WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

КЛОЧКОВА Татьяна Германовна

ИЗУЧЕНИЕ ИНФИЦИРОВАННОСТИ ЦИТОМЕГАЛОВИРУСОМ ЧЕЛОВЕКА ТКАНИ ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ У БОЛЬНЫХ РАКОМ ПРОСТАТЫ специальность:

14.01.12 - онкология

АВТОРЕФЕРАТ

диссертации на соискание учёной степени кандидата биологических наук

Санкт-Петербург 2012

Работа выполнена в Федеральном государственном бюджетном учреждении «Российский научный центр радиологии и хирургических технологий» Министерства здравоохранения и социального развития Российской Федерации, Санкт-Петербург.

Научный консультант: доктор биологических наук Евтушенко Владимир Иванович

Официальные оппоненты: д.м.н., проф.

Имянитов Евгений Наумович д.б.н., проф.

Козлов Андрей Петрович

Ведущая организация: СПбГУ

Защита состоится 13.03 2012 г. в часов на заседании диссертационного совета Д208.052.01 при ФГБУ «НИИ Онкологии им. Н.Н. Петрова» Минздравсоцразвития России по адресу: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68.

С диссертацией можно ознакомиться в Научной библиотеке ФГБУ «НИИ Онкологии им.

Н.Н. Петрова», на сайте Института www.niioncologii.ru и на сайте ВАК

Автореферат разослан «_____» _________________2012 г.

Учёный секретарь совета д.м.н., проф. Семёнов И. И.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Рак предстательной железы (РПЖ) является заболеванием сложной этиологии. На его возникновение и развитие влияет несколько факторов, из которых ключевыми являются старение организма, генетическая предрасположенность и условия окружающей среды.

Следует отметить, что в настоящее время ещё не все факторы выявлены и адекватно оценены, кроме того, неизвестно, насколько велико влияние того или иного фактора в развитии РПЖ.

Одним из таких малоизученных факторов является вирусная инфекция тканей предстательной железы (ПЖ). В силу особенностей своего расположения в организме ПЖ является резервуаром инфекции различной этиологии, в том числе, и вирусной. Роль вирусов в развитии онкологических заболеваний человека широко обсуждается в научной литературе. Накапливаюся данные о том, что вирусная инфекция может быть не только этиологическим фактором канцерогенеза, но и фактором, влияющим на прогрессию уже возникшей опухоли. В связи с этим, широко распространённые в человеческой популяции вирусы семейства Herpesviridae, некоторые члены которого обладают онкогенным и, возможно, онкомодулирующим потенциалом, привлекают особое внимание учёных. Одним из таких вирусов является цитомегаловирус человека (HCMV), выявленный во многих нормальных тканях и в опухолях различной этиологии (Michaelis, Doerr, Cinatl, 2009).

К настоящему времени накоплены многочисленные экспериментальные данные, свидетельствующие о значительном онкогенном и онкомодулирующем потенциале HCMV (Cinatl et al., 2004; Cobbs et al., 2007; Michaelis, Doerr, Cinatl, 2009 и др.). Показано, что в значительной степени этот потенциал может осуществляться за счёт функционирования вирусных генов IE72 и vIL10. В исследованиях, выполненных in vitro показано, что активность гена IE72 является ключевым фактором, определяющим функционирование геномов вируса и инфицированной клетки и взаимодействующим с системами пролиферации/гибели клетки, в то время как экспрессия vIL10 является одним из основных механизмов ухода клеток, инфицированных HCMV, от иммунного ответа (Cinatl et al., 2004;

Cheung et al., 2009). Однако, поскольку большинство исследований выполнено на моделях клеточных культур, существует настоятельная необходимость изучения активности цитомегаловируса в опухолях пациентов для оценки влияния вируса на ход канцерогенеза в клинической практике.

Инфицированность клинических образцов ткани простаты HCMV была показана ранее несколькими исследовательскими группами: Macasaet et al (1975), Rapp et al (1975), Schuman et al (1977), Geder, Rapp (1980). На современном уровне с использованием молекулярно биологических методов данные о высокой степени инфицированности ткани ПЖ HCMV у больных РПЖ были получены при изучении архивных образцов Boldogh et al (1983) и Samanta et al (2003). Однако, другие авторы, Bergh, Marklund et al., 2007, вообще не обнаружили ДНК и белков HCMV в ткани ПЖ у больных РПЖ, что ставит под сомнение результаты предыдущих авторов. Таким образом, данные об инфицированности цитомегаловирусом ткани предстательной железы при РПЖ носят противоречивый характер.

Возможно, одной из причин этого является различие в генетическом фоне, на котором происходит взаимодействие вируса и клетки. В связи с этим большое внимание исследователей привлекает ген RNASEL(HPCI) человека, участвующий с одной стороны в противовирусном ответе, а с другой - ассоциированный с семейными формами РПЖ. Вопрос о связи вирусной инфекции, РПЖ и аллельного состояния гена RNASEL до сих пор остаётся открытым (Silverman et al., 2010). Поэтому представляется актуальным проведение дальнейших детальных исследований этих вопросов, что позволит в перспективе не только понять причину противоречий в выводах исследователей, но и в конечном счёте определить роль цитомегаловирусной инфекции в возникновении и развитии рака предстательной железы.

Цель и задачи исследования Целью настоящего исследования является изучение инфицированности цитомегаловирусом ткани предстательной железы у больных раком простаты. Для реализации цели были поставлены следующие задачи:

1. Количественно оценить наличие ДНК цитомегаловируса в ткани предстательной железы у больных раком простаты в сравнении с тканью предстательной железы больных доброкачественной гиперплазией простаты.

2. Показать наличие или отсутствие транскрипционной активности цитомегаловируса в ткани предстательной железы у больных раком и доброкачественной гиперплазией простаты, изучив транскрипцию генов IE72 и vIL10 HCMV.

3. Изучить тканевую локализацию цитомегаловируса в предстательной железе у больных раком простаты.

4. Определить генотипы пациентов по мутации G1385A (Arg462Gln) в гене RNASEL человека.

5. Изучить ассоциацию инфицированности цитомегаловирусом ткани простаты, генотипа по мутации G1385A (Arg462Gln) в гене RNASEL человека и клинических показателей «уровень ПСА» и «сумма Глисона» у пациентов.

