WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

АБРАМОВА ТАТЬЯНА ВЕНИАМИНОВНА

МЕТОДОЛОГИЯ ПОЛУЧЕНИЯ МОДИФИЦИРОВАННЫХ ОЛИГОДЕЗОКСИРИБОНУКЛЕОТИДОВ ДЛЯ СОЗДАНИЯ ЭФФЕКТИВНЫХ ИНСТРУМЕНТОВ МОЛЕКУЛЯРНОБИОЛОГИЧЕСКИХ ИССЛЕДОВАНИЙ

02.00.10 – биоорганическая химия

Автореферат диссертации на соискание учной степени доктора химических наук

Новосибирск – 2012

Работа выполнена в Институте химической биологии и фундаментальной медицины СО РАН

Официальные оппоненты:

Орецкая Татьяна Семёновна, д.х.н., профессор Московский государственный университет имени М. В. Ломоносова, профессор Салахутдинов Нариман Фаридович, д.х.н.

Новосибирский институт органической химии имени Н. Н. Ворожцова СО РАН, зав. отделом Позмогова Галина Евгеньевна, д.х.н., профессор Научно-исследовательский институт физико-химической медицины ФМБА России, зав. лабораторией

Ведущая организация:

Институт биоорганической химии имени академиков М. М. Шемякина и Ю. А. Овчинникова РАН

Защита состоится « » 2012 г. в часов на заседании диссертационного совета Д 003.045.01 на базе Федерального государственного бюджетного учреждения науки Институт химической биологии и фундаментальной медицины СО РАН по адресу: Новосибирск, проспект академика Лаврентьева,

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждении науки Институт химической биологии и фундаментальной медицины СО РАН Автореферат разослан « » 2012 г.

Учный секретарь диссертационного совета к.х.н., доцент Коваль В.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы. В рамках биоорганической химии химия нуклеиновых кислот представляет собой обширный раздел, бурно развивающийся на протяжении последних 50 лет. Развитие методов синтеза НК обеспечило возможность поисковых исследований по применению олигонуклеотидов природного строения, их производных, аналогов (АО) и миметиков НК для решения фундаментальных научных проблем молекулярной биологии.

В процессе поиска подходов к решению одной из фундаментальных проблем молекулярной биологии, а именно – к выяснению функций отдельных генов и возможности избирательной регуляции их экспрессии, был предложен метод комплементарно-адресованной модификации НК. Позднее идея антисмысловой регуляции экспрессии генов была продемонстрирована на примере подавления репликации и трансляции вируса саркомы Рауса с помощью олигодезоксирибонуклеотидов (OdN), комплементарных вирусной РНК. В последние 30 лет этот подход в разных вариантах (антисмысловая – «antisense», или смысловая – «sense», стратегии) интенсивно применяется как при изучении, например, фундаментальных проблем молекулярного эмбриогенеза, так и при разработке и внедрении в медицинскую практику новых типов лекарственных средств. Другой крайне важной областью, где прогресс немыслим без широкого применения природных и модифицированных олигонуклеотидов, является диагностика наличия с помощью зондов на основе OdN определенных последовательностей НК в биологических образцах или других препаратах.

Еще в начале поисковых исследований по применению олигонуклеотидов в качестве инструментов молекулярно-биологических исследований стало ясно, что дальнейшее изучение взаимодействия OdN с клетками, попытки регуляции экспрессии генов с помощью антисмыслового подхода и применение олигонуклеотидов в медицинской практике сталкиваются с серьезными проблемами. Первая проблема заключалась в отсутствии эффективных методов синтеза OdN в количествах, достаточных для широкомасштабных фундаментальных исследований и практического применения. Вторая проблема – олигонуклеотиды природного строения плохо проникают через клеточные мембраны и быстро деградирут в биологических средах под действием ферментов. Кроме того, OdN не обладают достаточным разнообразием функциональных групп для создания новых поколений инструментов молекулярной биологии, например, диагностических зондов и аптамеров, что ставит перед исследователями задачу дополнительной функционализации олигонуклеотидов. Возможность обратимого модифицирования OdN открывает новые перспективы в применении производных OdN при изучении белковонуклеиновых взаимодействий, для аффинной хроматографии, при направленной регуляции экспрессии генов.

На пути к решению этих проблем были предложены эффективные методы синтеза олигонуклеотидов на полимерном носителе и в растворе. Для повышения устойчивости к ферментативной деградации и улучшения проникновения через клеточные мембраны было признано необходимым использовать модифицированные олигонуклеотиды. Было отмечено, что особенно удобно проводить модифицирование олигонуклеотидов, если на конце олигомера имеется фосфатная группа. Это связано с наличием предложенных к тому времени эффективных и селективных методов активации моноэфиров фосфорной кислоты, что позволяет легко синтезировать конъюгаты олигонуклеотидов с остатками, содержащими различные функционально активные группы (алкилирующие, фотоактивируемые).

Однако, достигнутый к началу 90-х гг. уровень исследований по синтезу природных и модифицированных OdN не позволял в полной мере решить существовавшие проблемы ввиду недостаточного развития препаративных методов и стратегии получения производных олигонуклеотидов. Мало разработанными оставались подходы к обратимому модифицированию OdN и ферментативные способы синтеза модифицированных OdN.

Практически отсутствовали примеры многофункциональных и глубоко модифицированных производных (миметиков НК).

В связи с изложенным, необходимо было осуществить исследование, направленное на разработку методов синтеза модифицированных OdN, особенно подходов, позволяющих эффективно получать значительные количества этих соединений как в плане увеличения разнообразия структур, так и с точки зрения масштабирования синтеза конкретных олигомеров. Общая стратегия при этом должна была быть направленной на создание эффективных инструментов решения фундаментальных задач молекулярной биологии.

При этом приоритетными изменениями физико-химических и биологических свойств природных соединений представлялись повышение термостабильности комплементарных комплексов их производных, разработка подходов к обратимому модифицированию, создание новых аналогов OdN и миметиков НК, перспективных для изучения регуляции экспрессии генов с помощью антисмыслового подхода, увеличение разнообразия функциональных групп в олигонуклеотидах для синтеза высокофункционализированных НК.

Цель и задачи работы. Целью настоящей работы являлась разработка методологии получения модифицированных олигодезоксирибонуклеотидов, в том числе в препаративных масштабах, для создания эффективных инструментов молекулярнобиологических исследований. Для этого необходимо было решить следующие задачи:

1. Модернизировать синтетическую базу получения природных и модифицированных OdN в препаративных количествах. Предполагалось разработать новый эффективный метод синтеза защищённых мономеров и усовершенствовать триэфирный метод синтеза 5’-фосфорилированных OdN в растворе с использованием 5’фосфо-2’-дезоксинуклеотидов в качестве исходных соединений.

2. Создать комплекс подходов к синтезу модифицированных по сахарофосфатному остову и по гетероциклическим основаниям OdN. Предполагалось разработать новые подходы к синтезу производных OdN, модифицированных по сахарофосфатному остову и по гетероциклическим основаниям, в том числе с обратимыми в случае необходимости модификациями. Для модифицирования OdN по концам олигомера предполагалось разработать новые методы получения бис-модифицированных производных и изучить различные стратегии синтеза 5’-конъюгатов с использованием 5’-фосфорилированных OdN.

3. Осуществить дизайн и разработать методы синтеза новых производных олигонуклеотидов. Предполагалось осуществить дизайн и разработать методы синтеза новых конъюгатов и аналогов OdN и новых миметиков НК с учетом выбранных приоритетных направлений изменения физико-химических и биологических свойств природных соединений, разработать новые методы синтеза трифосфатов природных и модифицированных OdN (на примере динуклеотидов), как потенциальных субстратов для получения высокофункционализированных НК ферментативными методами.

Научная новизна и практическая значимость работы. Настоящая работа представляет собой систематическое исследование, посвященное разработке комплекса подходов к синтезу модифицированных OdN, в результате которого создана новая методология получения модифицированных OdN, в том числе в препаративных количествах.

Разработан эффективный препаративный метод получения природных и модифицированных OdN, основанный на применении триэфирного метода синтеза в растворе с использованием 5’-фосфатов 2’-дезоксинуклеозидов в качестве исходных соединений. Метод отличается универсальностью, масштабами синтеза и экономичностью. С его помощью получены серии 5’-фосфорилированных природных и модифицированных OdN в препаративных количествах. Эти олигомеры успешно использованы сотрудниками НИБХ СО АН и ИХБФМ СО РАН в качестве инструментов молекулярно-биологических исследований при проведении большого цикла фундаментальных работ по изучению закономерностей комплементарно-адресованной модификации НК, исследованию возможностей антисмыслового подхода к регуляции экспрессии генов и контролированию развития вирусных инфекций в культурах клеток и in vivo. С использованием полученных в настоящей работе фосфотриэфирных этилированных аналогов олигонуклеотидов сотрудниками НИБХ СО АН осуществлен цикл фундаментальных исследований по выявлению зависимости степени поглощения олиготимидилатов клетками от гидрофобности олигомеров (доли фосфотриэфирных фрагментов) и от конфигурации асимметрического фосфотриэфирного центра.

Обнаружена зависимость степени комплементарно-адресованной модификации поли(А)трактов мРНК этиловыми эфирами олиготимидилатов от конфигурации при асимметрических атомах фосфора в культуре клеток.

Применение эффективного препаративного метода получения природных и модифицированных OdN в растворе, разработанного в ходе настоящего исследования, позволило обеспечить модельными соединениями проведение фундаментальных работ по определению пространственной структуры комплементарных комплексов природных OdN, их конъюгатов и аналогов в растворе методом ЯМР в НИБХ СО РАН и Университете штата Техас (США). В настоящее время мы работаем над дизайном и синтезом модельных соединений (конъюгатов моно-, ди- и олигонуклеотидов) для изучения химической поляризации ядер методом ЯМР в МТЦ СО РАН.

