WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

Pages:     ||
|

-

Около пос. Танхой

4

-

Муринская Банка

7

3

Около пос. Утулик

3

5

Около пос. Култук

1

2

М. Половинный

4

4

Около г. Байкальск

-

3

Всего

129

109

Экстракция ДНК. ДНК экстрагировали по модифицированному методу Дойла и Диксона (Doyle J.J., Dickson E., 1987) или методу Соколова (Sokolov E.P., 2000).

Амплификация ДНК. Амплификация фрагмента гена СО1 производилась методом ПЦР с использованием пары универсальных для беспозвоночных праймеров, фланкирующих фрагмент ДНК размером 710 п.н. (Folmer, 1994) и имеющих следующую структуру: L1490: 5 - GGTCAACAAATCATAAAGATATTGG - 3;

H2198: 5 - TAAACTTCAGGGTGACCAAAAAATCA - 3

Амплификацию фрагмента ITS1 проводили методом ПЦР, при помощи праймеров КР-2 (Salim and Maden, 1981) и 5,8S (Nazar and Roy, 1978), имеющих следующую структуру: ITS1 KP-2: 5 - AAAAAGCTTCCGTAGGTGAACCTGCG - 3;

ITS1 5,8S: 3 - AGCTTGGTGCGTTCTTCATCGA - 3

Определение нуклеотидных последовательностей. Прямое секвенирование двухцепочечных продуктов амплификации проводилось на автоматическом секвенаторе модели 373А фирмы “Applied Biosystem Inc.” с набором реактивов “Thermo Sequenase II dye terminator cycle sequencing kit” фирмы “Amersham pharmacia biotech”, а также на автоматическом секвенаторе CEQ 8800 (Beckman Coulter Inc.) с набором реактивов “Dye Terminator Cycle Sequencing with Quick Start Kit” фирмы “Beckman Coulter”, при помощи тех же праймеров (L1490 и H2198; Кр-2 и 5,8S).

Морфометрия. Все раковины моллюсков в рамках каждого сбора были измерены и сфотографированы, на основе чего создана компьютерная база данных. Промеры проводили с помощью бинокуляра, и только в случае очень крупных раковин использовали штанген-циркуль. Раковины измеряли по стандартной схеме (Жадин, 1952), дополненной измерениями ширины и высоты каждого из пяти оборотов, расположенных над устьем. Для статистического анализа данных использовали программы Excel и Statistica 6.0. Для оценки степени дивергенции между группами B. carinata вычисляли коэффициент Майра, определяемый как разность средних значений признаков в сравниваемых популяциях, деленная на сумму среднеквадратических отклонений (Майр, 1971).

Компьютерная обработка данных. Выравнивание нуклеотидных последовательностей СО1 и ITS1 проводилось с помощью программы BioEdit (Hall, 1999). Генетические расстояния между нуклеотидными последовательностями оценивали с помощью двухпараметрической модели Кимуры (Kimura, 1980) для чего использовали программу DNADist из пакета программ Phylip (Felsenstein, 1996). Филогенетические древа строили методом максимального правдоподобия (Maximum Likelihood, ML) (Felsenstein, 1981) с помощью программы Phyml (Bevan, et al 2005) и баесовским методом, программой MrBayes (Ronquist, Huelsenbeck, 2003). Популяционные параметры 0 и g вычисляли с помощью программы FLUCTUATE из пакета программ LAMARC (Kuhner et al., 1995). 0 - характеризует размер популяции и описывается формулой 0=4Ne, где Ne – эффективная численность популяции, - скорость накопления мутаций на сайт за поколение. Скорость изменения описывается выражением d/dt= 0egt Параметр g (growth) характеризует изменение численности популяции и определяется как g=[t-1].

Для изучения популяционной структуры строили простирающиеся древа методом максимальной экономии (Maximum Parsimony, MP) с помощью программы NetWork (Bandelt et al., 1995; Bandelt et al., 1999).

Для оценки достоверности генетических отличий между выделенными нами популяциями использовали критерий Манна и Уитни.





РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ


Исследование нуклеотидных последовательностей CO1 и ITS1

В ходе исследования нуклеотидные последовательности фрагмента митохондриального гена СО1 длиной 588 п.н. определены для 109 представителей B. carinata, собранных из 29 районов озера Байкал и для 20 представителей близкородственных видов B. carinatocostata, B. carinata rugosa, B. turriformis (табл.1). Последовательности частично депонированы в GenBank, номера доступа DQ436347 - DQ436441.