Научная новизна и практическая значимость полученных результатов В ходе выполнения данного диссертационного исследования впервые на свежезамороженном биопсийном материале методом ПЦР была проанализирована инфицированность цитомегаловирусом ткани ПЖ у больных раком и доброкачественной гиперплазией ПЖ и показана очень высокая степень инфицированности у больных данных категорий. Также впервые показана экспрессия генов НСMV IE72 и vIL10 в ткани ПЖ, причём экспрессия vIL10 выявлена только у больных РПЖ, тогда как экспрессия гена IE72 - как, у больных РПЖ, так и ДГПЖ. Генотипирование пациентов по мутации G1385A гена RNASEL человека позволило получить новые данные, демонстрирующие тенденцию к ассоциации генотипа пациента с инфицированностью ткани ПЖ HCMV и тенденцию к ассоциации генотипа пациента и инфицированностью ткани ПЖ HCMV со значением некоторых клинических прогностических показателей. В целом результаты работы вносят вклад в представление о широком распространении HCMV в ткани ПЖ, его онкомодулирующих свойствах и свидетельствуют о необходимости дальнейшего изучения инфицированности ПЖ с целью разработки наиболее адекватных подходов к лечению РПЖ.

Апробация работы Результаты работы были представлены на XIV, XV, XVII и XIX международных конференциях «СПИД, рак и общественное здоровье» (Санкт-Петербург, 2005, 2006, 2008, 2009, 2010); VI и VII Российских конференциях по фундаментальной онкологии «Петровские чтения» (Санкт-Петербург, 2010, 2011); научной конференции «Актуальные проблемы онкогенетики» (Москва, 2011); II международной конференции «Высокие технологии, фундаментальные и прикладные исследования в физиологии и медицине»; на международной конференции «Modern problems of genetics, radiobiology, radioecology and evolution» (Ереван, 2005); IV съезде онкологов и радиобиологов СНГ (Баку, 2006); I конгрессе Российского общества онкоурологов (Москва, 2006); VII съезде онкологов России (Москва, 2009 ); IV и VII Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика – 2010» (Москва,2002, 2010); на заседании Санкт-Петербургского общества урологов (Санкт-Петербург, 2006).

Публикации По материалам диссертации опубликовано 16 работ, из них 3 статьи (2 в рекомендованных ВАК журналах) и 13 тезисов докладов.

Структура и объём диссертации Диссертация состоит из введения и следующих глав: обзор литературы, материалы и методы, результаты исследований, обсуждение результатов работы и выводы. Работа иллюстрирована 16 таблицами и 8 рисунками. Библиографический указатель включает 3публикацию на русском и английском языках. Работа изложена на 153 страницах машинописного текста.

Работа выполнена в рамках госконтрактов №№ 16.552.11.7021 и 14.740.11.0011.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ В работе исследовали инфицированность ткани простаты HCMV у больных РПЖ и ДГПЖ.

Характеристика клинического материала Материал был предоставлен отделением урологии ФГБУ РНЦРХТ Минздравсоцразвития. В исследовании были использованы образцы опухолевой и прилегающей условно нормальной ткани ПЖ больных с диагнозами РПЖ и ДГПЖ, полученные в ходе операций радикальной простатэктомии или трансуретральной резекции простаты, а также образцы периферической крови этих больных, взятые непосредственно во время операций. Наличие опухолевой ткани в образце контролировали визуально и тактильно. Одну часть ткани каждого образца ПЖ сразу же замораживали в жидком азоте для последующего выделения нуклеиновых кислот, другую фиксировали в формалине и использовали для приготовления гистологических препаратов. В дальнейшем образцы были охарактеризованы в лаборатории патоморфологии Центра.

Были проанализированы ткани простаты и лимфоциты периферической крови пациентов в возрасте 50-89 лет. Из них 59 пациентов - с диагнозом РПЖ (стадии Т1 – Т4) и 19 пациентов - с диагнозом ДГПЖ (II, III стадии). Сумма Глисона у пациентов с диагнозом РПЖ варьировала в пределах 4 – 9, при этом 47,5 % пациентов имели значение суммы Глисона равное 6. Уровень простатспецифического антигена (ПСА) у этой же группы пациентов варьировал в пределах от 1,0 до 601,6 нг/мл, при этом медиана составила 7,нг/мл, среднее арифметическое – 25,4 нг/мл.

Выделение ДНК и РНК. Для выделения ДНК и РНК из одного образца ткани, образец делили пополам с помощью стерильного скальпеля и экстрагировали из одной части ДНК, а из другой – РНК. ДНК из образцов ткани и лейкоцитов выделяли протеиназно-фенольным методом (Blin, Stafford, 1976). Качество выделенной ДНК проверяли электрофоретически, спектрометрически и в реакции амплификации с праймерами к гену -актина человека (табл. 1). РНК выделяли гуанидин-изотиоцианатным методом (Chomczynski, Sacchi, 1987).

Всем препаратам ДНК и РНК, выделенным из тканей каждого пациента был присвоен индивидуальный номер.

Проведение ПЦР и ОТ-ПЦР. ПЦР на матрице ДНК, выделенной из тканей пациентов, проводили в амплификаторе GeneAmp PCR System 9700 (Applied Biosystems, США). Все реакции проводили в объёме 25 мкл в реакционном буфере, содержащем 2,5 мкл 10х буфера для Тaq-полимеразы, содержащего 25 мМ MgCl2, 0,2 мМ дНТФ, 0,4 мкМ каждого праймера, 1 ед. Тaq-полимеразы (Литех, Россия) и 200 нг ДНК или 2-5 мкл кДНК. Чувствительность метода позволяла определять 1 – 10 молекулы в реакции. Последовательности праймеров приведены в таблице 1.

Обратную транскрипцию проводили с использованием набора реагентов «Реверта» (Интерлабсервис, Россия) согласно инструкции производителя. Качество кДНК проверяли методом ПЦР с праймерами к кодирующей части гена PSA человека. Все праймеры для ОТПЦР были подобраны так, чтобы смысловой и антисмысловой праймеры лежали в разных экзонах (табл. 1).