В ходе разработки комплекса подходов к синтезу модифицированных по сахарофосфатному остову и по гетероциклическим основаниям OdN получены новые 5’- и/или 3’-конъюгаты OdN с соединениями различной природы: интеркалирующими (хромонами, кумаринами), реакционноспособными (порфиринами, фталоцианинами, урокановой и имидазолуксусной кислотами), гидрофобными (холестерином) остатками.

Для синтеза OdN, модифицированных внутри олигонуклеотидной цепи, впервые предложено использовать амидофосфиты, содержащие метоксиоксалилные группыпредшественники, присоединенные к гетероциклическим основаниям или к углеводному остатку. Реализация прекурсорного подхода с помощью этих синтонов открывает перспективы получения олигомеров, модифицированных внутри цепи, методами комбинаторной химии.

В ходе поиска транспортных форм OdN, предназначенных для антисмысловой терапии (про-OdN), предложен новый подход к обратимому блокированию межнуклеотидных фосфатных групп в OdN, заключающийся в применении фотолабильных фосфотриэфирных аналогов OdN. В рамках подхода осуществлен дизайн и разработаны методы синтеза новых фотолабильных триэфирных аналогов олигонуклеотидов в растворе и на полимерном носителе. Найдены условия фотодеблокирования этих соединений.

Для осуществления обратимого модифицирования OdN по концам олигомера или внутри цепи предложены оригинальные универсальные фотолабильные линкерные группы, содержащие о-нитробензильный фрагмент. Дизайн новых линкеров позволяет реализовывать различные стратегии синтеза конъюгатов OdN, гибко варьируя методы получения и место модифицирования в зависимости от целей дальнейшего применения конъюгатов.

Предложен новый эффективный метод синтеза 5’-трифосфатов природных динуклеотидов, основанный на активации 5’-монофосфата динуклеотидов под действием 2,2’-дипиридилдисульфида и трифенилфосфина в присутствии нуклеофильного катализатора. Разработан новый подход к синтезу 5’-трифосфатов модифицированных моно- и динуклеозидов. Подход заключается в комбинации синтеза нуклеозидной части молекулы в растворе с использованием широкого арсенала олигонуклеотидной химии с последующим введением трифосфатного остатка в соответствующим образом защищенные олигомеры и последующей постсинтетической обработке в случае необходимости. Разработанные методы обеспечивают получение природных и модифицированных 5’-трифосфатов моно- и динуклеотидов с высоким выходом и в препаративных количествах.

С использованием новых подходов и методов созданы серии 5’-трифосфатов природных и модифицированных динуклеотидов – потенциальных субстратов для ферментов матрично-зависимого синтеза олигонуклеотидов. Трифосфаты содержат широкий спектр модификаций как в углеводофосфатном остове, так и в гетероциклических основаниях и могут быть полезны при синтезе высокофункционализированных НК или при создании аптамеров. Методы синтеза трифосфатов природных и модифицированных динуклеотидов защищены патентами РФ.

Разработаны дизайн и оригинальная стратегия получения новых оксалилдиамидных миметиков НК с использованием морфолиновых аналогов нуклеозидов. Стратегия основана на разности реакционных способностей аминогрупп мономерных синтонов и заключается в применении бифункциональных реагентов и минимального количества защитных групп. Разработаны новые методы синтеза в растворе и на полимере Nметиленкарбоксамидных морфолиновых миметиков НК – урацил- и аденин-содержащих олигомеров длиной до 12-16 звеньев. Впервые показано, что комплексы Nметиленкарбоксамидных аденин-содержащих олигомеров с поли(U) обладают бльшей термостабильностью в сравнении с поли(dT).

Предложенные в работе подходы и методы позволяют осуществлять дизайн новых производных OdN и создавать новые инструменты молекулярно-биологических исследований на основе природных и модифицированных OdN.

Публикации и апробация работы. Материалы диссертационной работы опубликованы в 24 статьях (2 обзорах) и 2 патентах. Результаты работы были представлены на международных и российских конференциях: VIII Всесоюзный симпозиум по целенаправленному изысканию лекарственных веществ (Рига, СССР, 1989);

International Symposium “Synthetic oligonucleotides: Problems and Frontiers of Practical Application (Moscow, USSR, 1991); International conference on nucleic acid therapeutics (Holyday Inn Surfside, Clear Beach, USA, 1991); X Congresso Nationale della divisione di chimica farmaceutica della Societa Chimica Italiana (Siena, Italy, 1991); XVII Congresso Nationale della Societa Chimica Italiana (Genova, Italy, 1992);. Russian-French Symposium “Molecular mechanisms of gene expression” (Novosibirsk, Russia, 1995); International conference “RNA as therapeutic and genomics target” (Novosibirsk, Russia, 2001); Workshop “Biology and Biochemistry of Extracellular Nucleic Acids” (Novosibirsk, Russia, 2003);

International Symposium “Advances in Science for drag discovery” (Moscow, Russia, 2005);

International Conference on Chemical Biology (Novosibirsk, Russia, 2005); 31st FEBS Congress “Molecules in Health and Diseases” (Istanbul, Turkey, 2006); Международная конференция «Физико-химическая биология» (Новосибирск, Россия, 2006), Eight Tetrahedron Symposium “Challenges in Organic Chemistry” (Berlin, Germany, 2007); IV Съезд Российского общества биохимиков и молекулярных биологов (Новосибирск, Россия, 2008); Joint Symposium of the 18th International Roundtable on Nucleosides, Nucleotides and Nucleic Acids and the 35th International Symposium on Nucleic Acids Chemistry (Kioto, Japan, 2008); V Съезд Общества биотехнологов России им. Ю.А. Овчинникова (Москва, Россия, 2008); 2nd International Symposium-Cum-Training Course on Molecular Medicine and Drug Design (MMDR-2) (Karachi, Pakistan, 2009); Научная конференции «Химическая биология - Фундаментальные проблемы бионанотехнологии» (Новосибирск, Россия, 2009); XIX International Round Table on Nucleosides, Nucleotides and Nucleic Acids (Lyon, France, 2010); IInd International conference «Physico-Chemical Biology» dedicated to the 85th anniversary of academician D. G. Knorre (Novosibirsk, Russia, 2011); Sixth Cambridge Symposium on Nucleic Acids Chemistry and Biology (Cambridge, UK, 2011).

Структура и объем работы. Диссертация состоит из введения, обзора литературы, изложения результатов и их обсуждения, экспериментальной части, заключения, выводов, списка литературы. Работа изложена на 411 страницах, содержит 56 рисунков, 64 схемы и 9 таблиц. Библиография включает 603 литературных источника.

СОДЕРЖАНИЕ РАБОТЫ

1. Разработка метода получения защищённых 5’-фосфорилированных мономеров для синтеза OdN триэфирным методом в растворе К началу 80-ых годов прошлого века фосфотриэфирный подход к синтезу OdN, благодаря многолетним исследованиям по совершенствованию методов фосфорилирования нуклеозидов, разработке новых защитных групп для межнуклеотидного фосфата, введению в синтетическую практику новых конденсирующих реагентов, стал одним из основных методов синтеза ODN. Общепринятый вариант триэфирного метода основан на использовании 3’-фосфорилированных 2’дезоксинуклеозидов, защищённых по 5’-гидроксигруппе кислотолабильной защитной группой (Sonveaux E., 1986). Учеными Новосибирского института биоорганической химии СО АН (до 1984 г. – отдела биохимии Новосибирского института органической химии СО АН) показано, что эффективный синтез OdN возможен также с использованием 5’фосфорилированных 2’-дезоксинуклеотидов (Зарытова В. Ф. и др., 1983). В связи с этим возросла потребность в полностью защищённых мономерах 1 - п-хлорфенил(2цианоэтил)-5’-О-фосфо-N-ацил-3’-О-левулинил-2’-дезоксинуклеозидах. Ранее (Горн В. В.

и др., 1982) при синтезе этих соединений на первой стадии ацилировали экзоциклическую аминогруппу гетероциклического основания (в случае тимидинфосфата эта стадия отсутствовала) по методиками, разработанным в 60-ых годах XX века под руководством профессора Кораны (Khorana H. G.). Мы применили для получения N-ацилированных соединений 2 подход с введением временных триметилсилильных защитных групп, предложенный ранее для ацилирования нуклеозидов (Ti G. S. et al., 1982) (схема 1).

O O Схема B 1) TMSCl, Py - B' O P O 2) iBuCl или BzCl O P O O O (Lev)2O, Py O3) 2M NH3/H2O, O pH 8.OH OH O O B' (PyS)2/Ph3P, MeIm B' O P O - TPSCl, MeIm, O O P O O OClPhOH, TEA O CHCl3, CNEtOH OLev NC OLev O B' Cl O P O O B - тимин, цитидин, аденин, гуанин O B' - тимин, защищенные OLev гетероциклические основания N4-Bz-цитозин, 6-Bz-аденин, N2-iBu-гуанин Cl Применение этого подхода позволило избежать трудоёмких процедур по приготовлению и регенерации катионообменных смол и нейтрализации щелочных реакционных смесей с помощью катионообменников в пиридиниевой форме. Ключевой стадией синтеза полностью защищённого нуклеотида 1 является введение пхлорфенильной защитной группы в фосфомоноэфир нуклеозида 3. Мы разработали новый метод введения п-хлорфенильной защитной группы в N,O-ацилированные производные нуклеотидов 3 в условиях активации фосфомоноэфирной группировки смесью 2,2’дипиридилдисульфида и трифенилфосфина в присутствии N-метилимидазола (MeIm) (Годовикова Т. С. и др., 1986). Использование данного подхода позволило отказаться от трудоемких процедур прокачивания пиридинового раствора нуклеотида через колонку с полистиролсульфохлоридом, а также сократить время реакции получения фосфодиэфира с 16-20 до 3 ч. Введение 2-цианоэтильной защитной группы в диэфир 4 с образованием полностью защищённого мономерного синтона 1 проводили, активируя фосфодиэфирную группу в присутствии 2,4,6-триизопропилбензолсульфохлорида (TPSCl) и MeIm, аналогично условиям олигонуклеотидного синтеза. С учетом данных по образованию побочных продуктов при синтезе OdN триэфирным методом в растворе, мы предложили защищать гуанин-содержащий мономер 1 путем введения дополнительной защитной группы по О6 атому.

