WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М. В. ЛОМОНОСОВА __________________________________________________________ Химический факультет

На правах рукописи

ОСТЕРМАН ИЛЬЯ АНДРЕЕВИЧ

НОВАЯ СИСТЕМА ДЛЯ ШИРОКОМАСШТАБНОГО АНАЛИЗА САЙТОВ ИНИЦИАЦИИ И РЕИНИЦИАЦИИ ТРАНСЛЯЦИИ ESCHERICHIA COLI

02.00.10 – биоорганическая химия

Автореферат диссертации на соискание учёной степени кандидата химических наук

Москва – 2012

Работа выполнена на кафедре Химии Природных Соединений Химического факультета Московского Государственного Университета имени М.В. Ломоносова.

Научные руководители: доктор химических наук, доцент, Сергиев Петр Владимирович

Официальные оппоненты: доктор химических наук, профессор, Шатский Иван Николаевич;

доктор биологических наук, профессор, Гельфанд Михаил Сергеевич;

Ведущая организация: Институт Химической Биологии и Фундаментальной Медицины Сибирского отделения РАН, г. Новосибирск

Защита состоится 16 октября 2012 года в 16 часов на заседании диссертационного совета Д 501.001.41 по химическим наукам при Московском Государственном Университете имени М.В.

Ломоносова по адресу: 119992, Москва, Ленинские горы, д.1, стр. 40, МГУ Лабораторный корпус «А», аудитория 501.

С диссертацией можно ознакомиться в библиотеке Химического факультета МГУ имени М.В. Ломоносова.

Автореферат разослан 14 сентября 2012 г.

Учёный секретарь диссертационного совета, кандидат химических наук, доцент Смирнова И.Г.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Трансляция – центральный процесс в жизнедеятельности всех организмов, в ходе которого информация, закодированная в нуклеотидах мРНК, переводится в аминокислотную последовательность белка при помощи рибосомы.

Согласно центральной догме молекулярной биологии мРНК отводится роль посредника между ДНК, несущей всю наследственную информацию, и рибосомой, превращающей эту информацию в белки. Роль мРНК не сводится лишь к передаче информации с ДНК на рибосому, мРНК принимает непосредственное участие в регуляции и определении уровня экспрессии гена. Отличительные черты бактериальной мРНК, такие как последовательность Шайна-Дальгарно (SD), различные стартовые кодоны, A/U-богатые участки, элементы вторичной структуры мРНК, набор используемых кодонов, организация генов в опероны заметно влияют на трансляцию. Сочетание регуляции на уровне транскрипции, в общем определяющей будет или не будет экспрессироваться данный ген, и регуляции на уровне трансляции, точно и тонко модулирующей уровень синтеза белка, позволяет для данного гена достичь оптимальной экспрессии.

Факторы, влияющие на трансляцию, начали изучаться очень давно, но по отдельности и в совершенно разных системах, что не позволяет сравнивать результаты между собой и оценивать относительный вклад различных элементов мРНК.

Изучение бактериальной трансляции особенно важно еще и потому, что около половины применяемых в настоящее время антибиотиков действуют на рибосому.

Механизмы действия могут быть различными: некоторые антибиотики вызывают ошибки в ходе синтеза, другие замедляют скорость трансляции или нарушают структуру рибосомы. Определение механизма действия необходимо для создания лекарственного препарата, а также важно для понимания фундаментальных основ взаимодействия антибиотиков с рибосомой. Стандартный способ проверки антибактериальной активности заключается в измерении уровня ингибирования клеточного роста, но данный подход имеет несколько недостатков: во-первых, необходимы большие концентрации антибиотика, чтобы увидеть заметное снижение роста, а, во-вторых, при таком способе скрининга нельзя ничего сказать о механизме действия антибиотика. Методы для определения механизма существуют, но большинство из них требует in vitro экспериментов и выделения потенциальных мишеней антибиотиков из клетки, что делает их плохо применимыми для широкомасштабного поиска. Поэтому создание высокопроизводительно метода скрининга механизма действия антибиотиков, позволяющего проводить поиск in vivo, представляется крайне актуальным.

Цели работы:

1.Разработать систему для многофакторного анализа влияния элементов мРНК на эффективность трансляции Escherichia coli (E. coli), изучить с ее помощью роль основных элементов бактериальной мРНК в трансляции.

2.Разработать метод высокопроизводительного анализа механизма действия антибиотиков и использовать его для нахождения новых потенциальных антибиотиков с заданным механизмом действия.

Научная новизна и практическая значимость работы. В ходе данной работы была разработана двойная репортёрная конструкция, основанная на генах двух флуоресцентных белков, позволяющая проводить многофакторный анализ влияния различных элементов мРНК на эффективность трансляции. При помощи данной конструкции впервые показано, что in vivo наибольшую относительную эффективность трансляции обеспечивает SD наибольшего размера (8 нуклеотидов), расположенная на максимально близком к стартовому кодону расстоянии, а для среднего расстояния от старта трансляции продемонстрировано существование оптимального значения длины SD, равное нуклеотидам. Изучено влияние элементов вторичной структуры мРНК в области начала трансляции и обнаружено, что в некоторых положениях элементы вторичной структуры различной прочности оказывают противоположное влияние на эффективность трансляции. В отличие от трансляции моноцистронных мРНК, подробно исследованной во многих работах, регуляция трансляции полицистронных матриц мало изучена. Наша репортёрная конструкция позволила подробно изучить трансляцию бицистронной мРНК:

оценить влияние SD, вторичных структур между генами и экспрессии первого гена в опероне на эффективность реинициации трансляции и инициации de novo. При перекрывании или близком расположении стартового и стоп-кодонов SD не настолько необходима для эффективной трансляции, как в случаях большего расстояния между генами одной матрицы или моноцистронных матриц. В ходе работы впервые детально изучено влияние A/U-богатых участков на трансляцию второго гена в опероне, а также обнаружена зависимость эффективности влияния A/U-богатых участков на трансляцию от нуклеотидного контекста участка, следующего за стартовым кодоном. Полученные результаты позволяют лучше понять и количественно оценить эффекты, оказываемые различными элементами мРНК на трансляцию.

