WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Ильницкая Елена Вячеславовна

СТРУКТУРА И ФУНКЦИИ НОВЫХ БЕЛКОВ РЕСПИРАТОРНОГО ЭПИТЕЛИЯ rSec14p и rYm1olf

02.00.10 – Биоорганическая химия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата химических наук

Москва - 2012

Работа выполнена в лаборатории белков гормональной регуляции Федерального государственного бюджетного учреждения науки Института биоорганической химии им. академиков М.М. Шемякина и Ю.А.

Овчинникова РАН

Научный консультант: доктор химических наук Шуваева Татьяна Маратовна

Официальные оппоненты: Румш Лев Давыдович, доктор химических наук, профессор, ИБХ РАН, руководитель подразделения Бабаков Алексей Владимирович, доктор биологических наук, профессор, ГНУ ВНИИСБ РАСХН, руководитель подразделения

Ведущая организация: Государственный научный центр Российской Федерации ФГУП Государственный научно- исследовательский институт генетики и селекции промышленных микроорганизмов

Защита диссертации состоится 10 октября 2012 года в 10 часов на заседании Диссертационного совета Д 002.019.01 при Федеральном государственном бюджетном учреждении науки Институте биоорганической химии им.

академиков М.М. Шемякина и Ю.А. Овчинникова РАН по адресу 117997, ГСП-7, Москва В-437, ул. Миклухо-Маклая, 16/10.

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждения науки Института биоорганической химии им. академиков М.М. Шемякина и Ю.А.

Овчинникова РАН.

Автореферат разослан 10 сентября 2012 года.

Ученый секретарь Диссертационного совета, доктор физико-математических наук В.А. Олейников

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Функцией эпителиальных тканей организма, как пограничного образования, непосредственно контактирующего с кислородом воздуха, является обмен веществ между организмом и окружающей средой.

Некоторые из этих тканей, в том числе обонятельный и респираторный эпителии, покрыты слизью, являющейся первым защитным барьером, обеспечивающим нормальное функционирование клеток эпителия и, следовательно, всего организма в целом. В условиях постоянного роста влияния на человека техногенных воздействий, изучение механизмов нарушения невосприимчивости организма к внешним условиям вызывает постоянный интерес.

Несмотря на значительные события, произошедшие за последние годы в развитии понимания механизмов, обеспечивающих барьерную функцию слизистых воздухоносных путей, клинического разнообразия условий, способствующих патологии процессов, и, как следствие, фармакотерапии, непрекращающийся рост социально-значимых бронхо-легочных заболеваний (астма, аллергия) приводит к выводу, что их причины многофакторны, далеко не все участники развития процесса идентифицированы и изучены, так как выделение природных белковых соединений в индивидуальном виде имеет свои специфические трудности.

Поэтому большой фундаментальный и практический интерес представляет задача поиска и определения новых молекул белков-аутоантигенов, способствующих хронизации воспалительных процессов слизистых, специфических маркеров и белков, формирующих проницаемость защитного слоя тканей, контактирующих с внешней средой. Эти вещества потенциально могут служить сначала основой системы выявления факторов риска - критериями прогнозируемости рецидивирующего течения, а затем и лекарственных препаратов, корректирующих вышеупомянутые заболевания.

Исходя из вышесказанного, структурно-функциональное изучение белков респираторного эпителия представляется значимым и интересным.

В лаборатории белков гормональной регуляции ИБХ в слизи обонятельного эпителия крысы были идентифицированы новые секреторные белки: основной антиоксидант контактирующих с окружающей средой тканей пероксиредоксин VI (PrxVI, Peshenko, 1998) и Sec14p-подобный белок (rSec14p, Merkulova, 1999). Анализ аминокислотной последовательности rSec14p показал, что в его составе присутствует липидсвязывающий домен SEC14. rSec14p широко представлен в слизистых оболочках эпителиальных тканей (его содержание в обонятельной выстилке составляет ~ 2 % от всех водорастворимых белков), формируя защитный слой контактирующих с внешней средой клеток, но его биохимическая и физиологическая роль была неизвестна. В 2009 году с использованием аллергических животных моделей (Shan L., 2009) была выявлена обратная зависимость между уровнем экспрессии гена rSec14p и степенью хронизации болезни. Недавнее исследование этих же авторов (Shan L., 2011) на трахее показало, что уменьшение экспрессии мРНК rSec14p в патофизиологических условиях, предусматривающих использование внешних воздействий, вызвано только гибелью клеток реснитчатого эпителия, в которых белок синтезируется, а не изменением уровня экспрессии его гена. Это обстоятельство сдерживает прогресс в понимании механизмов естественной невосприимчивости организма и требует дальнейших исследований rSec14p в условиях других патофизиологических моделей.

Открытием, с которым в последние годы связывается надежда на выявление новых перспективных терапевтических мишеней развития воспалений, явилось обнаружение в организмах млекопитающих представителей семейства гликогидролаз 18 - хитиназ и хитиназоподобных белков (chitinase-like proteins, CLPs). Показано, что накопление того или иного члена семейства гликогидролаз 18 является отрицательным прогностическим маркером многих заболеваний самой различной этиологии.

В данной работе описаны исследования структуры и функций двух новых секреторных белков обонятельного эпителия, вовлеченных в иммунный ответ организма, – липидсвязывающего rSec14p и защитного хитиназоподобного белка rYm1olf.

Цель и задачи исследования Данная работа является частью исследований, проводимых в ИБХ РАН по поиску и изучению белков, участвующих в обеспечении нормального функционирования эпителиальных тканей. Цель диссертационной работы состояла в определении функциональной роли белка rSec14p, поиске и идентификации его возможных биологических партнеров, а также структурно-функциональной характеризации новых белков, синтезирующихся на разных стадиях развития воспалительных реакций в слизистых оболочках. Для достижения поставленной цели потребовалось решить следующие задачи:

1. Выделить природный rSec14p в гомогенном состоянии, оценить уровень его экспрессии в патологически измененных объектах;

2. Идентифицировать новый обнаруженный белок обонятельного эпителия (в последствии назван нами rYm1olf), определить его полную аминокислотную последовательность, клонировать его структурный ген;

3. Разработать животную модель воспалительного заболевания в отсутствие внешних раздражителей и исследовать функциональную роль белков rSec14p и rYm1olf на разных стадиях развития защитной реакции организма.