Детекция продуктов экспрессии вирусных генов. Для детекции транскриптов вирусных генов метод прямой визуализации результатов ПЦР на электрофоретическом геле в УФ-свете оказался недостаточно чувствителен. Поэтому понадобился второй этап детекции – гибридизация с мечеными дигоксегенином зондами, последовательности которых были комплементарны внутренним участкам амплифицированных фрагментов кДНК. После электрофореза проводили капиллярный перенос ДНК по Саузерну на нейлоновый фильтр Hybond-NX (GE Healthcare, США). Затем фильтр с иммобилизованным продуктом ПЦР гибридизовали с меченым зондом и проводили детекцию с помощью набора Roche (Германия) и визуализацию сигнала с помощью набора Fermentas (Литва).

Таблица 1. Последовательности олигонуклеотидов, использованных в работе Название Последовательность праймера праймера Область генома CMVC1 5’-TGTGTCTGTCAAGTCTGAGC-3’ CMVC2 5’-TTTCACAGGCGTGACACGTT-3’ CMVC3 5’-CAGTGTCTGAGATAGAGGAA-3’ CMVC4 5’-TATTGAGTAGGATTACAGAG-3’ Область MIE HCMV MIEex4out 5’-CCGTCTGGGTATATTTTTTC-3’ MIEex2out 5’-GACACGATGGAGTCCTCTGC-3’ MIEex4in 5’-GTGCTCCTTGATTCTATGCC-3’ MIEex2in 5’-CAAGAGAAAGATGGACCCTG-3’ MIEprobe-5'-ACTCTGGAAACAGCGGGTCTCCCAGACTCAGC-3’ MIEprobe-5’-GTTGAGGAAGGAGGTTAACAGTCAGCTGAGTC-3’ F1 5’-TACAAAGCCGCAGTGTCGTCCAGAGGATTACG-3’ R1 5’-CAACAACCAGTCCATGACGCTGCATC-3’ В1 5’- GTAGATGGATTCTAGCGTCGAGCGCAT-3’ R5 5’- TCTCGAGTGCAGATACTCTTCGAGACGG-3’ ген vIL-10 HCMV P3 5’- CAGATTGCAAGATCTCCGCGTCACCTT-3’ 5vIL10 5’- GATGGATCCATGCTGTCGGTGATGGTC-3’ 3vIL10 5’- CTCGAATTCCTTTCTCGAGTGCAGAT-3’ R6probe-1 5’- GACCACCGTACCGTCGAGCCACACGGAG-3’ R6probe-2 5’-GTAGCAACGTGAGGACGACTACTCCGTGTG-3’ CMV-1984-F 5’-CCGAGACAAGATTGCATTGGCTGAACTGTT-3’ область TRL HCMV CMV-1984-R 5’- CCGTATGTCCTCCAAACCGTATCTCCTCAT -3’ hb329 ген-актина человека 5’-TGGCACCACACCTTCTACAA-3’ hb1102 5’-ACAGCGAGGCCAGGATGGAG-3’ PSA 16 ген PSA человека 5’-ACCTGCACCCGGAGAGCTGT-3’ (внешние праймеры) PSA 817 5’-TAGGGGTGCTCAGGGGTTGG-3’ PSA 188 ген PSA человека 5’-CTGCGGCGGTGTTCTGGTGC-3’ (внутренние праймеры) PSA 538 5’-CTGAAGTTTCTTTGGGGTCA-3’ RNASELmut1 ген человека RNASEL 5-AACATGAGGAAGATGAATTTGCTC-3 RNASELmut2 5-TTTCTAAGAGAGAATTGGGGATTG-Последовательности фрагментов генов, использованных для приготовления зондов к генам MIE и vIL10, приведены в таблице 1. Введение дигоксигенин-11-дУТФ (Roche, Германия) в зонды осуществляли методом достройки частично комплементарных фрагментов зондов с помощью Taq-полимеразы (Литех, Россия).

Анализ полиморфизма G1385A (Arg462Gln) в последовательности гена RNASEL. Для генотипирования пациентов использовали ДНК, выделенную из образцов их тканей и крови.

Генотипирование проводили методом аллельспецифической ПЦР, сопряжённой с рестрикцией (Бархаш, Кобзев и др. 2006). Для этого выделенную из образцов ПЖ ДНК подвергали ПЦР с двумя праймерами, последовательности которых представлены в таблице 1. В один из праймеров (граничащий с 3-конца с исследуемым участком полиморфизма) вводили некомплементарный нуклеотид – Т вместо С во второй от 3-конца позиции (см.

табл. 1). Это приводило к последующему изменению последовательности матрицы в процессе ее амплификации и тем самым к созданию нового сайта рестрикции для рестриктазы Taq I (TCGA) в случае последовательности дикого типа, т.е. G в положении 1385 гена RNASEL. После ПЦР проводили рестрикцию ферментом TaqI (Stratagene, США). В случае гомозигот G/G в 2% агарозном геле (NuSieve 3:1, FMC, США) наблюдали фрагмент размером 128 п.н. (второй фрагмент размером 24 п.н. не выявляется), а в случае гомозигот A/A – фрагмент размером 152 п.н., в случае же гетерозигот G/A наблюдали два фрагмента размерами 152 и 128 п.н. Для подтверждения достоверности результатов производили выборочное секвенирование ПЦР-фрагментов с использованием набора BigDye® Terminator v 3.1. Cycle Sequencing Kit фирмы “Applied Biosystems” с последующим анализом на генетическом анализаторе ABI PRISM 3100 по протоколам фирмы “Applied Biosystems”, США.

In situ гибридизация ДНК-ДНК. Поскольку при отборе материала мы не могли достоверно отделить опухолевую ткань от прилежащей нормальной ткани и стромы органа, были проведены эксперименты по локализации HCMV на тканевых срезах ПЖ. Для этого у больных РПЖ, предварительно охарактеризованных методом ПЦР как содержащие HCMV в ткани ПЖ, методом in situ гибридизации со специфической меченой дигоксегинином ДНКпробой определяли наличие ДНК HCMV и её распределение на гистологическом препарате.