Кроме фундаментальных исследований, разработанная система может быть применена и при поиске новых антибиотиков. Нами разработан метод, позволяющий детектировать in vivo присутствие веществ, вызывающих торможение трансляции, и проведен успешный поиск нового антибиотика, тормозящего трансляцию.

Апробация работы. Материалы диссертации докладывались на следующих конференциях: «Chemistry in Molecular Biology», 16-20 декабря, г. Москва, Россия, 2011;

«Фундаментальная наука для биотехнологии и медицины», 29-30 сентября, г. Москва, Россия, 2011; 36th FEBS Congress “Biochemistry for tomorrow’s medicine”, 25-30 июня, г.

Турин, Италия, 2011;

Структура и объем работы. Диссертационная работа изложена на 110 страницах машинописного текста и содержит следующие разделы: введение, обзор литературы, результаты и обсуждение, материалы и методы, выводы и список цитируемой литературы.

Материал иллюстрирован 55 рисунками и 2 таблицами. Библиографический указатель включает 88 цитированных работ.

СОДЕРЖАНИЕ РАБОТЫ

1. СОЗДАНИЕ ДВОЙНОЙ РЕПОРТЁРНОЙ КОНСТРУКЦИИ, ПОЗВОЛЯЮЩЕЙ ПРОВОДИТЬ МНОГОФАКТОРНЫЙ АНАЛИЗ РОЛИ РАЗЛИЧНЫХ ЭЛЕМЕНТОВ мРНК В ТРАНСЛЯЦИИ E. coli.

Первым шагом нашей работы было создание генно-инженерной конструкции, содержащей гены двух флуоресцентных белков: первый – для внутреннего контроля, а второй для определения эффектов, оказываемых различными элементами мРНК. В исходной конструкции использованы одинаковые промотеры и терминаторы транскрипции обоих генов, и их работа не зависит от внутриклеточных процессов.

Измерение относительных значений трансляции (флуоресценция основного белка/флуоресценция внутреннего контроля) позволяет нивелировать эффект, оказываемый экспрессией двух посторонних белков на жизнедеятельность клетки. Даже если на уровень экспрессии репотёрных генов повлияет какой-то неучтенный нами фактор (состав среды, интенсивность перемешивания, температура и т.д.), то он будет одинаково воздействовать на оба белка, значит, отношение интенсивности их флуоресценции зависит только от влияния изучаемых нами особенностей мРНК, но не от внешних условий.

Двойная репортёрная система создана на основе коммерчески доступного вектора pCDFDuet-1 (Novagen), специально разработанного для коэкспрессии двух отдельных генов. Исходные T7lac промотеры были заменены на T5, так как последние могут узнаваться клеточной РНК-полимеразой, и их экспрессия не зависит от эндогенных транскрипционных факторов. В качестве репортёрных выбраны два флуоресцентных белка: Red Fluorescence protein (RFP) [Evrogen] (красный) и Cerulean (CER) (голубой).

Условием выбора из всех флуоресцентных белков явилось практическое отсутствие перекрывания спектров поглощения и испускания, таким образом, уровни их экспрессии можно детектировать независимо. Значения длин волн на максимумах пиков (нм) возбуждения/испускания для CER – 430/486, а для RFP – 531/595. С целью получения двух независимых мРНК и независимой экспрессии после стоп-кодонов репортёрных белков добавлены терминаторные области генов рибосомных РНК (эффективные терминаторы) из оперона rrnB.

Благодаря тому, что выбранные белки являются флуоресцентными, оказалось возможным детектировать уровень их экспрессии прямо в клетках без разрушения и без использования специфических субстратов, что значительно облегчает процесс измерения уровней экспрессии. При обработке полученной репортёрной плазмиды соответствующими эндонуклеазами рестрикции можно легко заменять 5’нетранслируемую область и начало кодирующей гена CER, и изучать эффект различных элементов мРНК, расположенных на 5’-конце моноцистронной матрицы. Кроме того, с помощью ПЦР реакции можно из двух моноцистронных матриц получить плазмиду с одной бицистронной матрицей и изучать эффекты, связанные с реинициациией или инициацией de novo второго гена в опероне.

2. ЗАВИСИМОСТЬ ЭФФЕКТИВНОСТИ ТРАНСЛЯЦИИ ОТ ДЛИНЫ SD И РАССТОЯНИЯ МЕЖДУ SD И СТАРТОВЫМ КОДОНОМ.

При изучении влияния SD на эффективность трансляции в большинстве работ изменялся какой-нибудь один параметр: или длина SD, или расстояние между SD и стартовым кодоном. Для того чтобы оценить встречаемость всех возможных комбинаций между длиной SD и расстоянием до стартового кодона, в нашей лаборатории была составлена двухмерная карта на основе всех аннотированных генов E. coli (рис. 1).

Рис. 1. Распределение длин SD (п.о.) для различных расстояний между SD и стартовым кодоном.

Частота встречаемости отражена при помощи цвета, чем темнее, тем чаще встречается такое сочетания длины SD и расстояния от старта трансляции. Точками отмечены те сочетания длины и расстояния, которые экспериментально проверены в нашей работе. Расстояние рассчитывается от большого G (начиная с a) в последовательности aagGagg и до первого нуклеотида в стартовом кодоне.

Небольшое количество мРНК имеет SD, расположенную ближе чем в 7 и дальше чем в 15 нуклеотидах от стартового кодона, длина SD в основном варьирует от 2 до 7 – полученные данные согласуются с уже описанными в литературе, какой-либо строгой зависимости расположения SD от ее длины при таком анализе обнаружить не удается.

Для экспериментального изучения влияния размера SD, расстояния от SD до AUG и взаимодействия этих параметров между собой, нами созданы 16 репортёрных конструкций, в которых четыре различные по длине SD (2, 4, 6 и 8) располагались на четырех различных расстояниях от стартового кодона CER (7, 10, 13 и 16), и еще одна конструкция, не имевшая участков, комплементарных aSD (рис. 2).