Научная новизна и практическая значимость работы В процессе исследования белок rSec14p был получен в гомогенном состоянии, создана модель экспериментальных животных, на которой впервые было продемонстрировано резкое увеличение его количества в условиях острого воспаления по сравнению с контролем. При этом обнаружен новый ранее неизвестный белок с молекулярной массой 43 кДа.

С помощью масс-спектрометрии проведена идентификация нового белка и установлена его частичная аминокислотная последовательность.

Выяснено, что он относится к семейству гликогидролаз 18, резкое увеличение синтеза и секреции представителей которого в условиях формирования иммунной защиты, ассоциировано со слизистыми оболочками. В соответствии с местом локализации (epithelium olfacctorium) и подобием с мышиным белком Ym1, новый белок назван нами rYm1olf.

Определена и проанализирована полная нуклеотидная последовательность гена, кодирующего rYm1olf обонятельного эпителия крысы, включая участки его 5`- и 3`-нетранслируемых областей. Определена структура его мРНК. Последовательность полноразмерной кДНК rYm1olf депонирована в международную базу данных GenBank (под номером JF781276).

Установлена последовательность предшественника зрелой формы rYm1olf крысы. Полноразмерный зрелый белок rYm1olf содержит 3аминокислотных остатков и имеет молекулярную массу 42986 Да. При этом подтверждены ранее полученные данные о том, что хитин не является обязательным антигеном для индукции синтеза хитиназоподобных белков.

Разработаны и созданы крысиные модели с синдромами острого системного и хронического воспалений. С помощью ПЦР-анализа в реальном времени показано резкое синхронное увеличение уровней экспрессии rYm1olf и rSec14p в обонятельной выстилке модельных животных с острым воспалением на первые сутки, что говорит о совместном вовлечении этих белков в иммунный ответ организма. Все представленные в данной работе результаты получены впервые и приоритетны. Сделанные выводы весьма перспективны для возможного выявления изучаемого нами белка rSec14p как показателя развития воспалительных заболеваний воздухоносных путей.

Поскольку накапливание белков подсемейства CLPs в тканях является отрицательным прогностическим маркером многих воспалительных заболеваний самой различной этиологии, rYm1olf может стать потенциальной терапевтической мишенью при заболеваниях дыхательных путей.

Апробация работы По теме диссертационной работы опубликованы 3 статьи в рецензируемых научных журналах. Результаты работы представлены на российских и международных конференциях: Международной конференции FEBS «Новые концепции липидологии: от липидомики до болезней» (SM06-07) (Нидерланды, Нарвайкерхуд, 2006); IV и V Российских симпозиумах «Белки и пептиды» (Казань, 2009, Петрозаводск, 2011); Международной научной конференции по биоорганической химии, биотехнологии и бионанотехнологии, посвященной 75-летию со дня рождения академика Ю.

А. Овчинникова (Москва, 2009); Х чтениях памяти академика Ю.А.

Овчинникова (Москва-Пущино, 2011); ХХ Международной конференции и дискуссионном научном клуб «Новые информационные технологии в медицине, биологии, фармакологии и экологии» (Гурзуф, Украина, 2012).

Структура диссертации Диссертационная работа изложена на страницах машинописного текста и состоит из введения, обзора литературы, обсуждения результатов и экспериментальной части, основных выводов и списка цитируемой литературы, включающего ссылок. Материал иллюстрирован рисунками и таблицами.

СОДЕРЖАНИЕ РАБОТЫ

К началу настоящей работы в нашей лаборатории при изучении белкового состава слизи обонятельного эпителия крысы методом Ds-NaПААГ-электрофореза был обнаружен новый водорастворимый высокопредставленный белок (порядка 2% от всех водорастворимых белков обонятельного эпителия) rSec14p с молекулярной массой ~ 45 кДа.

Была определена последовательность кДНК этого крысиного белка (GenBank AJ132352) и показано, что в его состав входит характерный для многих липид-переносящих белков, так называемый, «SEC14»-домен (по названию дрожжевого белка Sec14p, в котором он впервые был обнаружен, и поэтому получил название rSec14p) и «GOLD» (Golgi dynamics)-домен, определяющий белок-белковые взаимодействия. Было установлено, что специфическим гидрофобным лигандом rSec14p из обонятельного эпителия крысы является фосфатидилинозит-3,4,5-трифосфат (PtdIns(3,4,5)P3).

1. Изучение функциональных свойств rSec14p. Обнаружение нового белка Ранее в результате двугибридного поиска партнеров изучаемого нами белка rSec14p, его вероятными партнерами идентифицированы несколько белков иммунной системы (Меркулова М.И., 2005). Повышенный интерес среди них вызвали белки, чей синтез резко возрастает при воспалении и нейродегенеративных изменениях: секретоглобин – защитный белок, медиатор противовоспалительных процессов, CCL5 (RANTES) - хемокин, медиатор противовоспалительных процессов, и эндоглин (CD105) - цитокин, участвующий в гемопоэзе, сердечно-сосудистом развитии и ангиогенезе, компонент рецепторного комплекса трансформирующего ростового фактора 1. Учитывая высокую степень представленности rSec14p в обонятельной выстилке, и тот факт, что слизистая оболочка является типичным местом развития иммунных реакций, очевидно вовлечение этого белка в защитные ответные реакции организма. На данном этапе представлялся важным подбор подходящей модели животных для исследования нашего белка. С одной стороны, модель должна сопровождаться воспалительными процессами, отражающимися на слизистой оболочке дыхательных путей, но, с другой, нельзя было допускать непосредственного воздействия препаратов, используемых для создания модели, на эпителиальные клетки, поскольку изменение уровня мРНК может также вызываться дегенерацией или некрозом клеток эпителиального слоя воздухоносных путей, синтезирующих Sec14p-подобные белки. Поэтому нами было решено оценить уровень rSec14p в обонятельной выстилке крыс с хроническим воспалением, вызванным инъекцией -амилоидного пептида и иботеновой кислоты, что является моделью болезни Альцгеймера (Morimoto K., 1998). Данная модель предусматривает длиннодистантные эффекты и характеризуется накапливанием таких белков воспаления, как интерлейкины (IL)-1, IL-6, IL8, фактор некроза опухоли- (TNF), моноцитарный хемоаттрактивный белок-1 (MCP-1), макрофагальный белок воспаления-1 (MIP-1) и хемокин ССL5.