В качестве зонда для гибридизации использовали эквимолярную смесь фрагментов ДНК HCMV, полученных в результате ПЦР с праймерами CMVC1/CMVC2, F1/В1, CMV-1984F/CMV-1984-R (табл. 1) и ДНК HCMV, предоставленной О.Ю. Шипулиной (лаб.

молекулярных методов Центра молекулярной диагностики, ЦНИИ эпидемиологии, Москва).

В качестве положительного контроля гибридизации использовали клонотеку 4-й хромосомы человека в векторе pBluescribe (Stratagene, США), предоставленную проф. И.Е. Воробцовой (лаб. радиационной генетики ФГУ РНЦРХТ). В качестве отрицательного контроля гибридизации использовали ДНК фага , предварительно расщеплённой рестриктазой Hind III (Stratagene, США). Зонды для гибридизации метили дигоксигенином с помощью фрагмента Клёнова ДНК-полимеразы I (Fermentas, Литва). Парафинизированные срезы препаратов ткани ПЖ были изготовлены в лаборатории патоморфологии Центра по стандартной методике. Гибридизацию проводили согласно методике, изложенной в руководстве компании Boeringer (Германия). Визуализацию результатов гибридизации проводили методом иммунологической детекции с помощью наборов Roche (Германия) и Fermentas (Литва). В каждом эксперименте использовали последовательные срезы исследуемого биоптата. Гибридизацию проводили с одним из 3-х зондов – комплексным HСМV-зондом, клонотекой 4-й хромосомы или ДНК фага . Оценку и фотодокументацию результатов проводили с помощью светового микроскопа, снабжённого цифровой камерой (Leica, Германия).

Статистическая обработка полученных данных. Для статистической обработки данных использовали программу AtteStat (http://narod.ru/disk/4031623001/AtteStat_32.exe.html) и Genepop (http://genepop.curtin.edu.au). Сравнение распределений различных показателей в группах пациентов между собой и с теоретически ожидаемыми распределениями производили с помощью точного критерия Фишера и критерия Фримана-Холтона. Оценку правдоподобия статистических гипотез проводили с помощью фактора Байеса (http://www.toad.net/~jkaplan2/bayesCategories.htm). Интерпретацию фактора Байеса проводили по Джеффрису (Jeffreys, 1961). Сравнение средних числовых значений в разных выборках производили с помощью критерия Ван дер Вардена.

В работе использовано оборудование Центра коллективного пользования лаб. генной инженерии ФГБУ РНЦРХТ Минздравсоцразвития РФ.

РЕЗУЛЬТАТЫ РАБОТЫ Определение инфицированности ткани ПЖ цитомегаловирусом методом ПЦР. Исследование инфицированности ткани ПЖ HCMV проводили методом ПЦР с праймерами к геномной области MIE HCMV и вирусному гену vIL10. Данные, полученные с использованием обоих праймеров совпали. Результаты анализа инфицированности у пациентов с разными диагнозами представлены в таблице 2. В целом инфицированность можно назвать очень высокой (до 67,8% у больных РПЖ), при этом инфицированность ткани ПЖ больных ДГПЖ несколько ниже (47,4%). Однако, статистический анализ (точный критерий Фишера, p = 0,173) не показал достоверных различий между долями инфицированных пациентов с диагнозом РПЖ и ДГПЖ, но фактор Байеса (В01 = 1,291), оценивающей правдоподобие гипотезы о том, что выборки РПЖ и ДГПЖ не различаются по инфицированности по отношению к альтернативной был незначителен по классификации Джеффриса (табл. 2). Это позволяет предполагать, что при увеличении размеров выборок различия по инфицированности ткани ПЖ HCMV у пациентов с диагнозами РПЖ и ДГПЖ были бы статистически подтверждены. Полученные нами данные в общем соответствуют результатам предшествующей работы Boldogh et al (1983) по соотношению инфицированности ПЖ у больных РПЖ (30%) и ДГПЖ (22%), однако, показатели инфицированности в нашей работе значительно выше. При этом Samanta et al (2003) были получены данные о практически 100%-ной инфицированности ткани ПЖ при РПЖ. Эти различия, вероятно, можно объяснить разными методическими подходами.

Таблица Сравнение инфицированности ткани простаты цитомегаловирусом у больных РПЖ и ДГПЖ Наличие ДНК HCMV в HCMV + HCMV - Всего Статистические критерии ткани Точный критерий Фактор Диагноз Фишера, p Байеса, ВРПЖ 40 19 (67,8%) (32,2%) (100%) 0,173 1,2ДГПЖ 9 10 (47,4%) (52,6%) (100%) Всего 49 29 (62,8%) (37,2%) (100%) Клетки периферической крови исследовались у 28 из 59 пациентов с диагнозом РПЖ.

ДНК HCMV в лейкоцитах была обнаружена только в пяти образцах (17,8 %). Причём, только у двух пациентов HCMV был найден одновременно в лейкоцитах и в ткани ПЖ (7,1 %). У троих пациентов (10,7%) с диагнозом РПЖ HCMV был обнаружен только в клетках крови, тогда как в ткани предстательной железы ПЦР сигнал отсутствовал. Для пациентов с ДГПЖ только в одном случае в клетках крови была выявлена ДНК HCMV, причём в образце ткани простаты этого пациента ДНК HCMV была также обнаружена. Наличие ДНК HCMV в клетках крови считается диагностическим признаком активной вирусной репликации в организме в целом (виремии). Полученные данные дают возможность предполагать, что у подавляющего большинства пациентов, 87,2% обследованных на предмет виремии, инфицированность HCMV ткани ПЖ не была связана с состоянием активной вирусной репликации.

Рисунок 1. Выборочные результаты ПЦР-анализа инфицированности пациентов. 1-7 – результаты 7 пациентов с индивидуальными номерами с 1 по 7; PС – проба ДНК, выделенная из ПЖ пациента с диагнозом РПЖ; BPH – проба ДНК, выделенная из ПЖ пациента с диагнозом ДГПЖ; В – проба ДНК, выделенная из лейкоцитов. А – результаты ПЦР с праймерами к области MIE HCMV; Б - результаты ПЦР с праймерами к гену vIL10 HCMV; В - результаты ПЦР с праймерами к гену -актина человека.