На основании литературных Схема данных для нуклеозидов N (Kamimura T. et al., 1983) была O O O выбрана дифенилкарбамоильная N NH O N O N O (dpc) защитная группа, поскольку - O N O P O N N O N O P O N N H O её введение существенно O H O OLev DPCCl, TEA повышало липофильность OLev полностью защищённых гуанинCl Cl содержащих мономеров 1, а 4, B' = N2-iBu-гуанин 4', B' = О6-dpc-N2-iBu-гуанин удаление не требовало обработок дополнительными реагентами. Введение дифенилкарбамоильной защитной группы проводили после введения п-хлорфенильной группы с помощью обработки дифенилкарбамоилхлоридом (DPCCl) (схема 2).

Таким образом, нами полностью переработаны две из четырех стадий получения защищённых синтонов 1, необходимых для унифицированного метода синтеза 5’фосфорилированных OdN с помощью триэфирного подхода. В результате проделанной работы мы значительно упростили получение п-хлорфенил(2-цианоэтил)-5’-О-фосфо-Nацил-3’-О-левулинил-2’-дезоксинуклеозидов 1, сократили время синтеза и повысили выход продуктов по сравнению с применявшимися ранее методами. Разработанные методики позволили обеспечить производство 5’-фосфорилированных OdN в НИБХ СО РАН для проведения большого цикла работ по изучению возможности комплементарноадресованной модификации НК и регуляции экспрессии генов в культурах клеток и in vivo.

2. Препаративный синтез OdN К началу данной работы под препаративным синтезом OdN понимали, как правило, синтез этих соединений в пределах нескольких десятков миллиграммов (Rajendrakumar G.

V. et al., 1987). Обычно синтез таких количеств ODN проводили с помощью триэфирного метода в растворе, используя полностью защищённые 3’-фосфаты нуклеотидов. С развитием автоматического синтеза делались также попытки получения больших количеств олигомеров на ДНК-синтезаторе H-фосфонатным методом (Andrus A. et al., 1989). С помощью упомянутых методов получали OdN, не содержащие концевую фосфатную группу. Однако для синтеза модифицированных олигомеров, представляющих собой конъюгаты OdN и различных остатков, содержащих реакционноспособные группы (алкилирующие, расщепляющие фосфодиэфирные связи, генерирующие свободные радикалы и т.д.), с целью широкого применения таких производных как инструментов исследований в молекулярной биологии, наличие концевого фосфата крайне желательно.

Селективные методы активации фосфомоноэфирной группировки открывают путь к синтезу широкого набора конъюгатов олигонуклеотидов с любыми остатками и конструированию аффинных реагентов для ферментов матричного биосинтеза (Годовикова Т. С. и др., 1989). Наличие 5’-фосфатной группы позволяет использовать OdN в реакциях лигирования для получения относительно длинных фрагментов ДНК.

Имея в своем арсенале хорошо отработанные методы синтеза п-хлорфенил(2цианоэтил)-5’-О-фосфо-N-ацил-3’-О-левулинил-2’-дезоксинуклеозидов 1 (схема 1) в количествах до сотен граммов, мы приступили к поиску условий конденсации защищённых олигодезоксинуклеотидных блоков, деблокирования и выделения OdN, позволяющих получать высокие выходы последних в препаративных количествах, независимо от длины и состава используемых блоков. Следует отметить, что уже на уровне динуклеотидов возможны 16 различных соединений, с увеличением длины олигомера количество вариантов соединений равно 4n.

Основой метода стал вариант триэфирного подхода к синтезу 5’-фосфорилированных OdN, разработанный в НИОХ СО АН СССР (Зарытова В. Ф. и др., 1983) (схема 3). Синтез OdN по этому варианту включает в себя деблокирование 5’-фосфатной или 3’гидроксильной групп полностью защищённых исходных триэфиров 1, динуклеотидных и коротких олигонуклеотидных блоков.

Эта схема успешно применялась для синтеза OdN в небольших количествах, однако при систематическом использовании её в препаративном масштабе мы встретили целый ряд затруднений, как в проведении реакций, так и в выделении целевых продуктов. С помощью ряда методических приемов нам удалось унифицировать проведение реакций деблокирования временных защитных групп и конденсации вне зависимости от длины и состава блоков.

Схема O NC O P O B' NH2NH2.H2O, O O O NC Py/HOAc, O P O B' TPSCl, MeIm, O O OH 5 CHClCl OLev O Cl TEA/CH3CN O P O B' O O O OLev NC O P O B' Cl O O 4 - полностью защищённый 7 - полностью мономерный синтон O защищённый Cl 5 - нуклеозидный ОН- O P O B' димер O O компонент реакции B' - защищенные конденсации гетероциклические OLev 6 - нуклеотидный Р-компонент основания Cl реакции конденсации Так, замена ацетонитрила на пиридин при удалении 2-цианоэтильной защитной группы привела к полному растворению защищённых OdN различной длины и состава и к количественному протеканию реакции. В результате повышения температуры реакции до 40оС нам удалось сократить её продолжительность до 30 мин. На стадии удаления левулинильной защитной группы оказалось необходимым вдвое увеличить загрузку растворителей и реагентов по отношению к олигонуклеотидному блоку, начиная с гексануклеотидов, так как увеличение вязкости раствора с увеличением молекулярной массы олигомера затрудняло протекание реакции. При проведении реакции конденсации олигонуклеотидных блоков мы широко использовали пиридин или смесь пиридина и хлороформа в качестве растворителя, так как некоторые олигонуклеотидные блоки (например, олиготимидилаты) плохо растворялись в хлороформе. Реакцию конденсации длинных олигомеров (начиная с гексануклеотидов) проводили при 40оС с целью снижения повышенной вязкости концентрированных растворов этих соединений.

С помощью разработанного нами протокола операций промежуточного деблокирования и конденсации олигонуклеотидных блоков, окончательного деблокирования и очистки при синтезе OdN получены около сотни OdN 5’фосфорилированных OdN в количествах до 100 мкмоль (до 1.0 г) длиной до 20 звеньев.

Мы достигли выхода реакции конденсации 77-80 % практически независимо от длины и состава блоков. Статистическая обработка результатов дала средний выход защищённых OdN на цикл «удаление защитной группы + конденсация» при конденсации в хлороформе 53.8±4.4 %, в пиридине – 63.5±3.7 %. Повышение выхода при проведении реакции в пиридине статистически достоверно согласно критериям сравнения средних значений.

Значительное ускорение синтеза стало возможным вследствие применения препаративного жидкостного хроматографа высокого давления, позволявшего выделять за время не более 1 ч до 15 г защищённого OdN.

Из данных по синтезу OdN можно сделать вывод, что синтез OdN длиной до 16 звеньев протекает с достаточной эффективностью и стабильностью процесса, особенно при получении окта- и додекамеров. Синтез OdN длиной свыше 16 звеньев в растворе с помощью предложенной схемы менее эффективен, вероятно вследствие трудностей при очистке высокомолекулярных защищённых октамеров и более длинных блоков. При необходимости получения OdN длиной 18-22 звена в количествах более 50 мг (более 10ОЕ260, около 4 мкмоль очищенного продукта), выбор метода синтеза OdN (в растворе или на твердой фазе) в первую очередь определяется общей экономической целесообразностью процесса.

Серии OdN, синтезированные с помощью разработанного препаративного варианта триэфирного синтеза OdN в растворе, позволили провести изучение процесса комплементарно-адресованной модификации ДНК в составе трехцепочечного комплекса в модельной системе. В обзоре (Кнорре Д. Г., 1997) обобщены результаты по исследованию биологического действия антисмысловых OdN и их производных. Изучено ингибирующее действие OdN pd(ATACCCTGCTTTTGCT) и его укороченных вариантов pd(ATACCCTG) и pd(CTTTTGCT), комплементарных 5’-участку мРНК NP-белка вируса гриппа, на синтез NP-белка вируса гриппа в бесклеточной системе лизата ретикулоцитов кролика.

Стабильность природных и модифицированных OdN в культурах клеток изучена на примере pdT10 и рd[T(CT)6], их 5’- и 3’-модифицированных алкилирующих, холестериновых и феназиниевых производных. В экспериментах с первичноинфицированными HIV лимфоидными клетками МТ-4 продемонстрирована антисмысловая активность производных OdN pdT16 и pd(TGGCGTACTCACCAGTCGCCGC). Показано, что присоединение липофильных и алкилирующих групп повышает анти-ВИЧ активность этих конъюгатов. Были найдены и другие перспективные OdN, специфично подавляющие репродукцию ВИЧ в культуре клеток. Антисмысловой подход использован также для ингибирования размножения вируса клещевого энцефалита в культуре клеток и в живых организмах. Олигомеры pd[T(СТ)6], pd(TGACCCTCTTCCCATС) и pdT16 и их алкилирующие производные, комплементарные участкам полимеразного гена и поли(А) последовательности вирусной РНК, соответственно, ингибировали размножение вируса в культуре клеток и препятствовали развитию инфекционного процесса у мышей.

OdN, синтезированные с помощью разработанного препаративного варианта триэфирного синтеза OdN в растворе, успешно использованы при изучении пространственной структуры природных и модифицированных дуплексов НК методом ЯМР (Биченкова Е. В. и др., 1992; Денисов А. Ю. и др., 2001) 3. Дизайн и разработка методов синтеза модифицированных OdN и их аналогов 3.1 Модифицирование OdN по концам олигомера. Постсинтетический метод введения различных остатков на 5’-конец 5’-фосфорилированных OdN, полученных с помощью препаративного варианта триэфирного синтеза 5’-фосфорилированных OdN в растворе, применен нами для синтеза OdN, ковалентно связанных фосфамидной связью с новыми стабилизирующими комплементарный комплекс агентами 7-9 (рис. 1). Акридиновое производное 10 синтезировано для сравнения стабилизирующих свойств новых агентов 79 со свойствами замещенного акридина, широко применявшегося для этой цели ранее.