Рис. 2. Схематическое представление (левая колонка) и эффективность трансляции (правая колонка) использованных генно-инженерных конструкций. В названии конструкция первая цифра – длина SD, вторая – расстояния до стартового кодона. Расстояние рассчитывается от большого G (начиная с a) в последовательности aagGagg и до первого нуклеотида в стартовом кодоне. Масштаб столбцов для SD длиной 2 и 4 изменен для лучшей наглядности рисунка.

Максимальную эффективность демонстрирует самая большая SD, расположенная на максимально близком расстоянии (8/7), что, вроде бы, не согласуется с описанными в литературе примерами того, что очень большая SD не эффективна в трансляции.

Благодаря тому, что в нашей работе изменялось и расстояние до AUG, и размер SD, полученные нами данные не находятся в противоречии с литературными, а скорее дополняют их. При удалении от стартового кодона на 10 нуклеотидов (расстояние 10) наблюдается оптимальное значение длины SD –6 (6/10 > 8/10 > 4/10 > 2/10). Однако самая большая SD на таком расстоянии не является самой эффективной, в нашей системе SD 8/ демонстрирует максимальную эффективность. Это удалось установить благодаря присутствию внутреннего стандарта (RFP), позволяющего измерять в наших экспериментах конкуренцию между мРНК с SD 8/7 гена CER и мРНК с SD 5/9 гена RFP, сравнивая эффективность таких SD. Ранее в работах, использовавших один репортёрный ген, было невозможно отличать низкую эффективность трансляции репортерного гена от низкой экспрессии, вызванной замедлением роста клеток. Абсолютное значение флуоресценции CER для SD 8/7 меньше чем для 8/10 и 6/10 (данные не приведены), но относительно флуоресценции RFP оно значительно больше. Возможно, существование в клетках мРНК, обладающих такой эффективной SD, как 8/7, влияет на жизнедеятельность клетки, эта мРНК белка CER «отбирает» рибосомы у мРНК белков, необходимых для нормального роста.

Если из данных статистического анализа не удалось выявить каких-либо зависимостей между длиной SD и расстоянием до стартового кодона, то экспериментальные данные позволили обнаружить такую зависимость, и она оказалась сложнее, чем ожидалось. Для длинной SD, длина 8, эффективность падает с увеличением расстояния между SD и AUG, для SD, имеющей длину 6, наблюдается оптимальное расстояние – 10 (согласуется с данными, полученными в других работах), для средней SD, длина 4, опять та же зависимость, как для 8 – чем ближе, тем лучше. В то же время, для очень короткой SD, длина – 2, нет значительной разницы в расстоянии между SD и AUG (тем не менее, такая короткая SD остается функциональной, матрица 0 дает эффективность еще в десять раз меньшую). Для эффективных SD (8, 6 и 4) наблюдается резкое падение экспрессии при переходе расстояний SD-AUG от 7 или 10 к 13 или 16, так как эти SD по своей нуклеотидной последовательности могут занимать только одно положение в SD-aSD дуплексе. Расстояние больше 10, судя по всему, неэффективно за счет необходимости уместить слишком длинный участок мРНК в рибосоме между aSD и P-сайтом, для короткой же SD GA – такой проблемы нет, так как у нее есть два возможных положения в дуплексе с aSD 3’-AUUCCUCCA-5’.

Таким образом, варьируя лишь два таких параметра, как длина и расположение SD, можно изменять уровень трансляции вплоть до четырех порядков, что указывает на решающую роль SD в определении уровня экспрессии большинства белков.

3.ВЛИЯНИЕ ЭЛЕМЕНТОВ ВТОРИЧНОЙ СТРУКТУРЫ мРНК В ОБЛАСТИ СТАРТА ТРАНСЛЯЦИИ НА ЕЕ ЭФФЕКТИВНОСТЬ.

Для изучения влияния элементов вторичной структуры мРНК на эффективность трансляции моноцистронной матрицы нами создано двенадцать конструкций (H1-H12), содержащих либо большую шпильку (H1-H7) c энергией сворачивания около ккал/моль, либо маленькую (H8-H12) с энергией сворачивания около 6 ккал/моль, шпильки были расположены как перед, так и после стартового кодона (рис. 3).

Рис. 3. Схематическое изображение использованных конструкций со шпильками разного размера в участке инициации трансляции CER и указание относительной эффективности трансляции CER в этих конструкциях. Рядом с каждой шпилькой приведена энергия сворачивания в ккал/моль.

Отрезок, на котором мы расположили шпильки, покрывает участок мРНК, для которого биоинформатический анализ выявил наибольшие отклонения в распределении элементов вторичных структур от случайного (рис. 4 А). Большинство мРНК вообще не содержат элементов вторичной структуры в области инициации трансляции (как наша конструкция 4/7) или содержит слабые вторичные структуры (такие как HP8, HP9, HP10, HP11 и HP12 (рис. 4 Б), прочные элементы вторичной структуры встречаются гораздо реже (в нашем случае это HP1, HP2, HP3, HP4, HP5, HP6 и HP7).

Рис. 4. А. Распределение средней энергии вторичной структуры (ккал/моль) для всех мРНК E. coli в области начала трансляции, точками отмечены положения относительного стартового кодона конструкций, описанных на рис. 3. Б. Частота встречаемости вторичных структур с определенной энергией сворачивания в начальном участке трансляции, точками отмечены энергии сворачивания вторичных структур в конструкциях, описанных на рис. 3.

Присутствие элементов мРНК с прочной вторичной структурой на любом участке, начиная с SD и заканчивая кодирующей областью, сильно снижает эффективность трансляции (HP1-HP4), в то время как сдвиг стабильных вторичных структур от SD в сторону 5’-конца значительно снижает эффект, оказываемый ими на трансляцию. В том случае, если бы для бактериальной трансляции реализовывался механизм сканирования с 5’-конца, как для эукариотической, то стабильные шпильки (HP1) должны были предотвращать и сканирование, но заметного эффекта от их присутствия на 5’-конце не наблюдается. Небольшое снижение эффективности, вероятно, связано с тем, что шпилька HP5 близко расположена к SD и стерически затрудняет посадку 30S субчастицы, а последовательный сдвиг этой шпильки влево, т.е. в сторону 5’-конца, снижает этот эффект. Полностью отрицать возможность сканирования нельзя (так как даже HP7 дает сигнал меньший, чем 4/7), но этот механизм, очевидно, не основной.