Выборочные результаты анализа положительных и отрицательных по ДНК CMV образцов приведены на рисунке 1.

Таким образом, можно сделать вывод, что инфицированность HCMV ткани ПЖ у исследованной группы больных РПЖ и ДГПЖ является высокой, в то время как инфицированность клеток крови значительно ниже. Доля инфицированных пациентов с диагнозом РПЖ выше (67,8%), чем пациентов с диагнозом ДГПЖ (47,4%).

Выявление транскриптов вирусных генов в ткани ПЖ. В работе была исследована экспрессия двух функционально важных вирусных генов IE72 и vIl10 в инфицированной HCMV ткани ПЖ больных РПЖ и ДГПЖ. Для этого были проведены гнёздные реакции ОТПЦР на матрице кДНК 13 пациентов с РПЖ и 5 пациентов с ДГПЖ. Анализ осуществляли методом гибридизационно-флуоресцентной детекции (см. Материалы и методы).

Предварительно препараты кДНК были протестированы на целостность и тканевую специфичность в реакции ПЦР с праймерами к гену PSA (рис. 2В). Для того, чтобы убедиться, что полученные в результате ОТ-ПЦР фрагменты имеют транскрипционное происхождение, для каждого гена параллельно с ОТ-ПЦР проводили ПЦР с соответствующими препаратами РНК, не прошедшими обратную транскрипцию. Во всех случаях в реакции ПЦР на матрице РНК без ОТ положительных сигналов выявлено не было (данные не показаны), что свидетельствует о транскрипционном происхождении продуктов амплификации, полученных в результате соответствующей ОТ-ПЦР.

Рисунок 2. Анализ экспрессии генов цитомегаловируса в ткани простаты. А - результат детекции продуктов амплификации с праймерами к гену IE72 ; Б - результат детекции продуктов амплификации с праймерами к гену vIL10; В - результат ПЦР с праймерами к гену PSA человека; Г - схема анализа экспрессии гена IE72; Д - схема анализа экспрессии гена vIL10. PC – дорожки на геле, соответствующие препаратам больных РПЖ, BPH – дорожки на геле, соответствующие препаратам больных ДГПЖ, номера дорожек соответствуют номерам препаратов; c- - отрицательный контроль; с+ - положительный контроль; М – маркер молекулярного веса; Ex1, Ex2, Ex3, Ex4 – экзоны генов IE72 и IL10, изображённые чёрными прямоугольниками, ломанными тонкими линиями изображены интроны генов, белыми прямоугольниками – пробы для гибридизации, стрелками указаны направления реакций полимеризации.

ОТ–ПЦР последовательности IE72 проводили с праймерами ко второму и четвёртому экзонам области MIE генома HCMV (рис. 2Г). На рисунке 2А видно, что во всех препаратах, где выявлено наличие последовательности, гомологичной IE72, присутствуют два основных фрагмента ОТ-ПЦР – большой, соответствующий по размеру несплайсированной форме IE72 (578 п.н.), и малый, соответствующий по размеру форме со сплайсированным третьим интроном и несплайсированным вторым (410 п.н.). Поскольку контрольная ОТ-ПЦР на матрице РНК не выявила никаких сигналов, можно заключить, что выявленные фрагменты представляют разные транскрипционные формы IE72 и/или продукты последовательного сплайсинга первичного транскрипта. Всего транскрипционные продукты гена IE72 удалось выявить у 7 пациентов с диагнозом РПЖ и у 3-х пациентов с диагнозом ДГПЖ.

Последовательность IE72 кодируется четырьмя экзонами геномной области HCMV MIE (рис. 2Г). Показано, что эта область генома HCMV кодирует несколько видов РНКпродуктов за счёт выбора различных рамок и цепей считывания при транскрипции, альтернативного сплайсинга и полиаденилирования. Показано, что кроме мажорных продуктов IE72 и IE86, возможно появление и минорных, часть которых может быть ассоциирована с латентизацией (Paulus, Nevels, 2009). Можно предположить, что обнаруженные нами транскрипционные формы также могут быть связаны с латентным состоянием HCMV, поскольку мы не смогли обнаружить признаки активной репликации вируса (см. предыдущий и следующий разделы).

ОТ-ПЦР последовательности vIL10 проводили с праймерами к 1-му (5vIL10, P3) и 3-му (3vIL10, R5) экзонам гена (рис. 2Д). На рисунке 2Б видно, что во всех препаратах, где выявлено наличие последовательности, гомологичной vIL10, присутствуют фрагменты ОТПЦР, соответствующие несплайсированной форме гена (552 п.н.). Кроме того, во всех этих препаратах, кроме препарата PC5, чётко виден дополнительный фрагмент, соответствующий по размерам форме РНК с двумя сплайсированными интронами (393 п.н.). Поскольку при ОТ-ПЦР на матрице РНК, не прошедшей обратную транскрипцию никаких сигналов обнаружить не удалось, можно сделать вывод, что выявленные фрагменты представляют, как и в эксперименте по выявлению экспрессии IE72, транскрипционные формы гена vIL и/или продукты последовательного сплайсинга этого гена. Интересно, что продукты транскрипции гена vIL10 удалось выявить только у 7 пациентов с диагнозом РПЖ, у пациентов с диагнозом ДГПЖ продуктов транскрипции этого гена выявлено не было вообще.

Ген vIL10 состоит из трёх экзонов и двух интронов. Рядом исследователей (Jenkins et al., 2004; Lin et al., 2008) показано, что при инфицировании различных культур клеток может экспрессироваться разнообразный спектр дифференцированно сплайсированных продуктов vIL10, часть из которых может быть связана с латентизацией. Опираясь на эти данные и на работу Cheung et al. (2009) можно предположить,что наши результаты указывают на то, что в ткани РПЖ в отличие от ДГПЖ идёт положительный отбор на клетки, экспрессирующие vIL10.

Таким образом, нами было показано, что вирусные гены IE72 и vILтранскрибируются в инфицированной HCMV ткани ПЖ больных РПЖ. Возможно, что транскрипция одного из них, vIL10, специфична для РПЖ.

