WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     | 1 || 3 | 4 |   ...   | 5 |

51-70 лет

15-370

10-225

>71 лет

15-410

10-160

Генотипирование на наличие мутаций C282Y и H63D гена HFE (НГХ 1-го типа)

ДНК выделяли из цельной крови с помощью коммерческих наборов ДНК-Экспресс («Литех», Россия) и Puregene DNA Purification Kit (Gentra Systems, Minneapolis, MN, USA).

Генотипирование пациентов осуществлялось с использованием праймеров, указанных в табл. 2. В России ПЦР смесь состояла из 0,2mM каждого дНТФ, 1,5mM (для C282Y) и 2,5mM (для H63D) MgCl2, 0,6M каждого праймера, 0,04U Taq ДНК-полимеразы и ~100нг ДНК в общем объёме реакции 25L. Температурная программа: 95°С - 5мин; 30 циклов: 94°С - 40сек, 59°С (для C282Y) или 65°С (для H63D) - 40сек, 72°С – 40сек; далее 72°С - 5мин; 10°С – хранение. В Канаде для ПЦР смеси использовали 0,2mM каждого дНТФ, 1,5mM MgCl2, 1,25M каждого праймера, 0,025U Taq ДНК-полимеразы и ~100нг ДНК в общем объёме реакции 25L. Температурная программа была одинаковой для обеих мутаций: 94°С - 5мин; 29 циклов: 94°С - 30сек, 55°С - 30сек, 72°С - 1мин; далее 72°С - 7мин; 4°С – хранение.

Таблица 2.

Последовательность праймеров для генотипирования на наличие мутаций гена HFE

Мутация гена HFE

Праймер

Сиквенс (5-3')

Продукт (пн)

Россия

C282Y

F

R

CTACCCCCAGAACATCACCA

CTCCAATGACTAGGGTGCCA

394

H63D

F

R

AAGCTTTGGGCTACGTGGATGATCAG

CCCTCTCCACATACCCTTGCTG

212

Канада

C282Y

F

R

TGGCAAGGGTAAACAGATCC

TACCTCCTCAGGCACTCCTC

389

H63D

F

R

ACATGGTTAAGGCCTGTTGC

GCCACATCTGGCTTGAAATT

208

Рестрикционный анализ проводили с помощью ферментов RsaI и Ksp22I или DpnII для детекции C282Y и H63D у русских и канадских пациентов, соответственно («СибЭнзим», Россия и New England BioLabs Inc., Canada). Продукты рестрикции разделялись на 1,8% агарозном или 6% полиакриламидном геле.

Молекулярно-генетическое исследование других генов гемохроматоза

Из группы молодых канадских пациентов с риском гемохроматоза было просеквенировано 52 человека на наличие мутаций в генах других типов НГХ, манифестирующих в раннем возрасте (гены HJV, HAMP и FPN1). При этом 39 человек просеквенированы на наличие мутаций в генах HJV и HAMP, 18 пациентов – на наличие мутаций в гене FPN1.

Секвенирование генов HJV, HAMP и FPN1

ПЦР: Условия ПЦР и последовательность нуклеотидов праймеров, использованных для амплификации экзонов генов гемоювелина (HJV), гепсидина (HAMP) и ферропортина (FPN1) указаны в табл. 3. ПЦР всех экзонов проводились согласно следующей программе: 94°C - 5мин; 29 циклов: 94°C - 30сек, соответствующей температуры отжига (табл. 3) - 30сек, 72°C - 1мин; далее 72°C - 5мин; 4°C - хранение. Для всех анализируемых экзонов использовалась Taq ДНК полимераза из GIBCO-In Vitrogen Canada (Canadian Life Technologies/In Vitrogen Canada).

Секвенирование: В целях последующего секвенирования сразу за ПЦР проводили электрофорез в 0,8% агарозном геле с последующей экстракцией и очищением ПЦР продуктов с использованием QAquick Gel Extraction Kit (метод микроцентрифуг) (QIAGEN Inc., Canada). Для определения концентрации полученных продуктов проводили электрофорез в 2% агарозном геле, используя low DNA mass ladder (Canadian Life Technologies/In Vitrogen Canada). Для подготовки пробы к секвенированию использовали BigDye Terminator Ready Reaction Mix (Applied Biosystems, USA), соответствующее количество очищенного ПЦР продукта (табл. 3) и стандартные условия, рекомендуемые производителем. Секвенирование осуществляли на ABI PRISM 3100-Avant Genetic Analyzer. Результаты анализировали с использованием ABI Prism SeqScape Software версии 2,1 (Applied Biosystems, USA).

