   Добро пожаловать!

Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 10 |

Для выявлениятранскрипционного старта и промотераCALCRL геначеловека нами былиспользован метода быстрой амплификацииконцов кДНК (RACE). RACE является методом, основанным на использовании метода ПЦР ислужит эффективным методом в изолированииполной последовательности кДНКспецифических генов. Первоначально мыпровели дизайн ген-специфическогопраймера 5’CCCACAAGCAAGGTGGGAAAGAGTG,соответствующего первомуэкзону опубликованной последовательностиCALCRL геначеловека. РНКэндотелиальных клеток былатранскрибирована обратной полимеразой сприменением олиго-дТпраймера для получения одноцепочечнойкомплиментарной ДНК. Адапторные последовательности былилигированы к обоим концам полученной ДНКдля получения двухцепочечной кДНК.Лигированная ДНК была использована дляпроведения ПЦР сиспользованием ген-специфического иадапторного праймеров.

Использование метода5’-RACEпривело к амплификацииосновного продукта длиной 200 нуклеотидов (Рисунок 6). Данныйпродукт ПЦР был очищен методомизолирования из геля,просиквенирован, и полученнаяпоследовательность сравнена споследовательностью кДНК игеномной последовательностью c цельюопределения транскрипционного стартаCALCRL геначеловека. Наши данные привели к выявлениюначала транскрипции и позволилиопределить потенциальный промотер CALCRL гена, и поэтомусделать возможным проведение егоклонирования и анализа.

G-белок связывающийрецептор CL -ключевая молекула вадреномедул-линовых рецепторах.

CL экспрессирован вклетке в виде основно-
гликозилированного белкакоторый
локализирован вэндоплазматическом
ретикулуме. Белкимодифицирующие
активность рецептора (RAMPs)принимают
участие в терминальномгликозилировании,
транспорте CL к плазматическоймембране и
определяютфенотип гетеродимеров.
Гетеродимер CL/RAMP1 является
рецептором для CGRP (CGRP1рецептор), в
то время как CL/RAMP2 иCL/RAMP3
гетеродимеры посвоим Фармакологическимсвойствам являются соответственно AM1и AM2 рецепторами.

ТранскрипцияCALCRL гена в клетках и тканях человека.

(А) Преимущественнаяэкспрессия CALCRL мРНК в эндотелиальных клеткахполученных из разных органов человека. Экспрессия генанамного ниже внеэндотелиальных клеточных линиях ипервичных клеточныхкультурах. (Б) CALCRL мРНК локализуется в клетках сосудов микроциркуляторного русламатки как в эндометриальнойтак и миометриальной тканях(стрелки), ноне эпителиальных гландах(короткие стрелки) и строме(звезды)эндометрия (Э), либо гладкихмышцах (звезды) миометрия (М).Замороженные срезы гибридизированы сантисенс-зондом меченым 35Sдля выявления локализацииCALCRL мРНК (микроскопия с использованиемсветлого и темного полей). Сигналотсутствует прииспользовании сенс-зонда. СП– светлоеполе, ТП – темное поле.

Изначально нами былипроведены исследования промотера CALCRL гена, а также гетерогенность его транскриптов исубхромосомной организации вэндотелиальных клетках человека.

Определение началатранскрипции CALCRLгена человека в эндотелиальных клетках с использованием метода 3’RACE.

Праймер специфичныйдля экзона 1 CALCRL гена (GSP-1)был использован для проведения 3’RACE реакции амплификации. (А) Амплифицирован-ныйпродукт размером 200 нуклеотидных пар для CALCRL гена человека (1) и 2500нуклкотидных пар длятрансферринового рецептора (TFR;2; контроль). GSP-1 (3), TFR (4) илисмесь унмверсальныхпраймеров (5) при использовании поодиночке не производят данных продуктов,указывая на ихспецифичность. Амплифициро-ванныйфрагмент CALCRL кДНК был выделен из геля, очищен ипросеквенирован для определения 5’нетранслированного участка (5’UTR;

untranslated region) CALCRL кДНК. (Б)Проведенное секвенирование позволилоточно определить начало

транскрипции CALCRL гена человека.

