   Добро пожаловать!

Pages:     | 1 || 3 | 4 |

Флуоресцентная in situ-гибридизация. Приготовление давленых препаратов слюнных желез личинок Drosophila melanogaster осуществляли по описанной ранее методике (Biemont et al., 2002). Процедуру гибридизации выполняли по стандартному протоколу, состав гибридизационного раствора: 50 % формамид, 10% декстран-сульфат, 4SSC (0,6М NaCl; 0,6M цитрат натрия), 1хDenhardt (0,1 г фикола, 0,1 г поливинилпирролидона, 0,1 г BSA и до 10 мл H2O), 0,1 M фосфатный буфер (Na2HPO4-NaH2PO4, pH=7,6) и меченая ДНК зонда. Меченую ДНК добавляли из расчета 20 нг на препарат.

Для окрашивания хромосом использовали краситель DAPI с антифейдом (Vectashield, Vector ). Микроскопический анализ препаратов проводили на микроскопе Axioskop-2 Plus. Ввод цифровой информации осуществляли с помощью черно-белой ССD-камерыVC44 (PCO:) с матрицей 756 на 581 пикселя, PС (Pro, 500MH, 128 MB, 11 GB). Использовали пакеты программного обеспечения ISIS3 (In Situ Imaging System) компании MetaSystems GmbH.

ПЦР-анализ. Выделение ДНК из мух производили в соответствии с методикой (Bender et al., 1983). ПЦР-реакцию проводили в общем объеме 25 мкл, конечные концентрации веществ в растворе: магний хлористый – 4 мМ, праймеры– 1 мМ, dNTP – 0,4 мМ каждого, 1 буфер Taq-ДНК-полимераза (1,5 мМ MgCl2, 65 мМ Трис-HCl, pH=8,9, 16 мМ (NH4)2SO4, 0,05% Твин 20), Taq-полимераза 0,04 ед/мкл; геномную ДНК добавляли из расчета 20-50 нг на пробу. Для hobo-элемента использовали праймеры (gcgccatacataatgattg (5-праймер) и ctattgcgagttgtttag (3- праймер) Параметры ПЦР реакции: начальная денатурация 94°С, 3 мин., последующая денатурация 94°С, 30 сек., отжиг 54°С, 30 сек., синтез 72°С, 1мин. 40 сек., циклов 35, элонгация 72°С, 5 мин. Для Р-элемента использовали праймеры gagaggaaaggttgtgtgcggacga (прямой), gcttgcaataagtgcgagtgaaagg (обратный); параметры ПЦР реакции: начальная денатурация 94°С, 3 мин., последующая денатурация 94°С, 1 мин., отжиг 65°С, 1 мин., синтез 72°С, 2 мин., циклов 29, элонгация 72°С, 5 мин. (Sentry, 1994).

Статистическая обработка данных. Для подсчета достоверности различий между числом обнаруженных рецессивных летальных мутаций в контроле и опыте, а так же достоверности различий между частотой мутирования на клетку крыла в контроле и опыте применяли метод 2. Достоверность различий между частотой эксцизий и инсерций hobo- и P-элементов в Х-хромосомах D. melanogaster оценивали методом Фишера (Васильева, 2004).


Анализ популяции Drosophila melanogaster Умани на наличие/отсутствие hobo- и P-элементов. ПЦР-анализ линий D. melanogaster, выделенных из уманской популяции с 1979 по 2004 гг., на наличие полноразмерных и делетированных копий hobo-элементов показал, что полноразмерный hobo присутствует в геноме большей части исследованных линий, набор делетированных производных hobo-элемента в каждой линии уникален. В выборке 1979 г. присутствуют дефектные hobo-последовательности, следовательно, до начала периода вспышки мутабильности по гену yellow, которая была зафиксирована с 1982 по 1991 гг., в популяции Умани уже присутствовали делетированные hobo-элементы.

С помощью FISH-анализа проведена оценка количества и распределения hobo в Х-хромосомах уманских линий. Особи этой популяции различаются между собой как по количеству hobo-элементов, так и по сайтам их локализации в Х-хромосомах. Среднее количество hobo-элементов в Х-хромосомах разных линий составило 10,2, что является высоким по сравнению с данными для других популяций. Так, среднее число hobo на Х-хромосому для популяции Drosophila melanogaster Бийска составляет 2,7, для популяций Азербайджана – 4,8 (Biemont et al., 1988; Кожемякина, Фурман, 1995). По длине Х-хромосомы hobo-элементы распределены, в целом, равномерно, хотя можно указать “горячие” точки локализации hobo – районы 4EF, 7BC, 7D и 12EF. Районы 7ВС и 12 ЕF, согласно литературным данным, являются районами интеркалярного гетерохроматина (Zhimulev et al., 1982; Кожемякина, Фурман, 1995). Ранее было показано, что “горячие” точки локализации hobo-элемента примерно в 70 % приходятся на районы интеркалярного гетерохроматина, что говорит о предпочтительном встраивании hobo в гетерохроматиновые участки хромосом (Кожемякина, Фурман, 1995).