1.1. Оценка уровня синтеза rSec14p в обонятельной выстилке крыс с хроническим воспалением Для проверки уровня синтеза rSec14p были использованы 2 группы крыс линии Вистар (по 5 животных каждая): группа 1 – животные с синдромами хронического воспаления (модель болезни Альцгеймера), вызываемая инъекцией -амилоидного пептида в количестве 2 мкг и иботеновой кислоты в количестве 0,5 мкг на каждую сторону гиппокампа и контрольная группа 2 - крысы, содержащиеся в нормальных условиях, которым интрацеребрально вводили физраствор. Животных выводили из эксперимента через 21 день путем транслокации шейных позвонков.

Эксперименты с использованием контрольных животных и имеющих синдромы хронического воспаления проводились параллельно.

Изолированный обонятельный эпителий подвергали обработке на льду в ручном гомогенизаторе Поттера в буферном растворе, содержащем 30мМ Tris-HCl, pH 7,4 и 150 мМ NaCl. Супернатант после центрифугирования при 12 000g в течение 15 мин диализовали и использовали для выделения белка.

В результате очистки с помощью ионообменной хроматографии на DЕАЕсефацеле (рис.1) в пробирках 71-78 по данным электрофореза в ПААГ накапливался rSec14p. Картина хроматографического разделения изотонических экстрактов обонятельных выстилок контрольных и экспериментальных крыс была идентична. Содержимое указанных пробирок объединяли и проводили высаживание с помощью 9% метанола. Выход белка составил примерно 100 мкг из 5 крыс. Анализ общего белкового водорастворимого экстракта и очищенного препарата rSec14p осуществлялся с помощью ЭФ в ПААГ.

При электрофоретическом анализе белкового экстракта обонятельной выстилки контрольных животных в ПААГ присутствовала полоса, соответствующая подвижности rSec14p (рис.2). В обонятельной выстилке модельных крыс с синдромами хронического воспаления денситометрически было обнаружено незначительное увеличение количества rSec14p.

Рис. 1. Хроматограмма разделения изотонического экстракта обонятельного эпителия крыс с хроническим воспалением на DEAEсефацеле. Указано положение пика, обогащенного белком rSec14p c молекулярной массой 45 кДа. Номера собираемых фракций отложены по оси абсцисс.

Однако, помимо rSec14p, здесь же была выявлена заметная полоса белка с меньшей молекулярной массой (примерно 43 кДа), которая не проявлялась антителами к rSec14p (рис. 2, дорожки 4, 5). Сравнение белковых профилей двух групп животных свидетельствовало о том, что в обонятельной выстилке экспериментальных крыс идет накопление нового белка, имеющего близкую с rSec14p ИЭТ и совыделяющегося с ним при ионообменной хроматографии.

1.2. Определение уровня экспрессии гена rSec14p в обонятельной выстилке крыс с хроническим воспалением Из замороженных, измельчённых в жидком азоте образцов обонятельных выстилок двух групп животных выделяли суммарную РНК, которую обрабатывали ДНК-азой; качество РНК проверяли электрофорезом в 1% агарозном геле в присутствии бромида этидия. Количество РНК определяли на спектрофотометре по поглощению при длине волны 260 нм.

Далее обратной транскрипцией получали кДНК. Для анализа относительной экспрессии данного гена проводили ПЦР-анализ в реальном времени (в трех повторах) с использованием в качестве внутреннего контроля крысиный ген глицеральдегид-3-фосфатдегидрогеназы (GAPDH).

Рис. 2. Электрофоретический анализ в 12,5 % SDS-ПААГ водорастворимых белков обонятельной выстилки крыс с окрашиванием геля кумасси R-250 (дорожки 1, 2, 3, 4) или с помощью вестерн-блота с иммунохимической идентификацией rSec14p (5); 1- белковые стандарты молекулярных масс, кДа, 2- экстракт выстилок животных 2 -ой (контрольной) группы, 3- экстракт выстилок животных 1-ой группы (с хроническим воспалением), 4, 5 — очищенный препарат rSec14p (фракции 71-78), полученный после разделения экстракта водорастворимых белков из обонятельных выстилок животных 1-ой группы с помощью ионообменной хроматографии. Разведение первичных антител 1:750, вторичных – 1:5000.

Проявление методом хемилюминисцентной детекции (ECL).

Показано, что уровень экспрессии гена белка rSec14p в ткани животных с моделью болезни Альцгеймера, сопровождающейся хроническим воспалением, увеличивается более, чем в 10 раз по сравнению с контрольной группой (табл. 1). Однако разброс значений количества транскриптов гена rSec14p в обонятельной выстилке индивидуальных животных с этой моделью оказался очень значительным. Это можно объяснить тем, что мы работали с небольшой группой крыс, выборка из пяти животных может даль лишь оценочное представление об уровне экспрессии гена.

2. Идентификация нового белка из обонятельного эпителия крысы Для идентификации нового полипептида было решено определить его частичную аминокислотную последовательность и установить истинную молекулярную массу.

Таблица 1. Сравнение относительных уровней экспрессии мРНК rSec14p в обонятельной выстилке контрольных крыс и с хроническим воспалением I-группа животных (n=5) II- группа животных (n=5) Медиана Медиана (1; 3 квартиль) (1; 3 квартиль) Относительный уровень экспрессии 1,2 (0,37; 1,88) 15,1 (13,2; 18,3) мРНК rSec14p 2.1. Определение N-концевой аминокислотной последовательности Из-за ограниченной доступности модельных животных и подобия физико-химических свойств rSec14p и сопутствующего белка с молекулярной массой 43 кДа, выделение очищенного препарата последнего было весьма сложной задачей. Но, учитывая тот факт, что N-концевой остаток rSec14p блокирован, определение N-концевой последовательности нового белка было решено провести на смеси двух белков. После переноса белков частично очищенной фракции (пробирки 71-78, рис.1) на поливинилидендифторидную мембрану с помощью автоматического газофазного секвенатора (Applied Biosystem 470A, США) была установлена аминокислотная последовательность 11 остатков:

YQLMCYYTSWA Эта структура не имела гомологии с аминокислотной последовательностью rSec14p, но полностью соответствовала N-концевой структуре одного из представителей семейства гликогидролаз 18 - хитиназоподобного секреторного белка мышиных перитониальных макрофагов Ym1, активно экспрессирующегося в условиях заражения животного Trichinella spiralis (Chang N.C., 2001).

На основании полученных данных было высказано предположение о принадлежности белка из обонятельной выстилки крысы, имеющего в ПААГ подвижность ~ 43 кДа, к подсемейству CLPs, но индуцирование синтеза которого не связано с хитином. В соответствии с местом локализации (epithelium olfacctorium) он был назван «rYm1olf».