Стабилизирующие агенты 7-9 представляют собой производные -пирона (кумарина) и пирона (хромона). Аминопропильные линкеры в структуру этих соединений специально введены для последующего присоединения к OdN с помощью известного метода активации 5’-фосфата в присутствии Ph3P/(PyS)2 и MeIm (Годовикова Т. С. и др., 1986) Предварительное введение линкера, содержащего алифатическую аминогруппу, в модифицирующий остаток оказалось в этом случае эффективным и синтетически оправданным подходом. Введение заместителя на 5’-конец 5’-фосфорилированных OdN осуществлялось в этом случае постсинтетически в одну стадию. Однако, эта стратегия непригодна, когда синтез модифицирующего остатка, содержащего аминолинкер, для получения конъюгата с OdN по описанному методу, затруднителен.





Двухстадийная схема O постсинтетического стабилизирующий Nuc Nuc P O агент модифицирования 5’Oфосфорилированных OdN по Nuc Nuc = d(CCCAGGTGTGCGAA) и d(CAGGTGTGCG) 5’-концу осуществлена на примере получения стабилизирующие NH2 агенты тетрабензотетраазопорфирин NH2O O O NHовых (фталоцианиновых) O HN NO2 конъюгатов OdN.

Cl OCH3 O Синтетические аналоги O N NHпорфиринов – фталоцианины Cl N H O O (тетрабензотетраазопорфирин 7 8 ы) – по сравнению с Рисунок 1. 5'-Конъюгаты OdN с остатками, стабилизирующими порфиринами обладают комплементарные дуплексы.

рядом достоинств.

Фталоцианиновые красители химически стабильны, их электронный спектр поглощения сдвинут в длинноволновую область по сравнению с природными и синтетическими порфиринами, что существенно для применения этих соединений в фотодинамической терапии (Немыкин В. Н. и др., 2000).

Следует отметить, что производные фталоцианина особенно склонны к агрегации в водных растворах вследствие высокой гидрофобности. Первоначально мы использовали для синтеза фталоцианин-содержащего конъюгата OdN 4,5-октакарбоксифталоцианин, более растворимый в воде. Однако после очистки продукта нам не удалось при последующем анализе подтвердить наличие фталоцианин-содержащего конъюгата в растворе. Очевидно, при изменении рН среды со щелочного на нейтральный (после очистки) происходит быстрый гидролиз карбоксамидной связи с участием соседней ароматической СООН группы (внутримолекулярный катализ), как это описано для моноамидов фталевой кислоты.

Таким образом, конъюгат OdN с Co(II)окта-4,5-карбоксифталоцианином оказался неустойчивым в растворе при нейтральном значении рН. В связи с этим в дальнейшем мы использовали тетра-4-карбоксипроизводное фталоцианина 11 для синтеза конъюгата (схема 4). Выход конъюгата составлял от 15 до 30 %.

Основной причиной 1. Ph3P/(PyS)2, DMAP Схема 4 низкого выхода H pd(TCTTCCCA) N H2N конъюгата, pd(TCTTCCCA) 2. 0.5 M NH2(CH2)3NHсинтезированного по O(O)C O схеме 5, являлась C(O)O1) 0.2 M NaHCO3/Na2CON сложность отделения Phtc-C(O) O N H2O/DMF, pH 9.N N 2) 1 M Na2CO3 рН 10.целевого продукта O N Co N синтеза от избытка N N фталоцианина. Мы H - N O(O)C Phtc-[C(O)O-]3C(O)HN N pd(TCTTCCCA) попытались решить эту C(O)Oпроблему путем замены Тетра-4-карбоксифталоцианин кобальта(II) Phtc[C(O)O-]стратегии синтеза конъюгата с постсинтетического введения заместителей в OdN, полученный в растворе, на модифицирование в процессе синтеза OdN на твердофазном носителе. Линкер, содержавший алифатическую группу (аминопропанол), вводили на 5’-конец OdN в ходе стандартного метода синтеза OdN амидофосфитным методом с использованием соответствующего амидофосфитного мономера. После удаления защитной группы с алифатической аминогруппы олигонуклеотид, присоединенный к твердому носителю, обрабатывали раствором N-гидроксисукцинимидного производного соответствующего карбоксифталоцианина в DMF в присутствии диизопропилэтиламина. После завершения реакции избыток красителя тщательно отмывали от носителя, затем проводили щелочной гидролиз непрореагировавших карбоксильных групп, отщепление от носителя и деблокирование конъюгата водным раствором аммиака. С помощью такого подхода получены конъюгаты, содержащие тетра-4-карбоксифталоцианин кобальта(II), тетра-4карбоксиметилтиофталоцианин цинка(II) и тетра-4карбоксипентилсульфамилфталоцианин алюминия (III). Выходы очищенных конъюгатов достигали 50-60 %, в зависимости от длины олигомера и типа фталоцианина.

Таким образом, нами осуществлен синтез 5’-конъюгатов OdN с помощью различных схем: постсинтетически в одну или в две стадии при синтезе 5’-фосфорилированных OdN триэфирным методом в препаративном варианте в растворе, а также во время синтеза OdN на полимере амидофосфитным методом.

В развитие нашего варианта препаративного синтеза 5’-фосфорилированных OdN фосфотриэфирным методом в растворе нам представлялось интересным более подробно исследовать этот подход при синтезе конъюгатов OdN с различными остатками. При этом предполагалось вводить заместители как на 5’-конец олигомера, так и на оба конца. Выбор модифицирующих остатков определялся задачами молекулярной биологии по изучению возможностей антисмыслового подхода к регуляции экспрессии генов и разработки антивирусных препаратов нового принципа действия.

Мы осуществили блочный синтез гексадекадезоксирибонуклеотида pd(ACCATGGCACCTGTGC) в количестве 0.7 г полностью защищённого продукта 13 с общим выходом 15 %. Для введения остатка холестерина на 5’-конец олигомера 2цианоэтильную защитную группу полностью защищённого гексадекадезоксирибонуклеотида 13 удаляли (путь А, схема 5), затем проводили конденсацию нуклеотидного компонента 14 с холестерином в присутствии TPSCl и MeIm.

После деблокирования конъюгата с помощью водного раствора аммиака получали 5’конъюгат олигонуклеотида 15 с холестерином, присоединенным фосфоэфирной связью.

При необходимости получить 3’-конъюгат удаляли 3’-защитную левулинильную группы (путь Б, схема 5) с полностью защищённого блока 13, затем фосфорилировали 3’ОН группу обработкой п-хлорфенилфосфодихлоридом в присутствии 1,2,4-триазола в пиридине и проводили присоединение холестерина в присутствии TPSCl и MeIm с получением полностью защищённого конъюгата 16. После двухстадийного деблокирования (фторидом тетрабутиламмония и водным раствором аммиака) получали деблокированный 3’-конъюгат 17. При необходимости дополнительного модифицирования OdN по 5’-фосфату у полностью защищённого конъюгата 16 удаляли 2цианоэтильную защитную группу (путь В) и проводили введение дополнительного остатка, например, трифторацетилированного аминопропанола (схема 5).

После деблокирования водным раствором аммиака получали конъюгат 18, содержавший различные остатки, присоединенные к 5’- и 3’-концам OdN. Выход очищенных конъюгатов зависел главным образом от типа введенных заместителей и от степени модифицирования (моно- или бис-модификация).

O Схема O P O Nuc Nuc OLev NC O A TEA/Py N2H4/H2O/Py/AcOH Б Cl O O O P O Nuc Nuc OH - NC O P O Nuc Nuc OLev O O ClPhPOCl2, Tri, Py;

Cl H2O Cl ChlOH, TPSCl, MeIm O O O P O Nuc Nuc O P OO NC Nuc Nuc OLev ChlO P O O O O ChlOH, TPSCl, Cl Cl MeIm NH3/H2O Cl O O O O P O Nuc Nuc O P OChl ChlO P Nuc Nuc NC O O- O 15 В Cl TBAF, Py/H2O;

Cl TEA/Py NH3/H2O O O P O Nuc Nuc O P OChl O O O O O O P O Nuc Nuc P OChl OOROH, TPSCl, Cl Cl MeIm O O RO P O Nuc Nuc O P OChl Chl = O O Tri = 1,2,4-триазол NH3/H2O Cl Cl R = (CH2)3NHTFA, R = (CH2)3NHO O RO P O Nuc Nuc P OChl курсивом обозначены защищенные O- нуклеотиды, см.схему OВ случае присоединения с использованием триэфирного подхода в качестве одного из заместителей аминоспирта возможно дальнейшее модифицирование конъюгата 18 по алифатической аминогруппе постсинтетически с помощью одной из методик, например посредством активированных эфиров карбоксикислот (Sinha N. et al., 1991). Мы провели дополнительное модифицирование конъюгата 18 (R = (CH2)3NH2) путем введения остатка феназиния по алифатической аминогруппе по известному методу (Lokhov S. G. et al., 1992).

Таким образом, с помощью препаративного варианта триэфирного метода синтеза 5’фосфорилированных OdN в растворе мы успешно синтезировали 5’-, 3’-моно- и бисзамещенные конъюгаты OdN 15, 17, 18), предназначенные для изучения регуляции экспрессии генов ДНК-полимеразы с помощью антисмыслового подхода.

Возможности подхода, представленного на схеме 5, в дизайне и синтезе производных OdN, модифицированных как по 5’-, так и по 3’-концам, изучены нами на примере получения конъюгатов OdN 19-21, представленных на рис. 2. Конъюгаты предназначались для изучения антисмыслового подхода к специфическому подавлению экспрессии генов cmyc и bcr/abl.

O O Nuc Nuc O P O O P OChl RHN O- O- OH C(O)OОстаток порфирина R присоединен через одну из O(O)C карбоксильных групп карбоксамидной связью OH C(O)O- N C(O)ON остаток N N N 19, R = N Fe(III)гематопорфирина Fe3+ N Pd2+ N N N Co2+ N остаток N N 20, R = N N Pd(II)копропорфирина O(O)C - N остаток O(O)C 21, R = Co(II)тетра-4-карбоксиC(O)O- OC фталоцианина OC OC Рисунок 2. ODN, модифицированные как по 5'-, так и по 3'-концам.