Для всех нуклеотидных последовательностей установлена единственная и непрерывная рамка считывания, проведена проверка на отсутствие стоп-кодонов.

В пределах вида B. carinata содержится по фрагменту CO1 обнаружен 31 вариабельный сайт. Из всех выявленных вариабельных сайтов 27 содержат только транзиции, а 5 - трансверсии, несинонимичных замен – 1. Внутри рода Baicalia выявлено 60 вариабельных сайтов из них содержащих транзиции - 46, трансверсии - 16, несинонимичных замен – 3. Среди всех нуклеотидных последовательностей по фрагменту мтДНК обнаружено 59 уникальных гаплотипов.

Нуклеотидные последователь-ности фрагмента ITS1 ядерной ДНК длиной 360 п.н. определены для 95 представителей B. сarinata, собранных из 25 районов о. Байкал и 14 представителей близкородственных видов: B. carinatocostata, B. turriformis, B. carinata rugosa, B. dybowskiana carinatoides (табл.1).

Из всех исследованных нуклеотидных последовательностей по фрагменту ядерной ДНК 52 - уникальных.

Изучение популяционного полиморфизма B. carinata по митохондриальному маркеру

Исследование пространственно-генетической структуры B. carinata мы проводили с помощью простирающегося древа, построенному по фрагменту гена СО1 мтДНК методом максимальной экономии (Maximum Parsimony, MP).

На простирающемся древе, построенном на основе нуклеотидных последовательностей фрагмента митохондриального гена СО1 видно, что все исследованные улитки B. carinata формируют две группы, связанные между собой одной достаточно длинной веткой и соответствующие двум большим географическим ареалам: восточный берег Байкала (от губы Аяя до Танхоя) и западный берег, включая весь Южный Байкал (от Муринской Банки до о. Ярки), которые мы назвали Восточной и Юго-Западной популяциями соответственно (рис. 1). На древе также хорошо видно, что все сестринские виды образуются в его разных частях от вида B. carinata и формируют самостоятельные, четко различимые клады. То же касается и B. carinata rugosa, таксономический статус которого в настоящее время не ясен. Это свидетельствует о том, что исследуемый нами вид B. carinata является предковым для всех других видов рода Baicalia.


Рис. 1. Простирающееся древо, построенное на основе фрагмента гена СО1 мтДНК методом максимальной экономии. Разными цветами обозначены популяции вида B. carinata и его близкородственные виды.

Для более подробного исследования особенностей эволюции каринат, построили филогенетическое древо методом максимального правдоподобия (Maximum Likelihood, ML), с помощью программы Phyml (Bevan et al., 2005) для набора расшифрованных нуклеотидных последовательностей фрагмента гена СО1, принадлежащим особям вида B. carinata. В качестве аутгрупп выбрали один из сестринских видов – B. carinatocostata, а также один из самых далеко отстоящих видов по отношению к каринатам – Pseudobaicalia elegantula из сем. Baicaliidae.

Как и на простирающемся, на филогенетическом древе, построенном на основе последовательностей СО1, полученных в рамках данного исследования и взятых из GeneBank (номера доступа Z92986, Z92992) для других видов семейства Baicaliidae видно, что B. carinata также распадается на две клады по местообитанию: Восточную и Юго-Западную (рис. 2 А). Первая клада включает в себя моллюсков из Чивыркуйского залива, Гремячинска, м. Понгонье, о. Лиственничный, губы Таланка и м. Тонкого (Восточная популяция). Во вторую кладу входят представители, населяющие пос. Култук, пос. Утулик, Муринскую Банку, пос. Большие Коты, б. Песчаная, пролив Ольхонские Ворота, б. Тутайская, губа Семисосенная, о. Ярки (Юго-Западная популяция). Границы популяций и их локализация по периметру оз. Байкал, в соответствии с полученными молекулярно-филогенетическими данными показаны на рис. 2Б.