2.2. Масс-спектрометрический анализ белка rYm1olf Для определения истинной молекулярной массы rYm1olf белковую полосу с кажущейся подвижностью в области 43 кДа вырезали из ПААГ, гомогенизировали и анализировали с помощью масс-спектрометрии. Как видно из рис. 3, экспериментально определённый молекулярный вес rYm1olf (самый интенсивный пик) составляет 42986 Да. Минорный пик m/z 459соответствует следовой примеси белка rSec14р.

Рис. 3. Масс-спектр белка rYm1olf. Условия: MALDI-времяпролетновремяпролетный масс-спектрометр Ultraflex II BRUCER (Германия).

2.3. Определение частичной аминокислотной последовательности rYm1olf С целью определения аминокислотной последовательности полосу ПААГ, содержащую rYm1olf, вырезали и подвергали трипсинолизу.

Образовавшиеся в результате гидролиза низкомолекулярные фрагменты экстрагировали из ПААГ и анализировали с помощью масс-спектрометрии.

Молекулярные массы обнаруженных в масс-спектре ионов сравнивали с расчетными массами ожидаемых пептидов, образующихся при гидролизе трипсином хитиназоподобных белковых структур, имеющих в своем составе фрагмент, идентичный экспериментально установленной N-концевой аминокислотной последовательности rYm1olf. Регистрационные пики идентифицированных фрагментов исследуемого белка на рис. 4 отмечены соответствующим значением [M+H]+.

Результаты анализа триптического гидролизата rYm1olf суммированы в табл. 2. Таким образом, была установлена первичная структура уникальных 10 пептидов, в сумме содержащих 112 аминокислотных остатков.

Рис. 4. Масс-спектр триптического гидролизата rYm1olf. Значения m/z указаны над идентифицированными пиками. Условия: MALDI- времяпролетно-времяпролетный масс-спектрометр Ultraflex II BRUCER (Германия).

Таблица 2. Aминокислотные последовательности триптических фрагментов rYm1olf Номер Масса Местоположение пептида пептида аминокислотных Последовательность пептида* [M+H]+ остатков в цепи гипотетического белка XP_0010698 1 886.6 334 – 340 K.IKAQWLK 2 906.6 367 – 374 R.FPLTSTLK 3 958.6 82 – 90 K.TLLAIGGWK 4 1002.6 336 – 343 K.AQWLKDNK 5 1088.6 159 – 167 K.ESTEQEIPR 6 1374.8 143 – 153 K.HLFSVLVQEMR 7 1563.8 155 – 167 K.AFEKESTEQEIPR 8 1667.8 122 – 135 K.FDGLNLDWQYPGSR 9 1696.8 91-106 K.FGSAPFSAMVSTPQNR 10 2056.9 375-391 K.HYLGVQSTNCMAYKEEL * K. или R. соответствуют предполагаемым аминокислотным остаткам лизина или аргинина, по которым происходил гидролиз трипсином, предшествующих последовательности пептидов.

2.4. Сравнение полученных результатов с базой данных GenBank В результате сопоставления изученных пептидов со структурами белков, хранящихся в базе данных, стало ясно, что rYm1olf действительно относится к семейству гликогидролаз 18 и проявляет заметное сходство с секреторным белком Ym1 мыши. В литературе его также часто называют «ECF-L» или эозинофил-хемотактическим фактором, впервые, как уже было упомянуто, он идентифицирован в перитониальных макрофагах, его следы были обнаружены в условиях регенерации нейронов после повреждения обонятельной выстилки мыши (Chang N.C., 2001).

В базе данных GenBank выведенных белковых последовательностей крысы наиболее близким к изучаемому нами белку оказался гипотетический белок Chi3l3 (XP_001069857), или Ym1 по аналогии с мышиным белком. Ген Chi3l3 распространен только среди грызунов, и на мышах он достаточно хорошо изучен.

C целью определения полной аминокислотной последовательности зрелого природного rYm1olf крысы проведено сравнение структуры пептидов с гипотетической структурой Chi3l3. На рис. 5 видно, что, за исключением пептида № 10, экспериментальные триптические пептиды идеально укладываются в структуру Chi3l3.

Транслированная мРНК MAKLILATGSSYQLMCYYTSWAKDRPTVGSFKIGNIDPCL Эксперимент. пептиды YQLMCYYTSWA Транслированная мРНК CTHLIYAFAGMRNNEIINTSEQDLIDYEAINYLKDRNTEL Транслированная мРНК KTLLAIGGWKFGSAPFSAMVSTPQNRQTFIKSVIKFLRQY 1Эксперимент. пептиды TLLAIGGWKFGSAPFSAMVSTPQNR Транслированная мРНК KFDGLNLDWQYPGSRGSPPKDKHLFSVLVQEMRKAFEKES 1Эксперимент. пептиды FDGLNLDWQYPGSR HLFSVLVQEMR AFEKЕS Транслированная мРНК TEQEIPRLLLTATVAGVIDTIQSGYKIPELSQSLDYFQVM 2Эксперимент. пептиды TEQEIPR Транслированная мРНК TYNLHDFQNGYTRENSPLYQSPSDTGIYAYLNVDAIISYW 2Транслированная мРНК KDNGAAREKLIVGFPAYGHNFILSDPSNTGINAPIVSTGP 2Транслированная мРНК PGKFTGEAGLWAYYEICTFLNDGATDLWDGPQEVPYAVQG 3Транслированная мРНК NVWVGYDNVKSFKIKAQWLKDNKLGGAMVWPLDMDDFTGS 3Эксперимент. пептиды IKAQWLKDNK Транслированная мРНК FCQQGRFPLTSTLKHYLGVQSTSK 3Эксперимент. пептиды FPLTSTLKHYLGVQSTNCMAYKEEL Рис. 5. Сравнение структур экспериментально полученных пептидов с последовательностью транслированной мРНК гипотетического белка крысы chitinase 3-like 3 (Chi3l3) XP_001069857. Нижней строчкой представлены последовательности экспериментальных пептидов. СКонцевые фрагменты гипотетического белка Chi3l3 и пептида № выделены курсивом. Не совпадающие аминокислотные остатки выделены красным цветом.