Элементы мРНК со слабыми вторичными структурами оказывают различный эффект в зависимости от расположения: в случае попадания стартового кодона AUG в шпильку эффективность трансляции снижается (но меньше, чем в случае сильной шпильки HP9 – HP2), при расположении шпильки в кодирующей области эффективность трансляция наоборот увеличивается (HP8 – HP1), две шпильки на 5’-конце (HP10 и HP12) незначительно увеличивают эффективность трансляции, а HP11 её снижает. Результат, полученный для шпилек HP9 и HP2, согласуется с известным из литературы: снижение прочности вторичной структуры в области посадки 30S субчастицы повышает эффективность трансляции. Повышенная экспрессия гена, содержащего небольшую шпильку в кодирующей области (HP8) может быть объяснена, исходя из предположения, что небольшое торможение в начале кодирующей области увеличивает суммарный выход трансляции за счет предотвращения столкновений рибосом в ходе трансляции.

4. ИНИЦИАЦИЯ DE NOVO И РЕИНИЦИАЦИЯ ТРАНСЛЯЦИИ В СЛУЧАЕ БЛИЗКОРАСПОЛОЖЕННЫХ СТАРТОВОГО И ТЕРМИНАТОРНОГО КОДОНОВ.

Большое количество бактериальных мРНК кодируют сразу несколько генов, и иногда ОРС предшествующего гена перекрывается с ОРС последующего. Самые часто встречающиеся случаи перекрывания – это -4 и -1. Перекрывание на -2 и -3, исходя из нуклеотидного состава стартового и терминаторных кодонов, встречаться не могут, а расстояние между стартовым и стоп-кодоном равное нулю встречается редко. Важный случай расстояния 3 наблюдается для гена infC, кодирующего белок IF3, еще одна особенность этого гена – это стартовый кодон AUU. Для того, чтобы оценить эффективность трансляции второго гена в случае различного взаиморасположения стартового и терминаторного кодонов, мы создали набор репортных конструкций. Восемь из них имели SD перед стартовым кодоном второго гена, а в восьми SD была удалена (рис. 5). Еще в восьми случаях был внесен преждевременный стоп-кодон в последовательность первого гена (14ый кодон был заменен на UAA), в этом случае трансляция второго могла происходить только при инициации de novo. Конструкции со стоп-кодоном в первом гене и без SD у второго также были проверены, в них отсутствовала экспрессия как RFP, так CER. В связи с тем что SD CER попадает в кодирующую область RFP, были созданы контрольные конструкции, в которых в моноцистронной мРНК RFP были внесены соответствующие изменения в конце кодирующей области.

Перекрывание кодирующих областей -4 может встречаться только в одном случае AUGA (рис. 5. SD AUGA, AUGA и –RFP SD AUGA), -1 может реализовываться в двух случаях UAAUG и UGAUG (рис. 5. SD UAAUG, UAAUG, SD UGAUG,UGAAUG, –RFP SD UAAUG и –RFP SD UGAUG).

Рис. 5. Схема (левая колонка) и относительная эффективность трансляции (правая колонка) конструкций с бицистронной мРНК. Обозначения: SD – означает расположение SD перед началом гена CER (серые столбики), отсутствие SD в названии конструкции – SD перед CER нет (белые столбики), -RFP – преждевременный стоп-кодон в начале RFP (черные столбики).

Мы добавили редкий случай расположения стартового кодона сразу за терминаторным (рис. 5. SD UAAAUG, UAAAUG и –RFP SD UAAAUG). Создана также конструкция, воспроизводящая нуклеотидный контекст перекрывания рамок в случае гена infC, и аналогичная конструкция, в которой AUU стартовый кодон заменен на AUG (рис.

5. SD IF3, SD IF3 AUG, –RFP SD IF3 и –RFP SD IF3 AUG). Для обоих случаев, с AUU и с AUG стартовыми кодонами, созданы варианты и без SD (рис. 5. IF3, IF3 AUG). Для того, чтобы проверить эффективность реинициации на большем расстоянии, создана плазмида, в которой стартовый и стоп-кодон разнесены на 20 нуклеотидов (рис. 5. SD UAA 20 AUG, UAA 20 AUG и –RFP SD UAA 20 AUG), а также проверена роль шпильки (аналогичной HP10), расположенной между стоп и старт-кодоном (рис. 5. SD UAA HP AUG, UAA HP AUG и –RFP SD UAA HP AUG).

Во всех случаях взаиморасположения стартового и стоп-кодонов от -4 и до эффективность трансляции CER при наличии SD и трансляции RFP в два раза выше, чем в случае моноцистронной мРНК. Выключение трансляции первого гена приводит к примерно двукратному падению сигнала во всех случаях. Замена стартового кодона в IFc AUU на AUG приводит к примерно четырехкратному увеличению сигнала, подтверждая предположение о том, что трансляция IF3 в клетках специально снижена и поставлена в зависимость от присутсвия этого белка. Удаление SD приводит к снижению сигнала, но он все еще остается сравнительно большим, тогда как моноцистронная матрица без SD приводила к падению сигнала до уровня предела обнаружения. Без SD инициация de novo практически не происходит, и экспрессия CER в этом случае наблюдается благодаря реинициации трансляции. Существование SD, судя по всему, не настолько важно для реинициации, насколько необходимо для инициации de novo. Увеличение расстояние между генами до 20 нуклеотидов увеличивает зависимость экспрессии второго гена от присутствия SD, если рибосоме (скорее всего 30S субчастице) нужно пройти какое-то расстояние для реинициации, то SD помогает ей удержаться на мРНК, но если стартовый кодон на момент терминации находится внутри рибосомы, то SD играет куда меньшую роль. Интересно, что расположение стартового кодона сразу после стоп-кодона приводит к тому, что реинициация без SD становится настолько же неэффективной, как в случае расстояния 20. Возможно, из-за низкой эффективности трансляции в отсутствии SD, такое взаиморасположение стартового и стоп-кодонов редко встречается в геноме E. coli.