ПЦР-анализ ДНК уманских линий D. melanogaster показал, что большая часть исследованных линий не содержит полноразмерного Р-элемента. Для всех исследованных линий уманской популяции характерно присутствие четко выраженного сигнала, соответствующего размеру 1 тпн. Данные последовательности являются, вероятнее всего, КР-элементами – делетированными производными Р-элемента, широко распространенными в современных популяциях D. melanogaster (Black et al., 1987; Biemont et al., 1990b; Itoh et al., 2004).

Оценка линии y2-717 с помощью теста РСПЛМ. Оценивали активность hobo-элемента в нестабильной уманской линии y2-717 D. melanogaster по частоте возникновения летальных мутаций в Х-хромосомах (табл. 1).

Таблица 1. Частота возникновения рецессивных сцепленных с полом летальных мутаций в линии y2-717 из уманской популяции D. melanogaster.




Выявлено летальных мутаций


частота (x10-3)

Oregon R (контроль)




y2-717 (опыт)




* Результаты получены при участии М.П. Перепелкиной.

В линии y2-717 частота возникновения летальных мутаций составила 3,6x10-3; в контрольной линии Oregon R – 1,2x10-3. Разница в частоте возникновения рецессивных сцепленных с полом летальных мутаций между линиями статистически недостоверна, метод 2 (p< 0,05). Это свидетельствует о том, что, либо hobo-элемент не активен в y2-717-линии, либо его перемещения не зарегистрированы, поскольку не затрагивают важных генов. Таким образом, с помощью данного теста, нам не удалось подтвердить наличие активности hobo в линии y2-717.

Анализ распределения hobo- и Р-элементов в Х-хромосомах линии y2-717 и ее производных. С помощью флуоресцентной гибридизации in situ выявляли картину распределения и оценивали частоту транспозиций hobo- и P-элементов в Х-хромосомах линий y2-717 и фенотипически нормальных и мутантных y2717производных. Проведенный семейный анализ показал, что у каждой новой производной линии количество копий hobo на Х-хромосоме увеличивается (рис. 2).

Рис. 2. Число сайтов гибридизации hobo на Х-хромосомах в ряду y2-717-производных линий.

1- y2-717, 2- y2-717(15),

3- y+-717а, 4- y2-717а1,

5- y2-717а1к3, 6- y1t-717a1k3-2

Так, если на y2-717-Х-хромосомах 9 сайтов гибридизации hobo-элемента, то на Х-хромосоме производной линии y1t-717a1k3-2, которая появилась примерно через пятнадцать поколений от момента получения первой производной, число сайтов гибридизации hobo увеличилось в 3 раза (рис. 3). При сравнении рисунков

Рис. 3. In situ-гибридизация hobo-элементов на Х-хромосомах линии y2-717

и производной линии y1t717a1k32

(изображение инвертировано).

а) линия y2-717

б) линия y1t-717a1k3-2

распределения hobo в Х-хромосомах производных линий и исходной линии y2-717, частота перемещения hobo-элемента у производных достигает 1,2х10-2 на сайт, на Х-хромосому, за поколение (рис. 4).

Рис. 4. Анализ динамики hobo-элементов в Х-хромосомах производных линий в сравнении с исходной линией y2-717 D. melanogaster. 1- y2-717, 2- y2-717(15), 3- y+-717а, 4- y2717а1, 5y2717а1к3, 6- y1t-717a1k3-2. Различие между частотой эксцизий и инсерций hobo статистически достоверно: ** – (P0,99); *** – (Р0,999) (сравнение проводили внутри каждой линии); указана частота на сайт, на Х-хромосому, за поколение.

Из 9 сайтов гибридизации hobo, присутствующих на y2-717-Х-хромосоме, 8 сайтов сохраняются у всех проанализированных производных. Таким образом, “старые” сайты hobo проявляют высокую консервативность, при росте числа hobo-инсерций у y2-717-производных. Появляющиеся новые сайты локализации hobo так же обладают высокой устойчивостью – частота инсерций hobo в четырех линиях из пяти с высокой достоверностью превышает частоту эксцизий при сравнении сайтов локализации hobo на Х-хромосомах самцов производных линий с исходной линией y2-717 (рис. 4). Сходная ситуация описана для элемента Stalker – показано, что эксцизии этого МЭ происходят намного реже инсерций (Georgiev et al., 1990). Несмотря на то, что и Р- и hobo-элементы имеют сходный механизм перемещения, в большинстве исследованных нами линий разницы между частотой Р-эксцизий и Р-инсерций не обнаружено. Заметим, что Stalker – ретротранспозон, а Р и hobo – транспозоны. Вероятно, механизм перемещения не играет определяющей роли в образовании инсерций и эксцизий МЭ.