Аминокислотная последовательность 8 N-концевых остатков 17членного триптического пептида № 10 полностью совпадает со структурой His375 - Thr382, расхождения наблюдаются только в его С-концевой области, а именно, не совпадают лишь последние 2 аминокислотных остатка Chi3l(рис. 5): Ser383 Asn, а Lys384 Cys. Кроме того, экспериментальный пептид на С-конце имеет дополнительный участок длиной в аминокислотных остатков. Поскольку на С-конце пептида № 10 остатков аргинина или лизина обнаружено не было и молекулярная масса зрелого белка, имеющего в качестве N-концевого остаток Tyr, составляет 42986 Да (рис. 3), было предположено, что пептид №10 является С-концевым фрагментом rYm1olf, белок кодируется геном Chi3l3, но 3'-концевая область нуклеотидной последовательности гена, представленная в базе данных, требует уточнения.

3. Установление последовательности полноразмерной кДНК rYm1olf из обонятельной выстилки крысы Следующим этапом представленной работы стало установление полной нуклеотидной последовательности кДНК rYm1olf. Для эксперимента была выбрана модель животных с эндотоксикозом (крысам внутрибрушинно вводилась доза липополисахарида (ЛПС) 1,5 мг/кг), характеризующаяся острым воспалением. ЛПС – компонент клеточной стенки грамотрицательных бактерий, он запускает каскад внутриклеточных реакций, вызванных образованием на клеточной мембране комплекса с TLR4 (toll like receptors – TLR-4), что способствует продукции провоспалительных цитокинов. Высокий уровень эндотоксина в крови приводит к развитию патологических процессов, в том числе синдрому системного воспалительного ответа.

3.1. Получение фрагмента кДНК, кодирующего белок rYm1olf Из ткани обонятельной выстилки модельных животных выделена стабильная фракция суммарной РНК. Построенная в ходе ревертазной реакции суммарная двуцепочечная кДНК (дц-кДНК) послужила матрицей для получения полноразмерной кДНК rYm1olf. На основании ранее полученных данных об N-концевой структуре белка и структуре пептида №10 были синтезированы вырожденные праймеры rYm1olfForvNcoI 5`- TA(Y)CA(R)(Y)T(N)ATGTG(Y)TA(Y)TA(Y)AC(N)(W)(S)(N)TGGGC - 3` и rYM-1olfRevBamHI 5`- (N)A(R)(Y)TC(Y)TC(Y)TT(R)TA(N)GCCAT(R)CA(R)TT(N)GT(N)(S)(W) - 3` (где Y- C/T, R- A/G, N- A/C/T/G, W- A/T, S- G/C), фланкирующие кодирующую область гена. Амплифицированный с помощью данной пары праймеров продукт длиной примерно 1150 п.о клонировали в вектор pGEMT. Анализ клонов на наличие вставки проводили при помощи ПЦР с использованием стандартных праймеров, комплементарных последовательности вектора pGEM-T.

В результате секвенирования последовательности вставки отобранных клонов был полностью установлен уникальный фрагмент размером 11п.о., кодирующий полноразмерный rYm1olf (рис. 6).

TATCAGCTGATGTGCTACTATACCAGTTGGGCTAAGGAGAGACCAACAGTAGGGAGTTTCAAAA TTGGCAATATTGACCCTTGTCTGTGTACCCACTTGATCTATGCCTTTGCTGGGATGCGGAATAA TGAGATTATCAACACAAGTGAGCAGGACTTGATTGACTATGAAGCAATAAATTATCTGAAAGAC AGGAACACTGAGCTAAAAACTCTCCTGGCCATTGGAGGCTGGAAGTTTGGATCTGCCCCGTTCA GTGCCATGGTCTCTACTCCTCAGAACCGGCAGACATTCATCAAATCAGTCATCAAATTCCTTCG CCAGTATAAGTTTGATGGCCTCAACTTGGACTGGCAATACCCTGGGTCTCGTGGAAGCCCTCCT AAGGACAAACATCTCTTCAGTGTCCTGGTGCAGGAAATGCGTAAAGCGTTTGAGAAAGAATCTA CTGAGCAAGAAATCCCAAGGCTGCTTCTCACTGCCACAGTAGCTGGAGTCATTGACACAATCCA GTCTGGTTACAAGATTCCTGAACTGTCTCAGTCACTTGACTATTTTCAAGTCATGACATATAAT CTCCATGATTTCCAGAATGGTTACACTAGAGAAAATAGTCCCCTCTATCAATCTCCATCCGACA CTGGAATATATGCCTATCTCAATGTGGATGCAATCATAAGCTACTGGAAGGAAAATGGGGCAGC TCGTGAGAAGCTCATTGTGGGATTTCCAGCATATGGGCATAACTTTATCCTGAGTGACCCCTCT AACACTGGAATTAATGCCCCTATTGTCAGTACTGGCCCACCAGGGAAGTTCACAGGTGAAGCAG GACTCTGGGCTTACTATGAGATTTGCACATTTCTGAATGATGGAGCCACTGATCTCTGGGATGG CCCCCAGGAAGTACCCTATGCCGTTCAGGGCAATGTATGGGTTGGTTATGATAATGTCAAGAGC TTCAAGATTAAGGCTCAGTGGCTCAAGGACAACAAATTAGGAGGTGCAATGGTCTGGCCCCTGG ACATGGATGACTTCACTGGTTCTTTCTGTCAACAGGGAAGGTTCCCTTTGACTTCTACTTTAAA GCATTATCTAGGTGTACAGAGTACAAATTGTATGGCTTATAAAGAGGAGCTT Рис. 6. Нуклеотидная последовательность гена (1140 п.о.), кодирующего белок rYm1olf.

3.2. Определение 5`- и 3`-нетранслируемых областей rYm1olf Для получения последовательности 5`- и 3`- нетранслируемых областей (НТО) гена, кодирующего белок rYm1olf, суммарная дц-кДНК из обонятельной выстилки крысы замыкалась в кольцо с помощью T4 ДНКлигазы и использовалась в качестве матрицы для инвертированной ПЦР с помощью специфических праймеров, комплементарных концевым областям кодирующей части гена (рис. 7) Рис. 7. Схема получения нетранслируемых участков кДНК rYm1olf.

3`НТО-rYm1olfFor 5`- CTGGACATGGATGACTTCACTGG - 3` и 5`НТО-rYm1olfRev 5`- GCAAAGGCATAGATCAAGTGGG - 3`.

Продукт амплификации длиной около 700 п.о., содержащий нетранслируемые области и участки кодирующей последовательности, клонировали в вектор pGEM-T и определяли его структуру (рис. 8).