Клонирование ихарактеристика промотера CALCRL гена

Клонирование промотерабыло проведено с использованием данных5’RACE эксперимента. Нами былпроклонирован фрагмент геномной ДНКсоответствующий 2.3 кб дотранскрипционного старта. Конструкты5'-flanking участка были использованы в экспериментах с модифицированнымвектором для подтверждения роликлонированного участкаCALCRL гена в транскрипции [Nikitenko etal., 2003].Полученные данныеуказывают на то, чтоклонированный участок геномной ДНКдействительно обладает способностьюобеспечивать транскрипцию и поэтому вполневероятно что он является промотером CALCRL гена.

Кроме того,использование программы SIGNAL SCAN позволилоопределить потенциальныеучастки связывания известныхтранскрипционных факторов (ТФ), включаяNF-1, Sp1 иглюкокортикоидные рецепторы [Nikitenko etal., 2003].Кроме того, нами был проведен дополнительный анализпромотера, который позволил выявитьналичие участка ответа нагипоксию (hypoxia-respose element, HRE). Для выявления роли этого участка втранскрипции CALCRL гена вгипоксических условиях, нами был проведенмутагенез данногофрагмента промотера и соответствующиефункциональные исследования(Рисунок7).

Результаты данныхисследований подтвердили функциональнуюроль HRE в экпрессии CALCRLгена.

Рисунок 7

pGL3- CALCRL-516mut

pGL3- CALCRL-516mut_________________G__AT___ pGL3-CALCRL-516

pGL3-CALCRL-516CACACACACACACACGCCTAОтносительная активностьпромотера

А)Последовательностьнормальной и мутированной pGL3-CALCRL плазмид.pGL3-CALCRL-516вектор и pGL3- CALCRL-516mutпоследовательности pGL3-CALCRL-516 одинаковы(… … … ) за исключением заменытрех нуклеотидов (подчеркнуто) впоследовательности HRE мутированноговектора. (Б)Анализ транзитной экспрессиинормального и мутированноговекторов. ПервичныеЭКМР кожичеловека былитранфицированы с phPGK (для определенияравномерной трансфекции) и pGL3-CALCRL-516 либо pGL3-CALCRL-516mut.Трансфицированные клетки былипроинкубированы при 20% 02 в течение 4 часов,после чего проинкубированы при 20% 02 либо 0.1% 02 в течении 16 часов.pGL3/phPGTK отношение было определено длякаждой плазмиды и нормализовано крезультатам для pGL3-CALCRLв клетках при20% 02.Соотношение pGL3 (относительная активностьpGL3) было расчитано для определенияактивности участка HRE при гипоксии (mean±S.E.M.;one way ANOVA анализ).

Гетерогенность CALCRLтранскриптов

Проведенные намиэксперименты с использованием метода Northernblotting и CALCRL зонда выявили наличие несколькихРНК (данные не показаны), но в то же время5’-RACEэксперимент показал наличие только одногофрагмента (промотера) CALCRLгена (Рисунок 6). Поэтому намибыли проведены дальнейшие исследованиягетерогенности транскриптов CALCRL гена.

Нами был использованметод З’-RACE иклонирования амплифицированныхфрагментов для выявления гетерогенностиCALCRL транскриптов. Анализ полученныхклонов указал на наличие альтернативныхучастков терминации и полиаденилированияCALCRL гена

Субхромосомнаяорганизация CALCRL гена

Проведенные З’-RACE эксперименты иклонирование выявили наличие несколькихмРНК транскрибированных с CALCRL гена, а такженаличие первого интрона длиной 60-kb [Nikitenko etal., 2003]. Поэтому мы предположили чтопермиссивная транскрипция CALCRL генаобеспечивается уникальной структурой генав эндотелиальных клетках.