Если сканирование с 5’-конца для бактериальной трансляции маловероятно, то сканирование после стоп-кодона первого гена и до стартового кодона второго считается одним из основных механизмов реинициации. Необходимое для реинициации скольжение рибосомы по мРНК может быть затруднено из-за расположения элементов мРНК с вторичной структурой между генами. Для проверки этого предположения довольно прочная шпилька с энергией сворачивания -9 ккал/моль помещалась между стоп и старт кодонами. В случае выключения трансляции первого гена наблюдалось падение экспрессии второго более, чем в три раза, что говорит о реализации инициации трансляции по механизму реинициации. Удаление SD также приводит к очень сильному падению экспрессии, как и в случае UAA 20 AUG, для реинициации на таком расстоянии присутствие SD необходимо.

5. РОЛЬ A/U-БОГАТЫХ УЧАСТКОВ В ТРАНСЛЯЦИИ МОНОЦИСТРОННЫХ И ПОЛИЦИСТРОННЫХ МРНК.

A/U-богатые участки в 5’-нетранслируемой области мРНК увеличивают уровень экспрессии, по всей видимости, за счет взаимодействий с белком S1. Большое количество экспериментальных данных накоплено о влиянии A/U-богатых участков на трансляцию моноцистронных мРНК, и практически нет никакой информации о роли этого элемента при трансляции второго гена в опероне. Этот вопрос изучен при помощи нашей репортёрной системы.

Разместив A/U-богатую последовательность гена phoP (UAUUUUAAUAAUUAA) перед SD гена CER в случае моноцистронных матриц, мы показали, что данный элемент увеличивает эффективность трансляции более чем в четыре раза (рис. 6. 4/7 и 4/7 A/U).

Затем мы разместили A/U-богатый участок в конце гена RFP, чтобы изучить его влияние на реинициацию, использовав описанные ранее конструкции с различными случаями взаиморасположения стартового и стоп-кодона. Необходимо отметить, что добавление такого участка на C-конец RFP привело к тому, что белок перестал быть флуоресцентным, поэтому в таких экспериментах проводилась нормировка сигнала CER на количество клеток, определенное по оптической плотности.

Рис. 6. Схема (левая колонка) и относительная эффективность трансляции (правая колонка) конструкций с мРНК, содержащей или не содержащей A/U-богатые участки. Обозначение: A/U - если есть A/U-богатый участок перед геном CER (черные столбики), если A/U-богатых участков нет (серые столбики).

Для всех возможных вариантов взаиморасположения стоп кодона RFP и стартового кодона CER (-4, -1, 0 и +3) мы наблюдали значительное увеличение уровня экспрессии при существовании A/U-богатого участка, как и в случае A/U-богатого участка на 5’конце моноцистронной матрицы (рис. 6). Сравнение результатов, полученных для SD IF3, SD IF3 A/U, SD IF3 AUG и SD IF3 AUG A/U (рис. 6), показывает, что относительный усиливающий эффект, оказываемый взаимодействием A/U-богатого участка с рибосомой не зависит от стартового кодона. В случае неканонического AUU наблюдается такое же относительное увеличение экспрессии, как и для AUG. Удаление последовательности SD снижает абсолютное значение сигнала, но относительный эффект от A/U-богатого участка остается таким же (рис. 7. IF3 AUG и IF3 AUG A/U). Размещение аналогичных последовательностей на 5’-конце CER в случае моноцистронных матриц приводит к таким же эффектам, A/U-богатый участок стимулирует трансляцию и моноцистронной, и бицистронной матрицы (рис. 7. 5’-SD IF3 AUG A/U). Выключение трансляции первого гена не влияет на относительный эффект от присутствия A/U-богатого участка (рис. 7. RFP SD IF3 AUG и –RFP SD IF3 AUG A/U). Размещение такого участка в межгенной области, после стоп-кодона RFP, также оказывает положительный эффект на трансляцию CER (рис. 7. UAA SD IF3 AUG A/U). Судя по всему, A/U-богатый участок всегда увеличивает эффективность трансляции в несколько раз, но при этом осуществляет это независимо от SD, стартового кодона или организации генов в опероне.

Рис. 7. Схема (левая колонка) и относительная эффективность трансляции (правая колонка) конструкций с мРНК, содержащей или не содержащей A/U-богатые участки. Обозначение: A/U - если есть A/U-богатый участок перед геном CER (черные столбики), если нет A/U-богатых участков (серые столбики), 5’ – моноцистронная матрица.

Несмотря на такую универсальность нам удалось обнаружить случаи, в которых A/U-богатый участок не оказывает стимулирующего влияния на трансляцию. Эффект, оказываемый A/U-богатым участком, не зависит от SD, стартового кодона или организации генов в опероне, но зависит от нуклеотидного состава кодонов следующих за стартовым. Нуклеотидная последовательность гена CER, используемая нами почти во всех конструкциях, выглядит следующим образом:

ATGAAAGAGACGGACGAGAGCGGC (MKETDESG). Во втором положении находится кодон AAA, который согласно литературным данным должен обеспечивать максимальный уровень экспрессии. Мы удалили этот кодон и в получившейся последовательности: ATGGAGACGGACGAGAGCGGC (METDESG), во втором положении оказался кодон GAG, которой считается одним из самых неэффективных. Тем не менее, такая замена в случае моноцистронных мРНК не привела к падению уровня экспрессии, но неоптимальный +2 кодон сделал неэффективной стимуляцию трансляции A/U богатой последовательностью (рис. 8. 4/7 AUG AAA, 4/7 AUG AAA A/U, 4/7 AUG GAG и 4/7 AUG GAG A/U).