Рис. 8. Нуклеотидная последовательность продукта амплификации кДНК на кольцевой матрице, содержащей 5`- и 3`-нетранслируемые области. Условные обозначения: 1 - последовательности полилинкера вектора pGEM-T, 2 - последовательности праймеров 3`НТО-Ym1olfFor и 5`НТО-Ym1olfRev, 3 - участки последовательностей, кодирующих С- и Nконцевые фрагменты зрелого белка Ym1olf крысы, 4 - последовательности праймеров «CDS-1 adapter» и «PlugOligo-1 adapter» («Евроген», Россия), использованных для синтеза суммарной дц-кДНК, 5 – последовательность, кодирующая лидерный пептид, 6 - 5`- и 3`- нетранслируемые последовательности полноразмерной кДНК Ym1olf крысы. Указаны границы клонированного в вектор pGEM-T фрагмента размером около 700 п.о. (\...\) и место сшивания концов дц-кДНК в ходе инвертированного лигирования (../..). Большим шрифтом выделены инициирующий кодон ATG и стоп-кодон ТАА кодирующей области rYm1olf.

3.3. Определение полноразмерной последовательности кДНК и аминокислотной последовательности белка rYm1olf При сопоставлении данных о нетранслируемых областях с кодирующей последовательностью гена была установлена полная нуклеотидная последовательность зрелой мРНК rYm1olf. На рис. представлена нуклеотидная последовательность полноразмерной кДНК rYm1olf, включающая 1545 п.о.

Рис. 9. Последовательность полноразмерной кДНК и выведенная аминокислотная последовательность белка rYm1olf. Нижняя строчка – нуклеотидная последовательность, включающая 5’-нетранслируемый участок (выделен серым цветом), инициирующий кодон ATG (выделен курсивом жирным шрифтом), Козак-последовательноть (выделена рамкой), кодирующую область, стоп-кодон ТАА (выделен курсивом жирным шрифтом), 3’-нетранслируемый участок и подчеркнутый пунктиром полиаденилированный «хвост» (выделены серым цветом). Верхняя строчка – аминокислотная последовательность rYm1olf, подчеркнуты N-концевой участок и триптические пептиды, структуры которых установлены экспериментально.

Данная последовательность депонирована в международную базу данных GenBank, и ей присвоен номер JF781276.

Учитывая данные N-концевого анализа природного rYm1olf крысы, мы предположили, что последовательность предшественника зрелой формы rYm1olf крысы включает в себя 21-членный лидерный пептид (MAKLILATGLAILLYAHLGSS), а последовательность зрелого белка начинается с мотива YQLMCYYTSWA. Полноразмерный белок rYm1olf крысы содержит 380 аминокислотных остатков. Значение [M+H]+ природного образца исследуемого белка, согласно данным массспектрометрического анализа, составляло 42986, в то время как рассчитанная суммированием усредненных атомных масс элементов масса цепи, состоящей из 380 остатков, дает величину 42949 Да. С учетом точности определения Mr ( 20) белков с помощью масс-спектрометрии, эти данные позволяют предположить, что rYm1olf действительно состоит только из 380 остатков и, несмотря на присутствие в его полипептидной цепи потенциального участка гликозилирования (47-49, рис. 9), зрелый белок не модифицирован.

Определенная нами последовательность полноразмерной кДНК, подтвержденная секвенированием кДНК-клона в векторе pGEM-T, не совпала с геномной последовательностью гипотетического гена Chi3l(XM_001069857), предсказанного автоматическим компьютерным анализом с помощью метода GNOMON. Аминокислотная последовательность белка rYm1olf, кодируемого геном Chi3l3, которая была подтверждена триптическим анализом природного rYm1olf крысы, соответственно, также не совпала с транслированной последовательностью белка, кодируемого геном Chi3l3, представленной в базе данных GenBank (рис. 5).

В предложенной в базе данных гипотетической последовательности мРНК Chi3l3 (XM_001069857), неверно предсказан ее 3`-концевой участок.

Благодаря полученным нами данным была уточнена экзон-интронная организация гена Chi3l3. А именно, мы определили, что последовательность экзона X короче на 9 п.н.о. (они относятся к следующему интрону), а ген содержит дополнительный экзон XI. Более того, экзон I имеет большую длину, чем представлено в базе данных (рис. 10).

4. Структурные особенности белков семейства гликогидролаз Анализ доменной организации нового белка показал, что большую его часть составляет консервативный Глико_18 домен, присущий всем членам семейства гликогидролаз 18. В это белковое семейство входят как активные хитиназы - ферменты, способные катализировать реакцию деградации хитина, и хитиназоподобные белки, или CLPs, гидролазной активностью не обладающие, но способные связываться с углеводами, вследствие чего получившие название хитолектинов. Некоторые из них содержат в своем составе хитин-связывающий домен.

Рис. 10. Сравнение экзон-интронной организации гена Chi3l3 (Rattus norvegicus), представленной в базе данных GenBank (Gene ID: 295351) и гена, кодирующего белок rYm1olf. Интроны обозначены серыми блоками, экзоны – черными, их длина указана сверху. Порядок расположения экзонов в гене указан снизу римскими цифрами. Подчеркнуты экзоны, последовательности которых были уточнены.

Гидролитическая активность всех представителей семейства гликогидролаз определяется наличием каталитического остатка глутаминовой кислоты в последовательности DXDXE (где D – аспарагиновая кислота, Х – любая аминокислота, Е – глутаминовая кислота), расположенной, как правило, через один остаток после консервативного трипептида FDG (рис. 11). Последовательность каталитического центра rYm1olf на участке 115–119 имеет вид NLDWQ, т.е. по сравнению с канонической структурой содержит замены D на N и E на Q. Поскольку этот участок входит во фрагмент, чья структура была определена экспериментально (триптический пептид 8 (122–135), см. таблицу 2), можно с уверенностью сказать, что rYm1olf действительно является хитиназоподобным белком, гидролитической активностью обладать не может, и его появление в эпителиальной ткани воздухоносных путей, ассоциированной со слизистыми оболочками, не связано с активацией иммунной системы хитин-содержащими патогенами.

При сравнении последовательности нового идентифицированного белка с другими членами семейства гликогидролаз 18 человека в NCBI выяснилось, что ортолога изучаемому белку нет, а наиболее близкой к нему является истинная хитиназа млекопитающих (AMC-аза) — у них 68% идентичности, но которая имеет еще дополнительно хитин-связывающий домен. Известно, что AMC-аза (acid mammalian chitinase, кислая хитиназа млекопитающих) экспрессируется главным образом в желудке и нижнем отделе легких при аллергических заболеваниях и астме.