Мы провелиисследования регуляции промотера CALCRL гена втранскрипционно-пермиссивных(эндотелиальные клетки) и непермиссивных(неэндотелиальные клетки) клеткахчеловека. Для этого нами был использованG-less вектор и ядерные экстракты из клетокчеловека и проведен эксперимент потранскрипции in vitro [Ramadass et al., 2007]. Данные этогоэксперимента показали что промотер CALCRL гена может бытьактивен не только в эндотелиальных клеткахно и в неэндотелиальных клетках, посколькутранскрипционные факторы, активирующиеэкспрессию данного гена, присутствуют вядерных экстрактах тех и других клеточныхлиний [Ramadass et al., 2007].

Посколькуспецифическая экспрессия CALCRL гена наблюдаетсяв эндотелиальных клетках (Рисунок 5), нопромотер может быть активен и в другихклетках [Ramadass et al.,2007], этоподтверждает ранее вынесенноепредположение, что организация (трехмернаяструктура) данного генаразличается втранскрипционно-пермиссивных (ЭК) инепермессивных (неэндотелиальных клетках)человека.

Для проверки даннойгипотезы мы использовалиметод chromosomeconformationcapture (3CC) разработанный в лаборатории А.Акуличева (Sir William Dunn School of Pathology, University of Oxford, United Kingdom) для выявления субхромосомнойорганизации CALCRL гена [Akoulitchev et al., 2006;Ramadass et al., 2007]. Данный метод позволил нампроанализироватьтерхмерную структуру CALCRL гена втранскрипционно-пермессивных и непермиссивныхклетках человека. Результаты данногоэксперимента [Ramadass et al., 2007], подтверждают нашу гипотезу оналичии разных трехмерных структур CALCRL гена в эндотелиальных и неэндотелиальныхклетках человека. Наличие разнообразияструктур в CALCRL генеобеспечивается постоянной активностью РНКполимеразы и поэтому ее расположением в разных участкахданного гена при активной транскрипции вэндотелиальных клетках. Вто же время в неэндотелиальных клеткахструктура CALCRL гена указывает на то что, полимеразанаходится в одном доминирующем положении,которое препятствуетактивной транскрипции данного гена [Ramadass etal., 2007].

Таким образом,проведенные нами исследования указываютна то, что экспрессия CALCRL гена зависит прежде всего отклеточно- и ткане-специфического фона. Приэтом ключевым фактором вэкспрессии CALCRL гена является еготрехмерная субхромосомная структура, которая скорее всегообеспечивается эпигенетическимимеханизмами. В данных условиях активность промотераиграет вторичную роль.

Регуляция экспрессиифункционального CL рецептора в клетках итканях

Для выявлениямеханизмов регулирующих экспрессию CLрецептора необходимо изучение трансляции и экспрессии белка вклетках и тканях. Поэтому нами былиполучены и характеризованыспецифические антитела (АТ) против CLрецептора.

Разработка антителпротив CL рецептора и их характеристика

Для выработки антителпротив CL человека (кодируемого CALCRL геном) нами была выбрана стратегия с применениемсинтезированного пептида из 19 аминокислот,соответствующегокарбокси-окончанию белка (HDIENVLLKPENLYN; аминокислотная последовательность 427-461).Специфичность последовательности былапроверена с использованиемпрограммы CLASTP analysis [http://www.ncbi.nlm.nih.gov]Иммунизация новозеландскихкроликов была проведена после связыванияпептида с KLH(keyhole limpet haemocyanin). Сыворотка кроликов была забранаодин раз до и три раза после иммунизации (спромежутком в один месяц) для выявлениятитра полученных антител методом ELISA. После полученияудовлетворительного титра сывороткаиммунизированных животных была забрана и заморожена при -20С.