Рис. 8. Схема (левая колонка) и относительная эффективность трансляции (правая колонка) конструкций с мРНК, содержащей или не содержащей A/U-богатые участки. Обозначение: A/U - если есть A/U-богатый участок перед геном CER, если нет A/U – A/U-богатых участков нет.

A/U-богатый участок между генами RFP и CER в случае бицистронной конструкции SD UAA 20 AUG GAG, когда в +2 положении гена CER располагался GAG, а не AAA, не стимулировал трансляцию вне зависимости от присутствия или отсутствия SD (рис. 8. SD UAA 20 AUG GAG, SD UAA 20 AUG GAG A/U, UAA 20 AUG GAG и UAA 20 AUG GAG A/U). Нами также протестирована еще одна SD (такая же, как и для конструкций с близкорасположенными стоп- и стартовым кодонами), в этом случае стимулирующий эффект A/U-богатого участка также зависит от контекста кодонов, следующих за стартовым (рис. 8 SD2 UAA 20 AUG AAA A/U и SD2 UAA 20 AUG GAG A/U).

Исходя из известных данных о ходе инициации трансляции, можно предположить, каким образом кодон в положении +2 влияет на взаимодействия между участками: S1 и A/U-богатым участком. В случае инициации кодон, находящийся в A-сайте (+положение), может взаимодействовать с белком IF1, который, по всей видимости, закрывает A-сайт от аа-тРНК до тех пор, пока не закончилась инициация. Возможно, что нуклеотидный состав второго кодона определяет разную степень эффективности подобных взаимодействий. Эффект, оказываемый вторым кодоном, может быть связан не только с нуклеотидной последовательностью, но и с типом аминокислоты (заряд, размер, гидрофильность), а также с тем, насколько редка соответствующая тРНК. Возможно, что второй кодон мРНК влияет также на эффективность потери пептидил-тРНК рибосомой (peptidyl-tRNA drop-off).

6. ВЫСОКОПРОИЗВОДИТЕЛЬНЫЙ МЕТОД ОПРЕДЕЛЕНИЯ МЕХАНИЗМА ДЕЙСТВИЯ АНТИБИОТИКОВ, ОСНОВАННЫЙ НА ИСПОЛЬЗОВАНИИ ДВОЙНОЙ РЕПОРТЁРНОЙ СИСТЕМЫ RFP/CER.

На основе двойной репортёрной конструкции разработана система для детектирования сублетальных концентраций антибиотиков, вызывающих торможение рибосомы. Экспрессия гена CER поставлена в зависимость от скорости трансляции, в то время как RFP продолжал выполнять функции внутреннего контроля. Использование флюоресценции в качестве сигнала позволяет проводить все исследования в живых клетках без их разрушения: в жидкой среде или на чашках с агаром, что значительно облегчает и ускоряет процесс скрининга больших библиотек потенциальных антибиотиков.

Рис. 9. Предполагаемая вторичная структура лидерного участка, предшествующего гену CER, при различных условиях. (Слева) Вторичная структура лидерного участка мРНК в присутствии антибиотика, тормозящего трансляцию, аналогичная вторичной структуре trpL мРНК при низкой концентрации триптофана; (Справа) Вторичная структура лидерного участка мРНК в отсутствии антибиотиков, тормозящих трансляцию, аналогичная вторичной структуре trpL мРНК при высокой концентрации триптофана.

Регуляция экспрессии гена, основанная на скорости трансляции, встречается и в природе, классический пример – триптофановый оперон E. coli, регулируемый по механизму аттенюации. В начале оперона trpLEDCBA закодирован короткий пептид trpL, содержащий два идущих подряд кодона триптофана. При избытке триптофана в клетке рибосома быстро транслирует этот участок и идет дальше, что приводит к образованию вторичной структуры, стимулирующей преждевременную терминацию транскрипции, в результате чего оперон не экспрессируется. При недостатке триптофана рибосома надолго останавливается на этих двух кодонах из-за отсутствия соответствующих аминоацилированных тРНК, образующаяся альтернативная вторичная структура не мешает РНК-полимеразе продолжить транскрипцию оперона. В результате образуются белки, необходимые для биосинтеза триптофана. Взяв за основу последовательность лидерного пептида trpL, и, поместив ее перед началом гена CER, мы получили конструкцию, в которой экспрессия RFP – постоянная, а экспрессия CER зависит от концентрации триптофана. Затем два триптофановых кодона заменялись на два аланиновых, которые рибосома всегда быстро транслирует. При обычных условиях это должно приводить к ингибированию экспрессии CER. В присутствии же антибиотика замедляющего трансляцию (в сублетальной концентрации), рибосома все равно медленно транслирует участок с двумя аланиновыми кодонами, что приводит к сворачиванию альтернативной вторичной структуры и увеличению экспрессии CER (рис. 9).

На первом этапе мы убедились, что экспрессия CER в конструкции с природным trpL зависит от концентрации триптофана, а в конструкции, в которой два триптофановых кодона заменены на два аланиновых – нет. Уровень флуоресценции CER в TrpL2A такой же как в TrpL в присутствии триптофана, т.е. наше предположение подтверждается. А именно, замена кодонов привела к тому, что рибосома всегда транслирует этот участок быстро и экспрессия падает (рис. 10).

Рис. 10. Зависимость экспрессии CER от присутствия триптофана в среде для культивирования (M9), в клетках дикого типа, трансформированных плазмидой pRFPCER-TrpL или плазмидой pRFPCER-TrpL2A.

Затем, нами тестировался большой набор известных антибиотиков при помощи дисков и агара с газоном клеток, содержащих плазмиду pRFPCER-TrpL2A. Антибиотики, замедляющие трансляцию: макролиды (эритромицин, кларитромицин, рокситромицин и олеандомицин), азалиды (азитромицин) и линкозамиды (линкомицин), вызывают увеличение сигнала CER на границе зоны ингибирования, в то время как для антибиотиков с другим механизмом действия подобного эффекта не наблюдается (рис. 11.

А).