Рестрикционный анализ: Для проведения рестрикционного анализа 138пн ампликона гена FPN1 использовалась рестриктаза AhdI (New England BioLabs Inc., Canada). Реакция проводилась в условиях 37°C в течение 2 часов, за которой следовал электрофорез в 6% полиакриламидном геле. Замена A>G в составе праймера 6RM создаёт сайт распознавания для рестриктазы AhdI. В результате, 138пн ампликон разрезается с образованием 115пн и 23пн фрагментов. Лица, гомозиготные по аллелю wt, продуцируют один 138пн фрагмент, в то время как гетерозиготы по мутантному аллелю – 2 фрагмента – 138пн и 115пн.

Статистическая обработка

Статистическую обработку проводили с использованием программы Exel Microsoft Office (“Microsoft”). При анализе предполагаемых различий между выборками исходили из нуль-гипотезы об отсутствии различий, которую проверяли с помощью расчета критерия X2 и его сравнения с табличными данными. При малочисленных группах использовали критерий X2 с поправкой Йетца. Уровень значимости p<0,05 был принят достаточным для признания различий достоверными.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

1. Мутации C282Y и H63D гена HFE как причина гемохроматоза у лиц молодого возраста.

Распределение частот мутаций HFE

Из 137 человек русской выборки пациентов женщины составили 36%, мужчины - 64%. В канадской выборке, состоявшей из 201 пациента, соотношение лиц женского пола к лицам мужского было приблизительно одинаковым (женщины 51%, мужчины 49%). Средний возраст пациентов русской выборки составил 21 год, аналогичный показатель для канадской выборки - 22 года.

При расчете распределений по различным генотипам C282Y/H63D гена HFE получены следующие данные: для России YY/HH – 0%, CY/HD – 3%, CY/HH – 6%, CC/HD – 28%, CC/DD – 3%, СС/HH – 60%; для Канады YY/HH – 17%, CY/HD – 15%, CY/HH – 37%, CC/HD – 13%, CC/DD – 1%, СС/HH – 17% (рис. 1).

Таблица 3.

Последовательность праймеров и условия амплификации генов HJV, HAMP и FPN1

Экзон

Праймер

Сиквенс (5-3)

Продукт (пн)

Объём реакции (мкл)

[Mg] (mM)

T отжига (°C)

Количество ампликона (нг)

HJV

1

1F

1R

TCACACAAGCTGGAATTGGA

GAGACATCCAAGTAGGTGTTTGTAA

500

30

1,5

60

10

2

2F

2R

CCCCAAATTCCAGTCTGTT

CTCATTCAGGCTCACATGC

382

30

1,5

60

8

3

3F

3R

ACACTCCGATAGAGCAGAGG

GGAGCATTGCTGTTGAATAG

712

30

1,5

60

12

4

4aF

4aR

TGCACTGAACCCAAAATGAA

GGAGCTAAGAGGGTTGCTGA

625

30

1,5

60

15,5

4bF

4bR

ACTTTACCGTGGCAGCTCAG

CCTAGGCCCTGCTTCCTTTA

263

30

1,5

60

4

4cF

4cR

ATCGTCGGGGAGCTATAACC

TGCTTTCAGCTCTTGCCTCT

649

30

1,5

60

15

4dF

4dR

GGGGCTCTTCACCAATTTTT

TACTTCCGAGCCCTCTTTCA

491

30

1,5

60

8

HAMP

1

1F

1R

TTCCCGCTTATCTCTCCCGCCTT

CTCTCCCATCCCTGCTGCCCTG

321

60

1,8

69

10

2-3

2-3F

2-3R

TTTAAACCACTTGGAGAGGAGCAGG

TCGGCAGAGAGAAAGGACAACAGA

482

30

1,5

69

10

FPN1 (*праймер, содержащий замену нуклеотидов)

1

1F

1R

AAGGTTGACGGGAGCTCGTCTCGC

CTCGTGTAGAGTTGCTTGTCTCCA

572

100

2,5

68

10

2

2F

2R

ATTCTGCCCTCAGCTCATTAAGTG

AACTGGAAGTTGGCTTAATACAAC

221

100

2,5

65

4

3

3F

3R

GTCTCATAATGTAGCCAGGAAGTG

GTAGCTCAGGCATTGGTCCCATGA

326

100

2,5

65

5

4

4F

4R

GTGTGGATAAGAACAGTCTCACTG

ATACTTAATGAGTGCCTGTTGTGG

373

100

2,5

68

5

Pages:     | 1 || 3 | 4 |   ...   | 5 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»