Для присоединения порфириновых остатков по 5’-концу по схеме 5, путь В, мы первоначально опробовали способ, когда в качестве спирта ROH было выбрано производное дейтеропорфирина, содержавшее первичную алифатическую гидроксигруппу. Такой подход позволял сразу получать OdN, модифицированный по обоим концам как липофильной, так и реакционноспособной группировками, без применения постсинтетических стадий модифицирования. Несмотря на высокие выходы в реакциях конденсации защищённого олигонуклеотидного блока, нам не удалось очистить бис-замещенный конъюгат в случае, когда 5’-заместитель R представлял собой производное порфирина, вследствие высокой сорбции такого конъюгата на колонке при ионообменной хроматографии.

Учитывая эти результаты, мы проводили синтез бис-модифицированных конъюгатов 19-21 в два этапа. Сначала был синтезирован и очищен конъюгат, содержавший на 5’конце аминопропильный линкер. Затем первичную аминогруппу ацилировали с помощью активированных N-гидроксисукцинимидных эфиров Fe(III)гематопорфирина, Pd(II)копропорфирина и Co(II)тетра-4-карбоксифталоцианина аналогично ранее описанному методу введения фталоцианиновых остатков в OdN (схема 4). Последующая очистка не требовала применения ионообменной хроматографии.

Помимо порфиринов и фталоцианинов, перспективными реакционноспособными группами являются также искусственные РНКазомиметики, представляющие собой низкомолекулярные соединения, имитирующие каталитический центр рибонуклеаз. Часто такие соединения включают в себя остатки имидазола. Ранее синтезированы 5’- и 3’конъюгаты OdN, содержавшие диимидазольную каталитическую группировку (Vlassov V.

V. et al., 1997). Конъюгаты были получены с помощью активации 5’- или 3’-концевого фосфата олигонуклеотида в присутствии Ph3P/(PyS)2 и диметиламинопиридина (DMAP) и содержали фосфамидную связь. Производные олигонуклеотидов, содержавшие диимидазольную группировку, эффективно и специфично расщепляли комплементарную тРНКфен дрожжей, однако позднее было обнаружено, что фосфамидная связь в таких конъюгатах подвержена аутокаталитическому расщеплению.

Для исключения нестабильной фосфамидной связи в конъюгатах OdN с имидазолсодержащими группировками были предложены моно- и бис-имидазол-содержавшие конструкции, включающие в себя первичную алифатическую гидроксильную группу.

Такие соединения пригодны для получения конъюгатов не постсинтетически, а в процессе олигонуклеотидного синтеза. Нами опробован путь А (схема 5) для синтеза конъюгатов с моно- и бис-имидазол-содержащими конструкциями на основе урокановой кислоты и гистидина (рис. 3).

O O Остатки имидазола были N O R P O TT защищёны динитрофенильными N HN OH защитными группами.

H N 22, R = 4-[3-(1H-имидазолДеблокирование имидазольного O 4-ил)пропеноил]аминобутилокси N кольца происходило при обработке HN O конъюгатов водным раствором 23, R = 4-[N-(1Н-имидазолN O аммиака после завершения синтеза по 4-илацетил)-L-гистидил] N HN H аминобутилокси пути А, схема 5. В результате получены производные димидилата Рисунок 3. 5'-конъюгаты дитимидилата с имидазоли 23.

содержащими остатками.

Таким образом, для введения заместителей на 5’-, 3’- или оба конца в случае OdN, содержавших концевую фосфатную группу, нами применены схемы постсинтетического введения заместителей в олигомер в одну или две стадии с промежуточным введением линкера; подходы с введением линкерной группы в процессе синтеза олигомера с дополнительным модифицированием OdN во время синтеза или постсинтетически; прямое введение модифицирующих остатков в процессе синтеза 5’-фосфорилированных OdN в растворе с помощью препаративного варианта фосфотриэфирного метода. Выбор стратегии модифицирования зависел от метода синтеза OdN, наличия и способов защиты активных функциональных групп в модифицирующих остатках, а также от количества конъюгатов, необходимых для дальнейших исследований.

В ходе разработки и реализации различных схем синтеза успешно получены с удовлетворительными и высокими выходами конъюгаты с новыми интеркалирующими агентами на основе хромона и кумарина, соединения с порфириновыми и фталоцианиновыми остатками, а также конъюгаты с моно- и бис-имидазолилсодержащими конструкциями, обладающими РНКазной активностью. В совокупности предложенные методы и подходы обеспечивают возможность синтеза концевых конъюгатов OdN с любыми остатками и в любых необходимых количествах, в том числе препаративных.

3.2 Разработка подходов к модифицированию OdN по гетероциклическим основаниям. Чаще всего гетероциклические основания модифицируют с одновременным введением функционально активных групп, по которым в дальнейшем может быть осуществлено присоединение флуорофоров, интеркаляторов, катионных липидов, олигопептидов и др. Нам представлялся целесообразным поиск универсального метода синтеза модифицированных олигонуклеотидов. Для этого мы применили прекурсорный подход, опробованный ранее при введении каталитически активных остатков имидазола, имитирующих активный центр РНКазы, на 5’-конец OdN (Белоглазова Н. Г. и др., 1999).

Для введения линкеров с химически активными группами в различные положения ODN в процессе автоматического олигонуклеотидного синтеза удобно использование амидофосфитных реагентов на основе нуклеозидов с модифицированными гетероциклическими основаниями. При разработке методов синтеза соответствующих амидофосфитных синтонов мы уделили особое внимание использованию возможно более доступных исходных соединений и выбору схем синтеза, дающих наибольший выход целевых соединений.

Как правило, для получения модифицированных по гетероциклическому основанию аналогов тимидина в качестве исходного соединения используют 2’-дезоксиуридин или его производные (Ruth J. L., 1991). Однако, ввиду большей коммерческой доступности, мы использовали тимидин в качестве исходного соединения. Ранее были получены производные 2’-дезоксиуридина, содержавшие 5-(2-аминоэтил)оксиметильный линкер (Levina A. S. et al., 1993). Аналогичным образом мы получили производное 2’дезоксиуридина 24, содержавшее 5-(3-аминопропил)оксиметильный остаток (схема 6).

Схема 6 O O O HN O O HN NH2 NH NH HN O O N O N O O O O O 1) DMTrCl, Py DMTr HO O N O O HO O HN HN 25, TEA O 2) NC(CH2)2OP[N(iPr)2]2/ OH OH Tetr-HN(iPr)P 24 26 N O N N H H O O N O O N O NH N CN N O N 25 = O O H O H O O O O O 3 O Для сокращения числа стадий синтеза производного 2’-дезоксиуридина с двумя метоксиоксалиламидными группам был синтезирован трис(метоксиоксалиламидоэтил)амин 25. После защиты 5’-гидроксигруппы дезоксирибозы производного 26 и последующего фосфитилирования получен амидофосфит 27, пригодный для использования в стандартном олигонуклеотидном синтезе.

В случае 2’-дезоксицитидина введение алкильного заместителя по экзоциклической аминогруппе не приводит к потере способности образовывать водородные связи при комплементарном взаимодействии. Опираясь на опубликованную методику (Hovinen J., 1998), мы разработали метод синтеза защищённого по 5’-гидроксигруппе N4-(3аминопропил)-2’-дезоксицитидина 28 (схема 7).

H Схема O O NHO N NH HN HN O N O HN N O N N H N O N O NH DMTrO O N DMTr 1. 25, TEA O O O DMTrO O N O TBD/NH2(CH2)3NH2 O O OH OH 2. NC(CH2)2OP[N(iPr)2]2/ O Tetr-HN(iPr)29 NHP NC + O N N DMTrO O N O OH Несмотря на относительно невысокий выход реакции переаминирования (40 %), доступность исходного соединения 29, являющегося предшественником амидофосфитного реагента для стандартного олигонуклеотидного синтеза, и возможность регенерации нуклеозида 29 из основного побочного продукта – 5’-О-(4,4’диметокситритил)-2’-дезоксицитидина 30, делают данный метод получения производного 28 весьма привлекательным. На следующем этапе синтеза в модифицированный нуклеозид 28 вводили линкер с реакционноспособными метоксиоксалиламидными группами аналогично реакции с аминопропильным производным 2’-дезоксиуридина (схема 6). На последней стадии 3’-гидроксигруппу нуклеозида фосфитилировали, получая амидофосфит 31, пригодный для использования в олигонуклеотидном синтезе.

В молекулярной биологии широко используются OdN, содержащие 5-метил-2’дезоксицитидин вместо 2’-дезоксицитидина. Для изучения полноты протекания и специфичности расщепления комплементарных нуклеиновых кислот модифицированными олигонуклеотидами, содержащими производные 2’дезоксицитидина с различным расположением активных групп, мы синтезировали соединение 32, у которого функциональные группы присоединены по пятому положению гетероциклического основания 2’-цитидина (схема 8).

O O Схема O HN O NH2 HN O O N O HN N CF3 N NH2 N O NH NH O H O O O N O N O N O N 1) 1,2,4-Tri, DMTrO O O HO HO O 1) DMTrCl, Py O O O 1) 25, TEA O HN HN POCl3, TEA O O O OH 2) ( Bz)2O OH 2) NC(CH2)2OP[N(iPr)2]2/ O 2) NH3/H2O H 34 Tetr-HN(iPr)2 P 33 N H N N O N O O O N NH O CN O O NH O O O O O Синтез амидофосфита 32 начинали с превращения производного дезоксиуридина (промежуточного соединения при получении нуклеозида 24) в производное 2’дезоксицитидина с помощью реакции с 1,2,4-триазолом и хлорокисью фосфора. После обработки водным раствором аммиака получали 5-(3-аминопропил)оксиметил-2’дезоксицитидин 34. Этот нуклеозид вводили в реакцию с соединением 25 (при этом экзоциклическая аминогруппа не вступала в реакцию). На следующем этапе синтеза блокировали 4-аминогруппу производного 2’-дезоксицитидина с помощью бензойного ангидрида, получая соединение 35. Далее защищали 5’-гидроксигруппу модифицированного нуклеозида и продукт реакции фосфитилировали, получая амидофосфит 32, пригодный для использования в олигонуклеотидном синтезе.