Исследование распределения HCMV в ткани ПЖ методом гибридизации in situ. В результате проведённого исследования выяснилось, что сигнал, соответствующий ДНК HCMV, может распространяться как на опухолевую часть эпителия протоков ПЖ (рис. 3), так и на его нормальную часть. Кроме того, клетки стромы также могут быть в значительной степени инфицированы HCMV. Плотность сигнала у разных больных и в различных частях ткани ПЖ может варьировать от единичных сигналов до высокой. При этом ни в одном А. Б.

Рисунок 3. Гибридизация in situ гистологических срезов ткани простаты больного М-1. Увеличение 100Х. А – зонд HCMV, Б – положительный контроль, В – отрицательный контроль.

Стрелками показан гибридизационный сигнал.

В.

препарате не было выявлено характерных образований типа «совиный глаз» или гигантских клеток, свидетельствующих об интенсивной репликации вируса.

Определение генотипа пациентов по полиморфизму G1385A (Arg462Gln) в гене RNASEL человека. Для проверки предположения о том, что аллельное состояние гена RNASEL (локус HPC1) может иметь значение для возможности инфицирования ткани ПЖ HCMV, был проведён анализ наличия нуклеотидной замены G1385A в 1385-м положении гена RNASEL у пациентов с диагнозами РПЖ и ДГПЖ. Данная мутация приводит к замене аргинина на глутамин в последовательности белка и, как следствие, снижению активности фермента примерно в 3 раза. Для выяснения этого вопроса исследовали ДНК клеток крови и ткани простаты в нескольких повторностях от всех пациентов. Результаты приведены в таблице 3.

Таблица Распределение генотипов по полиморфизму G1385A гена RNASEL в зависимости от диагноза Генотипы GG GA AA Всего Статистические пациентов критерии Критерий Фактор Группы Фримана- Байеса, пациентов Холтона, p BРПЖ 18 27 14 (30,5%) (45,8%) (23,7%) (100%) 0,204 2,6ДГПЖ 8 10 1 (42,1%) (52,6%) (5,3%) (100%) 26 37 15 Всего пациентов (33,3%) (47,4%) (19,2%) (100%) После применения статистического анализа (сравнение выборок с помощью критерия Фримана-Холтона) оказалось, что группы не различаются по рапределению генотипов (p = 0,20). Однако, фактор Байеса оказался незначителен по классификации Джеффриса, поэтому можно предположить, что при увеличении размеров выборок, различие распределений генотипов среди больных РПЖ и ДГПЖ было бы статистически подтверждено. Были проанализированы отношения шансов (ОШ) для аллелей A и G локуса RNASEL и трёх возможных генотипов среди больных РПЖ и ДГПЖ. Оказалось, что с диагнозом РПЖ ассоциированы аллель А (ОШ = 1,89, 95%ДИ = 0,87; 4,10) и генотип АА (ОШ = 5,60, 95%ДИ =0,68; 45,78), однако 95% доверительные интервалы (95%ДИ) для этих показателей ОШ очень велики и включают значение равное 1, поэтому гипотезу об отсутствии ассоциации отбрасывать нельзя.

Для оценки ассоциации инфицированности HCMV с генотипом пациентов было также изучено распределение пациентов по генотипам в зависимости от наличия HCMV в ткани ПЖ. При сравнении выборок инфицированных и неинфицированных HCMV пациентов без учёта диагноза с помощью критерия Фримана-Холтона, оказалось, что выборки не различаются по рапределению исследуемых генотипов (p = 0,19). Анализ с помощью байесовской статистики позволили прийти к тому же выводу, поскольку байесовский фактор достаточно велик (B01 = 8,86), что по интерпретации Джеффриса свидетельствует о значительно большем правдоподобии гипотезы об отсутствии различий в выборках, чем альтернативной.

Мы предположили, что среди больных с разными диагнозами – РПЖ или ДГПЖ – распределение генотипов в изучаемом локусе в зависимости от инфицированности может быть различным. Результаты статистической проверки этого предположения приведены в таблицах 4 и 5.

Таблица Распределение генотипов по полиморфизму G1385A гена RNASEL в зависимости от инфицированности ткани простаты HCMV среди пациентов с диагнозом РПЖ Генотипы GG GA AA Всего Статистические пациентов критерии Критерий Фактор Группы Фримана- Байеса, пациентов Холтона, p B10 22 8 HCMV+ (25,0%) (55,0%) (20,0%) (100%) 0,932 10,65 11 3 HCMV- (26,3%) (57,9%) (15,8%) (100%) 15 33 11 Всего пациентов (25,4%) (55,9%) (18,6%) (100%) Для пациентов с диагнозом РПЖ критерий Фримана-Холтона не выявил различия между инфицированными и неинфицированными HCMV пациентами по распределению изучаемых генотипов (p = 0,93, табл. 4) Причём, байесовская статистика показала, что правдоподобие гипотезы об отсутствии различий является сильным по классификации Джеффриса (B01 = 10,62, табл. 4). Анализ отношения шансов показал слабую ассоциацию аллеля А (ОШ = 1,12, 95%ДИ = 0,51; 2,43) и ассоциацию генотипа АА (ОШ = 1,33, 95%ДИ = 0,31; 5,72) с инфицированностью ткани ПЖ HCMV у больных РПЖ. Однако, значение 95%ДИ, включающих ОШ = 1, не позволяют отбросить гипотезу об отсутствии ассоциации.

Для больных ДГПЖ применение критерия Фримана-Холтона также не выявило различий в распределении генотипов между инфицированными и неинфицированными HCMV пациентами (p = 0,48, табл. 5), но фактор Байеса в данном случае был незначителен по классификации Джеффриса (B01 = 2,87), что позволяет предполагать, что при увеличении размера выборки могут быть обнаружены статистически значимые различия в распределении генотипов по полиморфизму G1385A гена RNASEL в зависимости от инфици- Таблица Распределение генотипов по полиморфизму G1385A гена RNASEL в зависимости от инфицированности ткани простаты HCMV у пациентов с диагнозом ДГПЖ Генотипы GG GA AA Всего Статистические пациентов критерии Критерий Фактор Группы Фримана- Байеса, пациентов Холтона, p B3 5 1 HCMV+ (33,3%) (55,6%) (11,1%) (100%) 0,484 2,84 6 0 HCMV- (40,0%) (60,0%) (0%) (100%) 7 11 1 Всего пациентов (36,8%) (57,9%) (5,3%) (100%) рованности ткани простаты HCMV у пациентов с диагнозом ДГПЖ. Анализ отношения шансов показал, что среди больных ДГПЖ также, как в общей группе и среди больных РПЖ, с инфицированностью ассоциированы аллель А (ОШ = 1,48, 95%ДИ = 0,39; 5,71) и генотип АА (ОШ = 3,71, 95%ДИ = 0,13; 103,12). Однако, значение 95%ДИ, включающие ОШ = 1, не позволяют отбросить гипотезу об отсутствии ассоциации.