Анализ антител былпроведен с использованием методаиммуноблоттинга. кДНК CALCRLи RAMPs генов были клонированы в векторpcDNA3.1 (вектор для экспрессии в клетках млекопитающих) длясверхэкпрессии функциональныхгетеродимеров в клеточной линии HEK293T.CALCRL кДНК, содержащая полнуюпоследовательность кодирующую рецептор,была амплифицирована с использованием РНКполученной из эндотелиальных клеток. Белковые экстрактыполученные из клеточных линийсверхэкспрессирующие CL, CL+RAMP1или CL+RAMP2 были использованы для первичнойоценки поликлональныхантител выращенных против CL человека(Рисунок 8).

Временноэкспрессированный и эндогенный CL.

Кодирующая ДНК CALCRL геначеловека была

клонирована в pcDNA3.1– вектор дляэкспрессии в

клетках и названpcDNA3.1-CALCRL. Дляпроверки

функциональностиклонированной кДНКнами

была осуществленакоэкспрессия с RAMPs вклетках

HEK293T ианализ содержания цАМФпри

стимуляциисоответствующими лигандами. Дикий

тип HEK293T клеток неэкспрессирует эндогенных

AMи CGRP рецепторов, т.к.концентрация цАМФ в

ответна стимуляциюданными пептидами

отсутствует. В то жевремя в клетках HEK293T

которые содержаттрансфицированные CALCRLи

RAMPs человека, рецепторы активны(данные не показаны). Белковые экстракты из(А) клеток и (Б) тканей былипроанализированы методомSDS-PAGE при восстанавливающих условиях, ииммуноблоты обработаны первичнымиполиклональными антителами выращеннымипротив CL человека. (А) Антителаспецифически распознают CL человека в HEK293Tклетках трансфицированных толькоpcDNA3.1-CALCRL иливместе с RAMP1 или RAMP2 (CL+ RAMP1 или CL+ RAMP2; функциональными АМили СGRP рецепторами соответственно).Нетрансфицированные HEK293T клетки (MOCK) илитрансфицированные с вектором pcDNA3.1 или RAMP1или RAMP2 не экспрессируют CL. Разновидностирецептора массой ~40-45 кД (открытый ромб,основно-гликозилированный рецептор)присутствует в HEK293Tклетках трансфицированных только с pcDNA3.1-CALCRL. Рецептор массой~55 кД (закрытый ромб; терминальногликозилированный рецептор) производитсяклетками только в том случае коэкспрессииCL с RAMPs (детали эксперимента подегликозилированию указаны на Рис.35). (Б)Антитела также распознают эндогенный CLчеловека

экспрессированный втканях. Стрелка – дегликозилированный рецептор (~37кД). Иммуноблоты являются

экземпляром двухнезависимо проведенных экспериментов. Дляподтверждения равномерностиколичества

использованныхбелковых экстрактов были использованыантитела против -актина.

Данные проведенныхисследований с использованием методаиммуноблоттинга показали что антитела обладают высокойспецифичностью против трех форм CL – дегликозилированного, основно- итерминально-гликозилированного рецептора(Рисунок 8). Дляподтверждения данных выводов нами былипроведены эксперименты с использованиемэндогликозидаз F и H, с цельюопределения какие из детектируемых формрецептора являются основно-и какие терминально-гликозилированными(данные не показаны). После подтверждения специфичностиполученных антител, они были использованыдля проведенияиммуногистохимии и иммунофлуоресценции вразных тканях органов человека (Рисунок 9).

Локализация СL втканях человека.

Определениелокализации СL была проведена путем проведения методаиммуногистохимии на парафиновых срезах с использованием микро-чипатканей и первичных антител против СL человека и вторичных антителконъюгированных с щелочной фосфатазой,локализация которой выявлена с применением реактиваVector Red (красный цвет). Клеточные ядраокрашены гематоксилином(голубой цвет). Выявленопреимущественная локализация рецептора вэндотелиальных клеткахмикроциркуляторного русла (А) эндометрия,(Б) миометрия, (В)аденокарциномы, (Г) желтого тела, и (Д и Е)стромы (стрелки) и (Е) эпителии шейки матки (короткие стрелки).

Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 10 |

© 2011 www.dissers.ru - «Бесплатная электронная библиотека»