В двух производных линиях - y2-717a1k3 и y1t-717a1k3-2, обнаружена крупная инверсия Х-хромосомы - In(1)1B; 13CD, фланкированная hobo-элементами и образовавшаяся, вероятнее всего, при рекомбинации между двумя разнонаправленными hobo (Sheen et al., 1993; Lim, Simmons, 1994, Gray, 2000). Для линии y1t-717a1k3-2 характерны следующие свойства: (1) наличие эктопических контактов на Х-хромосоме и между хромосомами; (2) длительная нестабильность hobo, о которой свидетельствуют различия по распределению сайтов hobo-гибридизации на Х-хромосомах у всех взятых для анализа личинок; (3) сниженная продолжительность жизни мух (Захаренко, неопубликованные данные). Все эти события, возможно, связаны с возрастанием числа сайтов hobo в Х-хромосомах этой линии. Предполагается, что различия в местах расположения и числе мобильных элементов могут коррелировать с жизнеспособностью (Гвоздев, Кайданов, 1986). Также считается, что при скоплении большого числа МЭ одного семейства могут активизироваться процессы эктопической рекомбинации между этими МЭ, расположенными в негомологичных участках хромосом, что может приводить к снижению жизнеспособности организмов (Montgomery et al., 1987; Charlesworth et al., 1992). Возможно, эктопическая рекомбинация и инверсии являются защитными механизмами, “включающимися” в ответ на увеличенное число hobo-элементов на Х-хромосоме.

Подобная картина нестабильности описана в работах, где в системе скрещиваний, активизировавших транспозиции hobo и Stalker, наблюдали большое количество мутаций по разным локусам, были выявлены случаи аномальной рекомбинации и различные хромосомные перестройки (Буфф и др., 1992, 1993). Авторы считают, что существует общий механизм дестабилизации генома дрозофилы, вовлекающий процессы рекомбинаций и транспозиций МЭ и именно hobo-элементу может принадлежать решающая роль в запуске процесса дестабилизации. Возможно, что и в случае y2-717-производных серия последовательных скрещиваний привела к общей дестабилизации генома, с которой могут быть связаны наблюдаемые нами хромосомные перестройки, эктопическая рекомбинация, нестабильность hobo- и Р-сайтов гибридизации.

Почему же скрещивания между самцами линии y2-717 и самками линии С(I)DX,ywf/Y могли привести к дестабилизации генома и можно ли отнести данные скрещивания к дисгенным С помощью ПЦР-анализа мы выявили наличие полноразмерного hobo-элемента в геноме самок линии С(I)DX,ywf/Y, в то время как самцы исходной линии y2-717 и её производных не имеют полноразмерного hobo. Поскольку генетический состав аутосом у самок и самцов общий, полноразмерная копия или копии hobo-элементов должны быть в составе С(I)DX,ywf-хромосом, которые передаются только дочерям. Возможно, в цитоплазме яиц самок присутствует транспозаза в виде готового продукта и этим объясняется индукция транспозиций hobo у самцов. Есть данные, что для системы Н-Е, в отличие от Р-М системы гибридного дисгенеза, направление скрещивания не имеет значения (Blackman et al., 1987; Lim, 1988, Bazin, Higuet, 1996; OHare et al., 1998). Следовательно, hobo-гибридный дисгенез может иметь место у y2717производных.

Анализ распределения Р-элементов в Х-хромосомах производных линий выявил, что общее количество сайтов гибридизации Р-элементов в ряду производных изменяется незначительно (рис. 5). Однако, при сравнении картины локализации Р-элемента в Х-хромосомах исследуемых производных линий и исходной линии y2-717, частота Р-транспозиций у производных достигает 7х10-3 на сайт, на Х-хромосому, за поколение, что превышает спонтанный уровень.

Рис. 5. Число сайтов гибридизации P на

Х-хромосомах в ряду

y2-717-производных линий.

1- y2-717, 2- y2-717(15),

3- y+-717а, 4- y2-717а1,

5- y2-717а1к3, 6- y1t-717a1k3-2

По результатам ПЦР-анализа, ни у самцов линии y2-717 и производных линий, ни у самок линии С(I)DX,ywf/Y, не выявлено полноразмерного Р-элемента, хотя делетированные Р-последовательности в геноме этих линий присутствуют. Причина перемещения Р-элементов в исследуемых линиях остается неясной. Можно предположить, что делетированные Р-последовательности способны каким-то образом компенсировать друг друга и могут восстанавливать способность к продуцированию транспозазы – но это мало вероятно, или же возможна кросс-индукция Р-транспозиций транспозазой какого-либо другого МЭ. Хотя для Р-элемента данных по кроссмобилизации не приводилось, такая возможность не исключена (Sundararajan et al., 1999). Было обнаружено, что hobo-транспозаза способна взаимодействовать с терминальными последовательностями не только hobo-элемента, но и Hermes-элемента.

Pages:     | 1 || 3 | 4 |

© 2011 www.dissers.ru - «Бесплатная электронная библиотека»