Для проверки того, как влияет наличие 5-метильной группы в аналоге 2’дезоксицитидина на эффективность комплементарного взаимодействия нуклеиновых кислот, мы также синтезировали амидофосфит 36 (схема 9), отличающийся от мономера 31 метильной группой в положении 5 гетероцикла.

O NH NH2 Схема O HN HN N O N H NH HN N N O 1) TMSCl, Py O N O O O N 1) 25, TEA O N NH DMTrO 2) 1,2,4-Tri, POCl3, TEA O DMTr O DMTrO O O O O 2) NC(CH2)2OP[N(iPr)2]2/ 3) NH2(CH2)3NH2 O OH OH O Tetr-HN(iPr)38 P NC O N Для синтеза соединения 36 5’-О-(4,4’-диметокситритил)тимидин 37 обрабатывали триметилхлорсиланом, затем - 1,2,4-триазолом и хлорокисью фосфора. Промежуточное триазолидное производное без выделения обрабатывали 1,3-диаминопропаном. После обработки водным раствором аммиака получали N4-(3-аминопропил)-5’-О-(4,4’диметокситритил)-5-метил-2’-дезоксицитидин 38. Затем вводили линкер с активными метоксиоксалиламидными группами реакцией с соединениием 25 и фосфитилировали модифицированный нуклеозид с получением целевого реагента 36 (схема 9).

Для исследования расщепления нуклеиновых кислот по пиримидиновым нуклеотидам представляло интерес синтезировать пуриновый нуклеозид, содержащий метоксиоксалиламидные группы. Для введения модифицирующих остатков был выбран 2’-дезоксиаденозин. Ключевым соединением в синтезе производных 2’-дезоксиаденозина по 6 положению служит 9-(2’-дезокси--D-рибофуранозил)-6-хлорпурин, который получают хлорированием 2’-дезоксиинозина (Robins M. J. et al., 1973) или дезаминированием 2’-дезоксиаденозина под действием амилнитрита в присутствии CCl(Acedo M. et al., 1994). Недостатком данных методов является высокая чувствительность производных 2’-дезоксиаденозина 39 к апуринизации в кислых условиях, что понижает выход реакций.

Мы синтезировали N6-(3-аминопропил)-5’-О-(4,4’-диметокситритил)-2’дезоксиаденозин 40 (схема 10) через промежуточное триазолидное соединение 41, предложенное ранее (Godzina P. et al., 1999). После введения линкера с метоксиоксалиламидными группами по реакции с соединением 25 и фосфитилирования получали целевой амидофосфит 42.

N N NH2 HN O Схема HN NH2 N NH O O NH N H O N N N N N N N N N O N N N N 1) 25, TEA DMTr O N N N N DMTr HO HO O O O O O i, ii, iii 1) DMTrCl, Py 2) NC(CH2)2OP[N(iPr)2]2/ O OH OH OH NH O 2) NH2(CH2)3NH2 P Tetr-HN(iPr)39 O N O O i) TMSCl, Py; ii) [(CH3)2NCH=N]2, iii) CH3OH CN Таким образом, нами получены оригинальные синтоны 27, 31, 32, 36 и 42, позволяющие вводить прекурсорные группы в желаемую позицию последовательности OdN. После завершения синтеза OdN может быть проведена дополнительная модификация с использованием реакционноспособных метоксиоксалиламидных групппредшественников. Синтез всех модифицированных нуклеозидов не требует дорогостоящих исходных веществ, хорошо воспроизводится и позволяет получать целевые соединения с высокими выходами.

Препаративный вариант триэфирного синтеза в растворе 5’-фосфорилированных OdN, разработанный нами, также успешно может быть использован для синтеза OdN, содержащих модифицированные гетероциклические основания. Для проверки возможностей усовершенствованного варианта препаративного синтеза OdN триэфирным методом в растворе мы синтезировали 5’-фосфорилированные динуклеотиды, содержавшие модифицированный по гетероциклическому основанию нуклеозид – 5-фтор2’-дезоксиуридин. Препаративные количества динуклеотида, включающего в свою структуру 5-фторурацил, могут использоваться в качестве предшественников этого противоопухолевого терапевтического средства для регулирования его биодоступности.

При наличии в структуре O H O O F3C N модифицированных гетероциклических O NH NH N F3C оснований нуклеозидов активных H H O H N O N O N функциональных групп необходимо O N O HN HN соответствующим образом защищать эти CFCFN N функциональные группы для синтеза N олигомеров. Наряду с динуклетидом, N N N содержавшим 5-фторурацил в качестве Рисунок 4. Модифицированные гетероциклические гетероциклического основания, были основания, содержащиеся в OdN, синтезированных получены триэфирным методом в растворе триэфирным методом в растворе.

соответствующим образом защищённые динуклеозидфосфаты со свободной 5’-гидроксигруппой, содержавшие модифицированные тимин, урацил, цитозин и аденин (рис. 4).

Полученные динуклеозидфосфаты использовали для синтеза трифосфатов динуклеотидов, содержащих различные функциональные группы. Подробнее результаты по синтезу трифосфатных производных динуклеозидфосфатов изложены ниже.

Рассматривая различные варианты стратегии синтеза OdN, модифицированных по гетероциклическим основаниям, можно сделать вывод, что выбор метода синтеза конкретного модифицированного OdN определяется его структурой, необходимостью последующей постсинтетической или осуществляемой в процессе синтеза дополнительной обработки, а также требуемым количеством OdN. На примере синтеза больших количеств динуклеотидов, содержащих модифицированные гетероциклические основания, показана возможность применения фосфотриэфирного подхода к синтезу OdN, содержащих гетероциклические основания с дополнительными функциональными группами.

3.3 Разработка подходов к модифицированию олигонуклеотидов по углеводным остаткам. Для введения заместителей в углеводный остаток перспективным представляется 2’-положение. Такая модификация вызывает минимальные искажения в структуре олигонуклеотидных комплексов, позволяет получать нуклеозиды с С(2)-экзо- и с С(2)-эндо-конформациями углеводного остатка, а также ориентировать заместитель как в малую, так и в большую бороздки спирали дуплекса нуклеиновой кислоты. К потенциальным недостаткам данного типа модифицирования следует отнести наличие заместителей по соседству с амидофосфитной группой, что при синтезе олигомеров с помощью твердофазного амидофосфитного метода синтеза OdN приводит в ряде случаев к увеличению времени, необходимого для проведения конденсации, и снижению выходов, особенно в случае объемных заместителей (Yamana K. et al., 1997). Одним из способов уменьшить стерические препятствия в реакциях олигонуклеотидного синтеза является использование нуклеозидов, содержащих арабинозу в качестве углеводного фрагмента вместо рибозы. Нами осуществлен синтез амидофосфита защищённого производного арабиноаденозина 43 (схема 11).

Синтон 43 содержал Схема ABz O O ABz iii O N3ABz HO метоксиксалиламидный Si O O i, ii Si iv, v, vi прекурсорный остаток в O O OSO2CF3 O O OH OH Si Si 2’-положении в арабино44 конфигурации. Исходя OCHO OCH3 из защищённого по O O HN O гетероциклическому H2N ABz DMTr ABz vii DMTrO HN ABz DMTr O O O O O основанию аденозина 44, viii O с помощью ряда реакций OH OH P NC осуществлено O N 47 обращение i)TIPDSiCl, Py; ii)(CF3SO2)2O, Py/C2H4Cl2; iii) NaN3, DMF; iv) HF/Py/H2O; конфигурации v) DMTrCl, Py; vi) H2/Pd/C; vii) [CH3OC(O)]2;viii) NC(CH )2OP[N(iPr)2]2/Tetr-HN(iPr)2 заместителей при атоме углерода C2’ с заменой гидроксигруппы на аминогруппу, в основном аналогично литературным методикам (Zubin E. M. et al., 1998). Для введения азидогруппы в нуклеозид использовали азид натрия вместо азида лития вследствие бльшей устойчивости и меньшей гигроскопичности соли натрия. В отличие от ранее предлагавшегося применения NaN3 в смеси с эфиром 18-краун6 (Васильева С. В. и др., 2004) в реакции с 2,2’-ангидроуридином, реакция соединения 45 с азидом натрия в отсутствие добавок проходила достаточно эффективно при комнатной температуре. При этом происходило обращение конфигурации при атоме углерода С2’ с образованием арабинонуклеозида 46. Удаление дисилоксановой защиты проводили обработкой HF в водном пиридине, а не фторидом тетрабутиламмония, что облегчало очистку деблокированного нуклеозида. Замена восстановления азидогруппы трифенилфосфином на восстановление каталитическим гидрированием позволила увеличить выход на стадии получения аминосоединения 47 с 50 до 98 %. Обработка соединения 47 диметилоксалатом дала нуклеозид 48, содержавший прекурсорную метоксиоксалиламидную группу в 2’-положении углеводного остатка в арабиноконфигурации. Синтез целевого амидофосфита 43 проводили обычным образом.

Следует отметить, что синтез синтона, аналогичного соединению 43, но с рибоконфигурацией углеводного остатка, является более сложной задачей.

По литературным данным (Васильева С. В. и др., 2006), выходы модифицированных олигонуклеотидов, синтезированных с использованием мономера 43, в два раза выше по сравнению с выходами олигонуклеотидов, полученных с использованием мономера с рибоконфигурацией углеводного фрагмента.