Рис. 11. А. Тестирование влияния антибиотиков на экспрессию CER в клетках дикого типа (или штамма tolC), трансформированных плазмидой pRFPCER-TrpL2A, на чашках с агаром. Обозначения антибиотиков: эритромицин (Ery), кларитромицин (Cla), рокситромицин (Rox), олеандомицин (Ole), азитромицин (Azi), сульфаниламид (Sul), полимиксин (Pol), рифампицин (Rif), неомицин (Neo), клиндамицин (Cli), налидиксовая кислота (Nal), норфлоксацин (Nor), тобрамицин (Tob), левофлоксацин (Lev), фосфомицин (Pho), стрептомицин (Sm), хлорамфеникол (Cm), тетрациклин (Tet), канамицин (Kan), ванкомицин (Van), линезолид (Linez) и линкомицин (Linc). Б. Действие дисков, пропитанных культуральными жидкостями набора штаммов актиномицет на газон клеток штамма tolC, трансформированного плазмидой pRFPCER-TrpL2A. В. Сравнение действия экстракта штамма «428/07» и эритромицина на газон клеток штамма tolC, трансформированного плазмидой pRFPCER-TrpL2A. Г.

Тестирования влияния культуральных жидкостей бактерий продуцентов антибиотиков S. venezuelae Ehrlich (хлорамфеникол), S. fradiae (тилозин и неомицин), и S. griseus (стрептомицин) на экспрессию CER в клетках дикого типа, трансформированных плазмидой pRFPCER-TrpL2A, на чашках с агаром.

Белок TolC отвечает за экспорт различных метаболитов из клетки, в том числе он экспортирует и антибиотики. Использование штамма tolC позволило снизить минимальную ингибирующую концентрацию и определить механизм действия антибиотиков, которые не действуют на обычный штамм E. coli дикого типа. Штамм E.

coli, несущий tolC аллель, может служить своеобразной моделью грамположительной бактерии благодаря тому, что обладает повышенной чувствительностью к некоторым антибиотикам. Далее мы протестировали культуральные жидкости микроорганизмов продуцентов известных антибиотиков: Streptomyces venezuelae Ehrlich (хлорамфеникол), Streptomyces fradiae (тилозин и неомимцин) и Streptomyces griseus (стрептомицин). Как и ожидалось, культуральные жидкости продуцентов антибиотиков, замедляющих трансляцию (хлорамфеникол и тилозин), вызывают индукцию сигнала CER на границе зоны ингибирования, а культуральная жидкость стрептомицина, вызывающего ошибки при синтезе белка, ее не вызывают (рис. 11. Г).

Разработанный нами метод широкомасштабного поиска антибиотиков, замедляющих трансляцию, использовался также для изучения набора культуральных жидкостей почвенных бактерий (актиномицетов), обладающих антибактериальной активностью против метицилин-устойчивового штамма Staphylococcus aureus, но с неизвестным механизмом действия. Для этого мы использовали штамм tolC, трансформированный плазмидой pRFPCER-TrpL2A, так как концентрации действующих веществ в культуральных жидкостях было недостаточно, чтобы убить клетки дикого типа E. coli.

Среди протестированных сорока пяти образцов один приводил к заметной индукции CER на границе зоны ингибирования (рис. 11 Б).

При помощи экстракции хлороформом из культуральной жидкости этого штамма (Micromonospora sp. 428/07) получен экстракт, обладающий антибактериальной активностью и вызывающий индукцию CER также, как и эритромицин (рис. 11 В). Для подтверждения того, что обнаруженный нами антибиотик действительно действует на трансляцию, проведен ряд in vivo и in vitro экспериментов. Показано, что аминокислота гомопропаргилглицин может быть использована рибосомой при синтезе белка и встраивается вместо метионина. За счет того, что эта аминокислота имеет алкинильную группу можно, используя флуоресцентную метку (Cy5), содержащую азидную группу, проводить реакцию [3 + 2]-циклоприсоединения, катализируемую ионами Cu+, получая помеченные флуоресцентной меткой белки. Добавление гомопропаргилглицина в культуральную среду после добавления антибиотика позволяет оценить падение уровня синтеза белка, так как гомопропаргилглицин встраивается только во вновь синтезируемые (в присутствии антибиотика) белки. Мы проверили три различные концентрации экстракта 428/07, и три концентрации эритромицина, соответствующие концентрациям экстракта по уровню ингибирования клеточного роста на чашке с агаром. Увеличение концентрации экстракта 428/07, как и эритромицина, приводит к снижению количества синтезируемого белка, т.е. обнаруженный нами антибиотик ингибирует синтез белка in vivo (рис. 12 А). Даже если антибиотик действует на транскрипцию, а не на трансляцию, то после его добавления уровень синтеза белка будет падать. Чтобы убедиться в том, что обнаруженный антибиотик действительно действует на рибосому, мы изучали его активность in vitro. Для этого в сотрудничестве с лабораторий В.А. Колба (Институт Белка РАН) проведена in vitro трансляция предварительно синтезированной мРНК люцеферазы.

Экстракт 428/07, как и эритромицин (положительный контроль) ингибирует in vitro трансляцию, а рифампицин, действующий на РНК-полимеразу, и использованный в качестве отрицательного контроля, её не ингибирует (рис. 12 Б).

Рис. 12 А. In vivo ингибирование синтеза белка разными концентрациями экстракта 428/07 и соответствующими им по активности на чашках с агаром растворами эритромицина. Cy5-флуоресценция отражает количество вновь синтезированных белков, а окрашивание геля Кумасси показывает общее количество белка. Б. In vitro ингибирование трансляции мРНК люцеферазы, выраженное в миллионах вспышек в секунду (ввс) в присутствии эритромицина, рифампицина и экстракта 428/07.