Рис. 11. Доменная организация (А) и структура каталитических центров (Б) представителей семейства гликогидролаз 18 крысы.

Положение каталитического центра указано стрелками. Существенные аминокислотные остатки выделены жирным шрифтом. Консервативная последовательность FDG, предшествующая каталитическому мотиву, выделена серым цветом.

Было сделано наложение пространственной модели rYm1olf, созданной на основе разрешенной структуры мышиного Ym1, и структуры человеческой AMC-азы. Очевидно, что при таком значительном сходстве аминокислотных последовательностей, пространственные структуры этих белков практически совпадают (данные не приведены).

На мышиных моделях аллергического воспаления, ранее показано, что AMC-аза и Ym1 экспрессируются в разных отделах такого анатомически вытянутого органа, как трахея, AMCase — в дистальном и Ym1 — в проксимальном отделах трахеи, при их единовременной экспрессии в альвеолярных макрофагах. А также известно, что человеческая AMC-аза синтезируется в виде полноразмерной формы – 50 кДа, но в тканях обнаружена изоформа размером 39 кДа, которая образуется в результате протеолитического процессинга - после отщепления С-концевого хитинсвязывающего домена. Более того, показано, что утрата АМС-азой хитиназной активности в результате мутации каталитического центра, не отражается на некоторых биологических функциях этого белка (Hartl D., 2009). То есть для выполнения своих функций в организме человеческой АМС-азе наличие гидролазной активности не всегда важно.

Учитывая все вышеуказанное и помня о высокой идентичности человеческой AMC-азы и крысиного rYm1olf, было сделано предположение о том, что изучаемый нами крысиный rYm1olf и укороченная форма человеческой AMC-азы могут являться функциональными аналогами.

5. Исследование уровней экспрессии генов белков rYm1olf и rSec14p из обонятельной выстилки крыс на модели острого воспаления В работе (Shan L. et al, 2009), посвященной взаимосвязи уровня экспрессии липид-связывающего rSec14p и воспаления слизистых оболочек, сообщалось об обратной зависимости степени воспаления (в первые двое суток после инъекции животных овальбумином) и уровня экспрессии крысиного rSec14p, которая объяснялась изменением функций эпителиальных клеток в процессе развития воспаления воздухоносных путей. Эти данные не согласуются с нашими предположениями о взаимосвязи хитиназоподобного rYm1olf, который ассоциирован с защитными процессами организма, и по аналогии с мышиным гомологом, является медиатором воспаления, и липид-связывающего rSec14p, ведь мы продемонстрировали резкое увеличение количества rSec14p и появление rYm1olf при хроническом воспалении (модель болезни Альцгеймера). Для выяснения этих разногласий решено было на следующем этапе работы сравнить уровни экспрессии мРНК rYm1olf и rSec14р в клетках обонятельного эпителия крыс с эндотоксикозом, вызываемым введением липополисахарида (ЛПС) и сопровождающимся острым воспалением.

Важным при этом было сохранение целостности клеток обонятельного эпителия, непосредственно экспрессирующих rSec14р. ЛПС E. сoli штамма О26:В6 («Sigma», США) вводили внутрибрюшинно в дозе 1,5 мг/кг, исследования проводили на 1 или 7 сутки после введения ЛПС. Для получения статистически значимых результатов число животных в каждой группе составляло 10 штук.

В нашем эксперименте об активации иммунитета животных судили по уровню их цитокинов: интерлейкинов 2, 4, 6, 12, ФНО, интерферону. А о том, что модель состоялась (развился синдром системного воспалительного ответа) подтверждали результаты морфологических исследований тимуса и печени. Оценку цитокинового профиля и морфологические исследования для нас любезно провела с.н.с. НИИ морфологии человека РАМН Косырева А.М. Уровни экспрессии мРНК rYm1olf и rSec14р в тканях крыс с острым воспалением через 1 сутки или через 7 суток сравнивали с таковыми у контрольных (интактных) крыс.

Суммарную РНК выделяли из замороженных, измельчённых в жидком азоте образцов обонятельных выстилок трех групп животных, обрабатывали ДНКазой, качество РНК проверяли электрофорезом в 1% агарозном геле в присутствии бромида этидия. Количество РНК определяли на спектрофотометре по поглощению при длине волны 260 нм. С помощью обратной транскрипции получали кДНК. Для анализа относительной экспрессии генов, кодирующих белки rYm1olf и rSec14р, проводили ПЦРанализ в реальном времени (в трех повторах) с использованием в качестве внутреннего контроля гены крысиных белков -актина (Act) и глицеральдегид-3-фосфатдегидрогеназы (GAPDH).

Показано, что количество мРНК белка rYm1olf в ткани животных с острым воспалением на первые сутки увеличивается в 22,6 раза (p<0,05) (A), а гена rSec14р в 5,4 раза (p<0,05) (Б) по сравнению с контрольной группой (рис. 12).

А 0,0,0,0,0,0,0,rYm1olfК rYm1olfЛ1 rYm1olfЛБ rSec14pК rSec14pЛ1 rSec14pЛРис. 12. Сравнение уровней экспрессии генов, кодирующих белки rYm1olf и rSec14р, из обонятельных выстилок контрольной (К) и экспериментальных групп животных с острым воспалением на 1 и 7 сутки после инъекции ЛПС (Л1 и Л7). Количество транскриптов гена белка rYm1olf в ткани животных с острым воспалением на первые сутки увеличивается в 22,6 раза (p<0.05) (А), а гена rSec14р в 5,4 раза (p<0.05) (Б) по сравнению с контрольной группой. На седьмые сутки эксперимента значительного увеличения уровней экспрессии этих генов по сравнению с контролем не наблюдалось.

Таким образом, мы подтвердили свои предположения: протекание воспалительных процессов сопровождается усилением экспрессии гена защитного липид-связывающего белка, обильно содержащегося в слизистой оболочке обонятельного эпителия.

На седьмые сутки эксперимента наблюдалось значительное уменьшение уровней экспрессии этих генов по сравнению с их экспрессией на 1-е сутки, морфологическая выраженность воспалительных и дистрофических изменений органов иммунной системы снижалась, животные выздоравливали.

Такое значительное увеличение уровня экспрессии гена, кодирующего белок rYm1olf, при остром воспалении и его снижении при выздоровлении позволяет назвать уровень мРНК этого белка перспективным критерием прогнозируемости течения заболевания. Поскольку при остром воспалении резкому возрастанию уровня экспрессии гена белка rYm1olf сопутствует увеличение уровня гена белка rSec14р, а при выздоровлении животных уровни экспрессии этих генов близки к контрольным, можно говорить о совместном вовлечении этих белков в иммунный ответ организма.