3.4 Модифицирование OdN по межнуклеотидной фосфатной группе. Ранее был разработан подход к синтезу индивидуальных диастереомеров этиловых эфиров олиготимидилатов, получены олигомеры, содержавшие фосфатные группы в определенной относительной конфигурации при атоме фосфора, и изучена способность индивидуальных соединений образовывать комплементарные комплексы с поли(dA) (Абрамова Т. В. и др., 1986). Представлялось интересным выснить, как влияет конфигурация асимметрического центра при атоме фосфора на биологические свойства индивидуальных диастереомеров этиловых эфиров олиготимидилатов, физикохимические свойства которых были изучены ранее. Для решения этой задачи с использованием ранее разработанной стратегии синтеза индивидуальных диастереомеров этиловых эфиров олиготимидилатов (Абрамова Т. В. и др., 1986) нами были синтезированы препаративные количества реагентов 49-59, содержавших С-меченный алкилирующий остаток азотистого иприта на 3’-конце олигомера (рис. 5).

Алкилирующий остаток Tp'(Et)Tp'(Et)Tp'(Et))TpU>14CH-RCl 49 [ Tp'(Et)Tp]4NH14CH2-RCl присоединяли либо 2’,3’бензилиденовой связью к Tp'(Et)Tp''(Et)Tp'(Et)TpU>14CH-RCl 50 [ Tp''(Et)Tp]4NH14CH2-RCl 3’-концевому уридину в Tp''(Et)Tp'(Et)Tp''(Et)TpU>14CH-RCl 51 (Tp)8NH14CH2-RCl реагентах 49-55, либо 3’фосфамидной связью в Tp''(Et)Tp''(Et)Tp''(Et)TpU>14CH-RCl 52 [ Tp(Et)]7TpNH14CH2-RCl реагентах 56-59.

O Tp(Et)Tp(Et)Tp(Et)TpU>14CH-RCl На примере асцитной p(Et) = O P O карциномы Кребс-2 (АКК) Tp(Et)Tp(Et)Tp(Et)Tp(Et)U>14CH-RСl 54 смесь OEt диастереомеров нашими коллегами исследовано связывание TpTpTpTpU>14CH-RCl p' и p'' обозначают противоположные реагентов 49-59 с клетками энантиомерные конфигурации и алкилирование N Cl фосфотриэфирного RCl = межнуклеозидного фрагмента биополимеров клетки (РНК, ДНК, белок) Рисунок 5. Модифицированные по межнуклеотидной фосфатной группе реакционноспособные производные олиготимидилатов. (Абрамова Т. В. и др., 1988). Установлено, что этилированные пентамеры 49-54 сорбируются клетками в 4-15 раз эффективнее, чем соответствующее фосфодиэфирное производное 55. Уровень сорбции реагентов 56-57, содержащих половину этилированных фосфатных групп, в 2-3 раза превышает уровень сорбции полностью диэфирного реагента 58. В целом сорбция реагентов 49-положительно коррелирует с гидрофобностью этих соединений, определенной по данным обращенно-фазовой хроматографии (ОФХ). Степень модифицирования поли(А)-трактов мРНК реагентом 52 по сравнению с реагентом 49 в 50 раз выше. Очевидно, что конфигурация при асимметрических атомах фосфора р’’ способствует более эффективной комплементарно-адресованной модификации НК в культуре клеток АКК в случае пентамеров. Подобный эффект, хотя и менее выраженный, наблюдается и в случае реагентов 56 и 57.

Реагенты 56 и 57 содержат чередующиеся фосфотриэфирные и фосфодиэфирные фрагменты, причем конфигурация асимметрических атомов фосфора является противоположной (р’ и p’’, соответственно). В связи с наличием анионных центров в этих реагентах поглощение этих соединений клетками АКК менее эффективно, чем реагентов 49-52, что приводит к меньшему уровню модифицирования биополимеров внутри клетки реагентами 56 и 57. Однако синтез соединений 56 и 57 является существенно более простой задачей по сравнению с синтезом реагентов 49-52, так как включает в себя только одну трудоемкую стадию хроматографического разделения энантиомеров. Очевидно, что выбор дизайна адресующей части реагента на основе фосфотриэфиров OdN для осуществления регуляции экспрессии генов с помощью антисмыслового подхода in vivo зависит как от эффективности действия конкретного соединения, так и от трудоемкости и стоимости его получения. Нам представляется, что сочетание чередующихся фосфотриэфирных и фосфодиэфирных связей является оптимальным выбором при дизайне фосфотриэфирных антисмысловых АО.

С развитием твердофазного подхода к синтезу OdN, большое внимание исследователей привлекли метилфосфонатные АО, для которых были разработаны достаточно эффективные методы синтеза на полимерном носителе с помощью метилфосфонодиимидазолида или метилфосфоноамидитных синтонов. Как и в случае этиловых фосфотриэфиров OdN, было обнаружено, что только одна из двух возможных конфигураций метилфосфонатной межнуклеозидной связи благоприятствует образованию комплементарных комплексов с ДНК и РНК (Miller P. S. et al., 1993),.

Учитывая широкое применение метилфосфонатных неионных АО в экспериментах по регуляции экспрессии генов с помощью антисмыслового подхода и большое влияние конфигурации метилфосфонатного фрагмента на сродство АО к ДНК и РНК, мы провели исследование пространственной структуры в растворе комплементарных дуплексов d(CpmeCpmeApmeApmeApmeCpmeA)-d(TGTTTGGC) двух диастереомеров метилфосфонатного гептамера с конфигурацией RpRpRpRpRpRp и RpRpRpSpRpRp методом двумерной ЯМР-спектроскопии.

Для ЯМР-экспериментов требуется значительное количество очень чистого вещества (несколько микромолей). Нами осуществлен препаративный синтез метилфосфонатного аналога гептамера (двух диастереомеров) в растворе с помощью комбинации фосфоноимидазолидного подхода, адаптированного к синтезу в растворе, и фосфонодиэфирной конденсации присутствии TPSCl и MeIm. Следует отметить, что количества индивидуальных диастереомеров гептануклеотида d(CpmeCpmeApmeApmeApmeCpmeA), полученные ранее, не превышали 0.05 мкмоль (Vyazovkina E. V. et al., 1994).

По данным ЯМР-спектроскопии построены усредненные трехмерные молекулярные модели комплементарных дуплексов для обоих диастереомеров.

3.5 Морфолиновые аналоги олигонуклеотидов. Существует большой класс аналогов олигонуклеотидов с модифицированными как углеводным, так и линкерным фрагментами, например, пептидно-нуклеиновые кислоты (ПНК) или морфолиновые аналоги. Среди подобного типа аналогов одними из самых успешных следует признать морфолиновые АО, особенно при использовании в качестве инструментов регуляции экспрессии генов в ходе эмбрионального развития различных организмов (Moulton J. D. et al., 2009).

Диметиламидоморфолидофосфатные АО в настоящее время коммерчески доступны, однако у этих распространенных аналогов есть недостатки, в частности, наличие хиральных атомов фосфора.

Как показано в многочисленных исследованиях, в том числе и проведенных нами на примере фосфотриэфирных и метилфосфонатных АО (см. раздел 3.4), свойства диастереомеров АО по линкерной группе между нуклеозидами резко различаются и часто становятся фактором, определяющим эффективность образования комплементарных комплексов и биологического действия антисмысловых АО в целом. Коммерчески доступные соединения представляют собой рацемическую смесь 2n диастереомеров, где n – число межнуклеозидных линкерных групп. Содержание диастереомера, имеющего наиболее благоприятную для образования комплементарных комплексов конфигурацию, в коммерческом препарате очень мало. Решением проблемы могла бы стать разработка дизайна и методов синтеза новых типов морфолиновых АО, не имеющих диастереомерных центров и обладающих высоким сродством к НК.

В начале исследований мы разработали схему синтеза 2’-аминометильных производных морфолиновых нуклеозидов 60а-г исходя из защищённых морфолиновых нуклеозидов 61а-г (схема 12).

Схема 1' O O HO B' O B' N3 O B' H2N H2N B 2' 6' Ph3P/CBrCl3 H2/Pd/C, MeOH 1) Py/ NH3/H2O 3' 4' 5' N N N или N 2)AcOH/H2O NaN3, DMF H 1) Ph3P, Py Tr Tr Tr 60а-г 2) NH3/H2O 61а-г 63а, б 62а-г 1) Py/ NH3/H2O 1) Ph3P, Py 2) AcOH/H2O N3 O B 2) NH3/H2O B' = Ura (a), N6-Bz-Ade (б), B = Ura (а), Ade (б), N 64в, г Cyt (в), Gua (г) H N4-Bz-Cyt (в), N2-iBu-Gua (г) Замену гидроксильной группы на азидную проводили с помощью смеси трифенилфосфина, азида натрия и бромтрихлорметана в DMF, используя подход, предложенный для нуклеозидов (Yamamoto I. et al., 1980). Основным отличием нашей методики было применение более удобного в обращении азида натрия вместо азида лития и использование бромтрихлорметана вместо тетрабромметана. После восстановления азидогруппы в соединениях 62а,б газообразным водородом в присутствии палладиевого катализатора на угле (аденин-содержащий мономер) либо действием трифенилфосфина с последующей обработкой водным раствором аммиака (урацил-содержащий мономер) мы получили защищённые аминопроизводные 63а,б. Нам не удалось полностью очистить защищённые азидопроизводные 62а-г с помощью силикагельной хроматографии, поэтому в случае производных цитозина и гуанозина мы изменили порядок стадий деблокирования и восстановления азидогруппы и применили ОФХ для очистки 2’азидометилморфолиновых нуклеозидов 64в,г. После деблокикирования 2’аминометилморфолиновые нуклеозиды 60а-г очищали катионообменной хроматографией.

В ходе разработки стратегии синтеза морфолиновых олигомеров мы опирались на значительное различие в реакционной способности первичной 2’-аминометильной группы, аминогрупп гетероциклических оснований и атома азота морфолинового кольца в реакциях нуклеофильного замещения. Оптимальным было бы использование бифункционального соединения, реагирующего с этими центрами с разной эффективностью. Диметилоксалат является бифункциональным реагентом, активно применяющимся в синтезе олигонуклеотидных конъюгатов с использованием стратегии активных групп - предшественников. Важным обстоятельством является также то, что применение в качестве линкера, соединяющего отдельные мономеры, остатка щавелевой кислоты не приведет к появлению дополнительных хиральных центров в молекуле олигомера.