Таким образом, на основании выполненного статистического анализа можно предположить, что существует тенденция ассоциации носительства аллеля А и генотипа АА как с диагнозом РПЖ, так и, для больных ДГПЖ, с инфицированностью ткани ПЖ HCMV.

Для больных РПЖ ассоциация носительства аллеля А и генотипа АА с инфицированностью ткани ПЖ HCMV менее правдоподобна.

Сопоставление молекулярно-биологических и клинических данных. Многочисленные исследования, выполненные на культурах клеток, демонстрируют наличие у HCMV онкомодулирующих свойств (Cinatl et al., 2004; Cobbs et al., 2007; Michaelis et al., 2009 и др.), данных же, отображающих реальную клиническую картину, практически нет. Мы попытались изучить у пациентов с диагнозом РПЖ связь инфицированности ткани ПЖ HCMV и наличия мутантного по замене G/A в 1385-м положении аллеля гена RNASEL со следующими клиническими показателями: уровень ПСА в сыворотке крови до операции, сумма Глисона и проанализировать инфицированность и генотип умерших в течение 5-ти лет после перенесённой операции пациентов. Во всех выборках наблюдали отклонение от нормального распределения при анализе количественных показателей, поэтому средние значения сравнивали с помощью непараметрического критерия Ван дер Вардена.

Уровень ПСА в сыворотке крови считается маркером ростовых процессов в ПЖ, его величина обычно коррелирует с клинической стадией процесса и объёмом опухоли и является важным прогностическим показателем. Для 40 пациентов с HCMVинфицированной ПЖ уровень ПСА в среднем составил 17,0 нг/мл, а для неинфицированных пациентов – 14,1 нг/мл. Критерий Ван дер Вардена показал, что различия статистически незначимы (p = 0,173), несмотря на то, что для HCMVинфицированных уровень ПСА был несколько выше, чем для неинфицированных пациентов.

Сумма Глисона характеризует степень дифференцировки опухоли. Более низкому показателю суммы Глисона соответствует большая степень дифференцировки опухоли и лучший прогноз течения заболевания. Среди инфицированных HCMV пациентов среднее значение суммы Глисона составило 6,4, среди неинфицированных – 6,2. Критерий Ван дер Вардена показал, что различия статистически незначимы (p = 0,554), хотя значение суммы Глисона у неинфицированных пациентов несколько ниже, чем у инфицированных.

Известно, что 6 пациентов умерли в течение пятилетнего срока после операции, при этом у 5 из них в ткани ПЖ присутствовал HCMV. Следует отметить, что все умершие пациенты имели метастазы, в отличие от остальных пациентов.

Распределение средних значений прогностических показателей – уровень ПСА и сумма Глисона – по генотипам пациентов по полиморфизму G1385A гена RNASEL приведено в таблице 6.

Таблица Средние значения прогностических показателей у пациентов с различными генотипами по мутации G1385A гена RNASEL Генотипы GG GA AA Всего пациентов Средние значения показателей ПСА(нг/мл) 12,7 10,5 8,4 Сумма Глисона 6,6 6,5 5,7 Визуальный анализ данных таблицы 6 позволяет предположить, что наличие аллеля А в генотипе улучшает значения прогностических показателей (показатели у гомозигот GG хуже, чем у гетерозигот GA, а у них, в свою очередь хуже, чем у гомозигот АА). Однако, применение критерия Ван дер Вардена при попарном сравнении средних значений ПСА и суммы Глисона у пациентов с разными генотипами позволило показать, что статистически значимо отличаются только значения суммы Глисона гомозигот АА от аналогичного показателя гомозигот GG (p = 0,034) и гетерозигот GA (p = 0,028) при 5%-ном уровне значимости. Тем не менее, тот факт, что тенденция к улучшению значений в зависимости от генотипа наблюдается сразу для обоих показателей, позволяет предположить, что при больших размерах выборок, достоверность различий при всех попарных сравнениях средних будет подтверждена.

Из 6 пациентов, умерших в течение пятилетнего срока после операции, 4 имели генотип GG, 1- GA и 1 – AA, что также позволяет предполагать наличие тенденции негативного влияние аллеля G в генотипе на течение заболевания.

Проведённый анализ связи инфицированности ткани ПЖ, генотипа пациентов по полиморфизму G1385A гена RNASEL и клинических показателей больных РПЖ позволяет предположить, что, возможно, существует три независимые разновероятные тенденции: 1) ткани ПЖ пациентов-носителей аллеля А несколько чаще инфицируются HCMV; 2) инфицированные пациенты имеют менее благоприятные значения прогностических показателей; но, при этом, 3) пациенты-носители аллеля А имеют более благоприятные значения прогностических показателей независимо от инфицирования ткани ПЖ HCMV.

ВЫВОДЫ 1. Показана высокая степень инфицированности ткани предстательной железы цитомегаловирусом у больных РПЖ, составившая 67,8%, при этом, инфицированность ткани ПЖ у больных ДГПЖ была ниже и составила 47,3%.

2. У подавляющего большинства больных РПЖ (87,2%) отсутствовала виремия; вирус находился в латентном (репликативно-неактивном) состоянии, не было выявлено избирательной инфекции опухолевых элементов ткани по сравнению с неопухолевыми.

3. Впервые у больных раком и доброкачественной гиперплазией предстательной железы выявлены транскрипты генов цитомегаловируса IE72 и vIL10 в ткани ПЖ, причём транскрипты vIL10 обнаружены только у больных раком предстательной железы.