6. Проверка экспрессии гена Сhi3l4 в обонятельной выстилке крысы Как уже упоминалось выше, при идентификации выделенного нами нового полипептида проводилось сравнение его частичной аминокислотной последовательности со структурами белков крысы, внесенных в базу данных GenBank. Помимо Сhi3l3 другим наиболее гомологичным оказался белок, кодируемый геном Сhi3l4 (73% идентичности). И поскольку этот крысиный белок является гипотетическим, предсказанным методами REFSEQ, и, по литературным данным должен всегда сопутствовать синтезу Сhi3l3, было решено проверить, экспрессируется ли ген Сhi3l4 наряду с Сhi3l3 в обонятельной выстилке крыс в данной модели патофизиологии.

На матрице суммарной дц-кДНК из обонятельной выстилки контрольных и модельных животных с помощью пары праймеров, созданных на основе нуклеотидной последовательности гена крысы Сhi3l4, представленной в базе GenBank, была предпринята попытка получить уникальные фрагменты методом полуколичественной ОТ-ПЦР (рис. 13). В качестве контроля использовали ген «домашнего хозяйства» -актин.

Рис. 13. Экспрессия мРНК Сhi3l4 и Сhi3l3 (кодирующего rYm1olf) и актина (использовался в качестве контроля) в обонятельной выстилке контрольных (К) и модельных (М), с острым воспалением, крыс. Продукты ОТ-ПЦР (30-й цикл) электрофоретически разделены в 2%-м агарозном геле.

В этих же условиях была проверена экспрессия гена Сhi3l3, кодирующего rYm1olf, на уникальных праймерах rYm1olfFor и rYm1olfRev.

Таким образом, экспериментально было подтверждено отсутствие экспрессии в обонятельной выстилке крыс гена Сhi3l4, наиболее близкого к изучаемому крысиному гену в данной модели воспаления.

ВЫВОДЫ 1. Подобрана животная модель с хроническим воспалением, на которой показано увеличение уровня экспрессии гена и белка rSec14p по сравнению с контрольной группой.

2. В обонятельной выстилке крыс с моделью хронического воспаления обнаружен и идентифицирован новый белок rYm1olf, определена его частичная аминокислотная последовательность и принадлежность к семейству гликогидролаз 18. Установлено, что белок кодируется геном Chi3l3.

3. Установлена последовательность полноразмерной кДНК rYm1olf, которая депонирована в GenBank под номером JF781276, уточнена экзонинтронная организация гена Chi3l3 крысы. Установлена полная 380-членная аминокислотная последовательность нового белка rYm1olf крысы, определена последовательность предшественника его зрелой формы.

4. Изучена экспрессия генов, кодирующих rYm1olf и rSec14р в обонятельной выстилке животных с моделью острого воспаления. Показано совместное вовлечение этих белков в иммунный ответ организма - резкое увеличение количества их транскриптов (гена rYm1olf в 22,6 раза, а гена rSec14р в 5,4) по сравнению с контрольной группой.

5. Высказано предположение, что уровень экспрессии гена, кодирующего белок rYm1olf, может являться перспективным критерием прогнозируемости течения воспалительного процесса.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Ильницкая Е.В., Радченко В.В., Косырева А.М., Шуваева Т.М., Липкин В.М. Клонирование и анализ последовательности зрелой мРНК нового хитиназоподобного белка крысы, экспрессирующегося в патологических условиях. ДАН 2011, 439 (6), с. 835–837.

2. Радченко В.В., Ильницкая Е.В., Третьяков В.Е., Серебрякова М.В., Сторожева З.И., Шуваева Т.М., Липкин В.М. Идентификация в обонятельном эпителии крысы нового хитиназоподобного белка подгруппы YM-1. Биоорган.химия 2010, 36 (5), с. 646–653.

3. Ильницкая Е.В., Шамборант О.Г., Радченко В.В., Шуваева Т.М., Липкин В.М. Связывание Sec14-подобного белка с молекулярной массой кДа из обонятельного эпителия крысы с фосфатидилинозит-3,4,5трифосфатом в липосомах. Биоорган.химия 2006, 32 (3), с. 335-336.

Тезисы докладов:

1. Ильницкая Е.В., Радченко В.В., Шуваева Т.М., Липкин В.М. Новые защитные белки обонятельного эпителия rSEC14p и rYM1olf. ХХ международная конференция и дискуссионный научный клуб «Новые информационные технологии в медицине, биологии, фармакологии и экологии». Гурзуф, Украина 2012. Сборник тезисов, с. 119.

2. Шуваева Т.М., Ильницкая Е.В., Радченко В.В., Липкин В.М. Новый хитолектин крысы в животных моделях с синдромом системного воспалительного ответа. Х чтения памяти академика Ю.А. Овчинникова, Москва-Пущино 2011. Сборник тезисов, с. 91.

3. Ильницкая Е.В., Радченко В.В., Родионова А.С., Шуваева Т.М., Липкин В.М. Идентификация нового хитиназоподобного белка крысы в модели острого воспаления. V Российский симпозиум «Белки и пептиды», Петрозаводск 2011. Сборник тезисов, с. 278.

4. Радченко В.В., Ильницкая Е.В., Третьяков В.Е, Сторожева З.И., Шуваева Т.М., Липкин В.М. Новый белок обонятельного эпителия крысы, экспрессирующийся в патофизиологических условиях. Международная научная конференция по биоорганической химии, биотехнологии и бионанотехнологии, посвященная 75-летию со дня рождения академика Ю.

А. Овчинникова, Москва 2009. Сборник тезисов, с. 333.

5. Ильницкая Е.В., Радченко В.В., Третьяков В.Е., Родионова А.С., Шуваева Т.М., Липкин В.М. Обнаружение нового хитиназоподобного белка крысы, экспрессирующегося в условиях нейродегенеративных изменений.

IV Российский симпозиум «Белки и пептиды», Казань 2009. Сборник тезисов, с. 112.

6. Radchenko V. V., Il’nitskaya E. V., Shuvaeva T. M., Tret’yakov V. E., Lipkin V. M. A new method for lipid transport studying in vitro: The tool for identification unknown lipid binding proteins and their hydrophobic ligands determining lipid metabolism pathology. The FEBS Special Meeting «New concepts in lipidology: from lipidomics to disease (SM06-07)» Noordwijkerhout 2006. Abstr., p.109.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.