А Б


Рис. 2. А. Молекулярно-филогенетическое древо, построенное методом максимального правдоподобия по двухпараметрической модели Кимуры, на основе нуклеотидных последовательностей мтДНК фрагмента гена СО1. Бутстрепные поддержки приведены только для значимых узлов. Курсивом выделены другие виды сем. Baicaliidae. Б. Географическая дифференциация вида Baicalia carinata в озере Байкал.

Анализ внутригруппового распределения попарных генетических дистанций для Восточной популяции показал, что наибольшее число последовательностей отличаются одним процентом замен (общее количество вариабельных сайтов равно шести), тогда как для Юго-Западной популяции эта цифра возрастает до 4,6% замен (27 вариабельных сайтов). То есть, по сравнению с крайне полиморфной Юго-Западной группой улиток, Восточная популяция достаточно однородна и имеет небольшой размах по генетическому полиморфизму. На графике межгруппового распределения попарных генетических дистанций видно, что область наиболее часто встречающихся последовательностей смещена в сторону больших генетических дистанций, это свидетельствует о том, что мы имеем дело с разными популяциями (рис. 3).

Рис. 3. Графики попарного распределения генетических расстояний внутри и между группами. X – попарное распределение генетических расстояний (% замен), Y – вероятность встречаемости двух последовательностей с одинаковыми генетическими расстояниями.

Для обеих популяций оценили важнейшие параметры 0 и g, характеризующие популяции (табл. 2).

Таблица 2. Значение параметров 0 и g для двух популяций

Полученные данные свидетельствует о том, что Восточная популяция при относительно небольшом эффективном размере численности и генетической однородности (параметр 0 равен 0,0054) очень быстро растет, то есть ее эффективный размер постоянно возрастает (параметр g равен 360,44). В то время как Юго-Западная популяция при большем эффективном размере и генетической вариабельности (0 составляет 0,0306) растет довольно медленно (параметр g равен 81,98). Такой результат объясняется тем, что восточный берег, как правило, песчаный и пологий, больше пригоден для жизни этих улиток, чем крутое западное побережье, где песчаные пляжи прерываются выходами скал.


Изучение популяционного полиморфизма B. carinata по ядерному маркеру

Далее, построили простирающееся древо на основе нуклеотидных последовательностей внутреннего транскрибируемого спейсера ITS1 (рис. 4).

В отличие от простирающегося древа по фрагменту СО1, где каринаты образуют две отдельные группы, соединенные одной ветвью (рис. 1), по ядерному маркеру такого четкого разделения на популяции нет. Заметна лишь тенденция к разделению B. carinata на группы, но эти группы перекрываются и связаны между собой более чем одной ветвью.


Рис. 4. Простирающееся древо, построенное на основе межгенного спейсера ITS1 яДНК методом максимальной экономии (Maximum Parsimony). Разными цветами обозначены популяции вида B. carinata и его близкородственные виды.

Точно также, как и для фрагмента гена СО1, кроме сетчатого древа мы построили еще и филогенетическое (рис. 5). В качестве аутгруппы использовали тот же самый близкородственный каринатам вид, что и для митохондриального древа - B. carinatocostata.

Фрагменты ITS1 содержат разные по длине вставки и делеции, поэтому мы использовали два особых способа для построения филогенетического древа. Первый из них заключается в том, что из последовательностей удаляются все сайты, содержащие делеции или вставки и филогенетическое древо сроится только с учетом нуклеотидных замен. В качестве модели генетических дистанций использовали двухпараметровую модель Кимуры (Kimura, 1980). Для построения другого филогенетического древа мы предположили, что вставки и делеции, подобно точечным заменам несут важную информацию об истории эволюционного процесса, поэтому имеющиеся последовательности представили в виде двухбуквенной записи, где одной буквой обозначили все нуклеотидные основания, другой – все делеции. Поскольку в таком наборе данных могут происходить замены только одного типа (одной буквы на другую), то в качестве модели генетических дистанций использовали модель Джукса-Кантора (Jukes, Cantor, 1969). Древа, полученные в результате применения обеих процедур, по топологии существенно не различались, и на них невозможно выделить клады, соответствующие географическим районам Байкала.


Рис. 5. Молекулярно-филогенетическое древо, построенное методом максимального правдоподобия по двухпараметрической модели Кимуры, на основе нуклеотидных последовательностей яДНК фрагмента ITS1 только с учетом мутаций. Курсивом выделен другой вид сем. Baicaliidae.

Pages:     ||
|



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.