4. Генотипирование больных РПЖ и ДГПЖ по мутации G1385A в гене RNASEL показало, что у больных ДГПЖ носительство аллеля А имеет тенденцию к ассоцииации с фактором инфицированности ткани простаты, тогда как у больных РПЖ носительство аллеля А имеет тенденцию к ассоцииации как с наличием заболевания, так и с более благоприятными значениями некоторых прогностических показателей.

5. Инфицированность ткани ПЖ цитомегаловирусом имеет тенденцию к ассоциации с менее благоприятными значениями клинических показателей «уровень ПСА» и «сумма Глисона» у изучаемой группы больных РПЖ.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1.: Клочкова Т.Г., Виноградская Г.Р. Оптимизация ПЦР-диагностикума для мониторинга цитомегаловирусной инфекции : количественная конкурентная одностадийная реакция // Тезисы 4-й Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний». - Москва: Центральный НИИ Эпидемиологии Минздрава России, 2002. - С.112-114.

2 Клочкова Т.Г., Евтушенко В.И. Анализ инфицированности ткани предстательной железы цитомегаловирусом и другими вирусами герпесной группы у больных раком простаты // Русский журнал «СПИД, рак и общественное здоровье». - 2005. - Т.9. - С.

61.

3 Klochkova T.G., Shkolnik M.I., Evtushenko V.I. Analysis of the cytomegalovirus infection in human prostate and prostate carcinoma tissues // Abstracts of International conference « Modern problems of genetics, radiobiology, radioecology and evolution». - Dubna: Joint Institude for Nuclear Research, 2005. - P.70.

4 Клочкова Т.Г., Андабеков Т.Т,, Школьник М.И., Карелин М.И., Евтушенко В.И.

Анализ инфицированности ткани предстательной железы цитомегаловирусом и вирусом Эпштейна-Барра у больных раком простаты // Русский журнал «СПИД, рак и общественное здоровье». - 2006. - Т.10. - С. 19.

5 Клочкова Т.Г., Андабеков Т.Т., Школьник М.И., Евтушенко В.И., Карелин М.И.

Изучение инфицированности цитомегаловирусом ткани простаты и лейкоцитов крови у больных раком и доброкачественной гиперплазией предстательной железы // Материалы 4-го съезда онкологов и радиобиологов СНГ. - Баку, 2006. - С.207.

6 Андабеков Т.Т., Клочкова Т.Г., Урбанский А.И., Школьник М.И., Карелин М.И., Евтушенко В.И. Анализ инфицированности ткани предстательной железы цитомегаловирусом и другими вирусами семейства Herpesviridae у брольных раком и доброкачественной гиперплазией простаты // Материалы I конгресса Российского общества онкоурологов. - Москва, 2006. - С.21.

7 Клочкова Т.Г., Андабеков Т.Т., Самсонов Р.Б., Карелин М.И., Школьник М.И., Семёнов А.В., Виноградская Г.Р., Евтушенко В.И. Анализ инфицированности предстательной железы цитомегаловирусом у больных раком и доброкачественной гиперплазией простаты // Медицинский академический журнал. - 2008. - Т. 8. - С. 64 -70.

8 Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Изучение функциональной активности цитомегаловируса человека в клетках предстательной железы у больных раком и доброкачественной гиперплазией простаты // Русский журнал «СПИД, рак и общественное здоровье». - 2008. - Т.12. - С. 23.

9 Андабеков Т.Т., Клочкова Т.Г., Урбанский А.И., Самсонов Р.Б., Школьник М.И., Евтушенко В.И., Карелин М.И. Более низкая степень дифференцировки рака предстательной железы может быть связана с цитомегаловирусной инфекцией ткани простаты // Вопросы онкологии. - 2009. - Т. 5. - С. 183 – 186.

10 Андабеков Т.Т., Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Влияние цитомегаловирусной инфекции на эффективность лечения рака предстательной железы // Материалы VII съезда онкологов России. - Москва, 2009. - Т. 2. - С. 88.

11 Самсонов Р.Б., Клочкова Т.Г., Андабеков Т.Т., Школьник М.И., Карелин М.И., Евтушенко В.И. Цитомегаловирусная инфекция ткани предстательной железы у больных раком и доброкачественной гиперплазией предстательной железы // Вопросы онкологии. Тезисы 6-й Российской конференции по фундаментальной онкологии. - Санкт-Петербург: ФГУ НИИ онкологии им. Петрова Росмедтехнологий, 2010. - С.39.

12 Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Инфицированность ткани предстательной железы вирусами семейства Herpesviridae и HPV у больных раком предстательной железы// Русский журнал «СПИД, рак и общественное здоровье». - 2010. - Т.14. - С. 22.

13 Самсонов Р.Б., Клочкова Т.Г., Евтушенко В.И. Диагностика вирусных инфекций при раке предстательной железы в ткани простаты // Сборник трудов VII Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика – 2010». - Москва: ФГУН ЦНИИЭ Роспотребнадзора, 2010. - Т. 4. - С.

118-119.

14 Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Изучение инфицированности ткани предстательной железы у больных раком простаты вирусами семейства Herpesviridae и HPV: оценка представленности и связь с клиническими показателями // Вопросы онкологии. Тезисы 7-й Российской конференции по фундаментальной онкологии. - Санкт-Петербург: ФГУ НИИ онкологии им. Петрова Росмедтехнологий, 2011. - С.37.

15 Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Анализ полиморфизма G1385A в гене RNASEL и инфицированности ткани простаты цитомегаловирусом у больных раком и доброкачественной гиперплазией предстательной железы // Материалы научной конференции «Актуальные проблемы онкогенетики»». - Москва: Медикогенетический научный центр РАМН, 2011. - С.11-12.

16 Клочкова Т.Г., Самсонов Р.Б., Евтушенко В.И. Клиническое значение молекулярной диагностики вирусных инфекций в ткани простаты у больных раком предстательной железы // Высокие технологии, фундаментальные и прикладные исследования в физиологии, фармакологии и медицине. Сборник статей под ред. Кудинова А.П., Крылова Б.В. - Санкт-Петербург: Изд-во Политехнического университета, 2011. - Т. 3.

С. - 167-169.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.