Разработанный метод анализа механизма действия антибиотиков обладает рядом преимуществ, отличающих его от ранее созданных систем. Во-первых, использование флуоресцентных белков позволяет проводить анализ in vivo, без разрушения клеток и выделения каких-либо ее компонентов. Это очень полезно при первичном широкомасштабном скрининге, когда проверяют тысячи соединений на наличие антибактериальной активности, одновременно с этим можно отбирать антибиотики, замедляющие трансляцию, проводя первичный скрининг на клетках, трансформированных плазмидой pRFPCER-TrpL2A. Во-вторых, использование штаммов дикого типа E. coli и tolC позволяет одновременно проверять эффективность проникновения антибиотика в клетку, и обнаруживать потенциальные антибиотики даже при низкой концентрации. В-третьих, наш метод позволяет обнаруживать антибиотики, даже если они находятся в концентрации меньше МИК. А именно, если нет зоны ингибирования, но наблюдается увеличение индукции CER, значит, в образце присутствует вещество, замедляющее трансляцию, но его недостаточно, чтобы убить клетку.

ВЫВОДЫ 1) Впервые показано, что наибольшую эффективность трансляции обеспечивает последовательность Шайна-Дальгарно длиной 8 нуклеотидов, расположенная на расстоянии 7 нуклеотидов от стартового кодона до центрального G в последовательности aagGaggu.

2) Продемонстрировано, что последовательность Шайна-Дальгарно длиной 6 наиболее эффективна при расположении на расстоянии 10 нуклеотидов от стартового кодона до центрального G в последовательности agGagg.

3) Установлено, что элементы вторичной структуры мРНК, расположенные с 5’-конца от последовательности Шайна-Дальгарно, не снижают эффективность трансляции.

4) Показано, что элементы вторичной структуры мРНК в области стартового кодона или последовательности Шайна-Дальгарно ингибируют трансляцию.

5) Обнаружено, что при перекрывании стартового и терминаторного кодонов двух генов (UAAUG, UGAUG и AUGA) эффективность реинициации в меньшей степени зависит от присутствия последовательности Шайна-Дальгарно, чем при удалении стартового кодона от терминаторного на 20 нуклеотидов или расположении их друг за другом (UAAAUG).

6) Исследована роль A/U-богатых участков, расположенных с 5’-конца от стартового кодона, и установлено, что они увеличивают уровень экспрессии гена вне зависимости от характера стартового кодона, присутствия последовательности Шайна-Дальгарно или расположения гена в опероне.

7) Впервые показано, что стимулирующий трансляцию эффект, оказываемый A/U-богатыми участками, зависит от последовательности второго кодона.

8) Разработана репортёрная система для поиска новых антибиотиков, замедляющих трансляцию.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Osterman I.A., Prokhorova I.V., Sysoev V.O., Boykova YV, Efremenkova O.V., Svetlov M.S., Kolb V.A., Bogdanov A.A., Sergiev P.V., and Dontsova O.A. Attenuation-based dual-fluorescentprotein reporter for screening translation inhibitors. // Antimicrob Agents Chemother. 2012 56, №4, p. 1774-83.

2. Golovina A.Y., Dzama M.M., Osterman I.A., Sergiev P.V., Serebryakova M.V., Bogdanov A.A., and Dontsova O.A. The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA. // RNA.

2012 18, №9, p. 1725-34.

3. Sergiev P.V., Golovina A.Y., Sergeeva O.V., Osterman I.A., Nesterchuk M.V., Bogdanov A.A., and Dontsova O.A. How much can we learn about the function of bacterial rRNA modification by mining large-scale experimental datasets? // Nucleic Acids Res. 2012, 40, №12, p. 5694-705.

4. Osterman I.A., Sergiev P.V., Tsvetkov P.O., Makarov A.A., Bogdanov A.A., and Dontsova O.A.

“Methylated 23S rRNA nucleotide m(2)G1835 of Escherichia coli ribosome facilitates subunit association”. // Biochimie. 2011 93, №4 p. 725-9.

5. Osterman I., Sergiev P., Kazanov M., and Dontsova O. New class of Escherichia coli small RNAstRNA associated RNAs (TARs). // FEBS Journal. 2011, 278, №471, p. 1742-464.

6. Sergiev P.V., Golovina A.Y., Prokhorova I.V., Sergeeva O.V., Osterman I.A., Nesterchuk M.V., Burakovsky D.E., Bogdanov A.A., and Dontsova O.A.. Modifications of ribosomal RNA: From enzymes to function. // Rodnina, Marina V.; Wintermeyer, Wolfgang; Green, Rachel (Eds.) Ribosomes Structure, Function, and Dynamics. 1st Edition., Wien/New York 2011. p.97-111.

7. Сергиев П.В., Остерман И.А., Прохорова И.В., Нестерчук М.В., Сергеева О.В., Головина А.Я., Демина И.А., Галямина М.А., Серебрякова М.В., Донцова О.А. Опыт изучения методами системной биологии функциональной роли ферментативной модификации бактериальной рибосомы. // Биоорганическая химия. 2011, том 37, № 1, С. 81-8. Ilya A. Osterman, Irina V. Prokhorova, Vasily O. Sysoev, Yulia V. Boykova, Olga V.

Efremenkova, Maxim S. Svetlov, Vyacheslav A. Kolb, Alexey A. Bogdanov, Petr V.Sergiev, Olga A. Dontsova. Attenuation based dual fluorescent protein reporter for screening translation inhibitors.

«Chemistry in Molecular Biology». Moscow, 2011, 16-20 December, abstract book p.9. П.В. Сергиев, И.А. Остерман, И.В. Прохорова, Е. Ордабаев, В. Сысоев, М.В. Нестерчук, О.В. Сергеева, А.Я. Головина, А.В. Головин, А.В. Шишкина, Н.В. Сумбатян, Г.А. Коршунова, О.В. Евфременкова, О.А. Донцова Антибиотики, действующие на рибосому: поиск новых и усовершенствование старых. "Постгеномные методы анализа в биологии, лабораторной и клинической медицине". Новосибирск, 2011, 14-17 ноября, 2011, сборник тезисов с.10. И.А. Остерман, П.В. Сергиев, О.А. Донцова. Разработка высокопроизводительного метода тестирования механизма действия антибактериальных препаратов и его применение к библиотеке потенциальных антибиотиков. «Фундаментальная наука для биотехнологии и медицины, материалы конференции». Москва, 2011, 29-30 сентября, сборник тезисов, с.50.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.