Для предварительного изучения свойств оксалилдиамидных морфолиновых АО мы синтезировали димеры 65 (HOMorU-Ox-NHMorU) и 66 (HOMorU-Ox-NHMorA) (схема 13).

Схема 13 Растворителем для реакции O HO Ura O HO Ura O HO Ura конденсации между активированным мономером 67 и [CH3OC(O)]60а или 60б N N N H аминомономерами 60а или 60б был Py, TEA TEA O O O O выбран пиридин. При проведении OCHO HN B реакции в метаноле целевые 68 65 B = Ura димеры 65 и 66 подвергались N 66 B = Ade медленному метанолизу с H образованием исходного соединения 68 и 2’-метоксиоксалиламидного производного соответствующего аминомономера. Обнаружено, что разность в реакционной способности первичной 2’аминометильной группы, морфолинового атома азота и аминогрупп гетероциклических оснований достаточно велика, чтобы проводить реакцию конденсации активированного по морфолиновому атому азота соединения 67 с аминокомпонентом без защиты N’(4) и ароматических аминогрупп гетероциклических оснований. Найдено, что соединения 65 и 66 стабильны в водном растворе при слабокислых и нейтральных значениях рН, но быстро гидролизуются в концентрированном водном аммиаке (1/2 = 15 мин), давая смесь соединения 68, 2’-амидооксалиламидо- и 2’-карбоксиоксалиламидо- производных второго морфолинового мономера. В 6 М растворе аммиака в метаноле медленно образуются (1/= 5 ч) соединение 68 и 2’-амидооксалиламидное производное соответствующего аминомономера. Нестабильность морфолидооксалиламидных АО в присутствии аммиака могла бы служить серьезным препятствием в синтезе таких олигомеров в случае использования морфолиновых нуклеозидов с гетероциклическими основаниями, защищёнными ацильными группами. Однако, как отмечено выше, применение защищённых по гетероциклическим основаниям производных не обязательно, так как диметилоксалат, по нашим данным, не реагирует в заметной степени с ароматическими группами гетероциклических оснований даже при продолжительной (более 5 дней) обработке.

HO O Повторяя реакции Ura Схема O DMTrO активации и конденсации, Ura 60a, TEA N как показано на схеме 13, мы 60a, TEA N [CH3OC(O)]2 AcOH/H2O O O синтезировали гексамер HN O O Ura O (схема 14). На каждой стадии OCH3 TEA конденсации использовали N H 69 не менее трёхкратного избытка аминокомпонента. Наличие диметокситритильной защитной группы в исходном активированном производном 70 облегчало очистку промежуточных олигомеров. После конденсации избыток аминокомпонента удаляли промывкой раствора реакционной смеси в хлористом метилене водой. После упаривания водного раствора и высушивания остатка аминокомпонент может быть использован в следующем цикле наращивания цепи без очистки. После каждой стадии удлинения мы подтверждали длину полученного олигомера с помощью масс-спектрометрии (табл. 1).

Таблица 1. Данные масс-спектрометрии и отношение интегральных интенсивностей сигналов некоторых протонов в ПМР-спектрах в зависимости от длины олигомеров.

Соединение [M+H]+, Интегральное отношение DMTr- H6(Ura)/четыре деблокиро- ароматических DMTrванный протона при 7.00-6.фрагмента м.д./H6’(Mor)+H5(Ura)/O CH3(DMTr)/OCH3 (метилоксалат, если имеется)b DMTr-O-MorU-Ox-NHMorU 508.14 0.50/1.00/1.10/1.57/- DMTr-O-MorU-Ox-NHMorU-Ox-OCH3 594.20 0.53/1.00/0.93/1.56/0.DMTr-O-MorU-(Ox-NHMorU)2 788.52 0.78/1.00/1.69/1.48/- DMTr-O-MorU-(Ox-NHMorU)2-Ox-OCH3 874.53 0.78/1.00/1.51/1.49/0.DMTr-O-MorU-(Ox-NHMorU)3 1068.65 1.04/1.00/2.02/1.68/- DMTr-O-MorU-(Ox-NHMorU)3-Ox-OCH3 1154.80 0.91/1.00/2.25/1.65/0.DMTr-O-MorU-(Ox-NHMorU)4 1349.26 1.30/1.00/2.84/1.59/- DMTr-O-MorU-(Ox-NHMorU)4-Ox-OCH3 1434.00 - DMTr-O-MorU-(Ox-NHMorU)5 1629.26 - HOMorU-(Ox-NHMorU)5 (69) 1629.56 - a) Вследствие использования дигидроксибензойной кислоты в качестве матрицы при приготовлении образцов для MALDI-TOF масс-спектров DMTr-защитная группа отщеплялась в процессе анализа.

b) Спектры записаны в метаноле-d4, с добавлением нескольких капель DMSO-d6.

Длина олигомера также может быть оценена по соотношению интегральных интенсивностей сигналов протонов при ПМР-спектроскопии, а именно, по соотношению интенсивности мультиплета протонов H6(Ura) на 7.80-7.68 м.д., хорошо разрешенной дтгруппы четырех ароматических DMTr-протонов на 7.00-6.90 м.д., мультиплетов H6’(Mor) и H5(Ura) на 5.85-5.65 м.д. и синглета шести метоксильных протонов DMTr-защитной группы на 3.75-3.85 м.д. После обработки диметилоксалатом строение полученного продукта подтверждали с помощью масс-спектрометрии, а также, дополнительно к интегральным интенсивностям сигналов указанных протонов, интенсивностью сигналов метоксильных протонов на 3.85-3.95 м.д., отнесенных к метиловому эфиру остатка щавелевой кислоты.

Одним из недостатков некоторых глубоко модифицированных АО, в частности – ПНК, является низкая растворимость в воде. Мы обнаружили, что морфолидооксалиламидные димеры 65, 66 и олигомер 69 растворяются в воде и в водных буферах при рН 7.5 вплоть до милимолярных концентраций. Таким образом, мы не испытали затруднений при последующих экспериментах по изучению физико-химических свойств морфолидооксалиламидных АО.

Как отмечалось выше, разработанная нами стратегия синтеза новых морфолидооксалиламидных АО основана на существенной разнице в реакционных способностях первичных алифатической и ароматической аминогрупп, а также морфолинового атома азота. Вследствие этой разницы при синтезе олигомеров нет необходимости в промежуточных защитных группах гетероциклических оснований и морфолинового атома азота мономеров. Ключевым соединением в этом случае являются аминомономеры 60а-г. В дополнение к схеме 12, где исходными соединениями для синтеза аминомономеров 60а-г являются защищённые морфолиновые нуклеозиды, мы разработали усовершенствованную методику получения 2’-аминометилморфолиновых аналогов нуклеозидов без использования защитных групп, исходя из рибонуклеозидов 71а-г (схема 15).

Схема O B O HO B HO B HO Ph3P/CBrCl3, 1) NaIO4/EtOH+H2O O TrCl, TEA 2) (NH4)2B4O7*4H2O NaN3, DMF OH OH N N 3) NaBH3CN H 73а-г 71а-г 68, 72б-г Tr B N3 O N3 O B H2N O B 1) Ph3P, Py AcOH/H2O 2) NH3/H2O N N N H 74а-г H 75в,г 60а-г Tr O B H2N 1) Ph3P, Py AcOH/H2O 2) NH3/H2O N B = Ura (а), Ade (б), Cyt (в), Gua (г) 76а,б Tr Синтез соединений 68, 72б-г проводили аналогично получению защищённых производных 61а-г (Summerton J. E. et al., 1991). Нам не удалось осуществить замену гидроксигруппы на азидную в морфолиновых нуклеозидах 68 и 72 б-г, поэтому мы ввели промежуточную защиту атома азота морфолинового цикла с помощью тритильной группы. Реакция проходила селективно, не затрагивая 2’-гидроксиметильную группу и аминогруппы гетероциклических оснований. Реакцию с соединениями 68, 72б,в удалось провести без предварительной очистки. Для синтеза соединения 73г нам пришлось предварительно очистить соединение 72г с помощью ОФХ. Введение азидогруппы в соединения 73а-г проводили, как описано выше для соединений 61а-г. Дальнейшая обработка соединений 74а-г для получения целевых продуктов 60а-г возможна двумя путями: сначала восстановление азидогруппы, затем удаление тритильной защитной группы, или наоборот (схема 15). Мы реализовали оба пути. Нужно отметить, что наличие тритильной защитной группы в мономерах 76а,б полезно при разработке твердофазного варианта синтеза морфолидооксалиламидных олигомеров для оценки степени присоединения очередного мономера к растущей цепи спектрофотометрически.

Среди морфолиновых АО, в которых субъединицы связаны ахиральными линкерами, наше внимание привлекли олигомеры, содержавшие N-метиленкарбоксамидные группы.

Как показано ранее, урацил- и аденин-содержащие декамеры такого типа образуют с комплементарными ДНК комплексы с повышенной либо незначительно пониженной термостабильностью по сравнению с природными OdN (Chakhmakhcheva O. et al., 1999). В этой работе также кратко описано получение урацил- и аденин-содержащих 2’аминометил-4’-метиленкарбоксильных морфолиновых мономеров, защищённых монометокситритильной группой. Исходными соединениями при этом служили 5’-Oдиметокситритилнуклеозиды, защищённые по аминогруппам гетероциклических оснований.

Мы синтезировали все четыре морфолиновых 2’-аминометил-4’метиленкарбоксильных мономера 77а-г, содержащих Вос-защитную группу, по схеме 16.

В качестве исходных соединений использовали более доступные уридин 71а и защищённые по гетероциклическим основаниям рибонуклеозиды 44, 78в,г. В отличие от схемы 15, сначала вводили азидогруппу в нуклеозид, а затем окисляли модифицированные рибонуклеозиды 79а-г.

Схема 16 Так как азидная N3 O B' B' HO N3 O B' O 1) Ph3P, Py функция уже Ph3P/CBrCl3, 1) NaIO4/EtOH/H2O OH OH OH OH присутствовала в N 2)NH3/H2O или 2) Gly/TEA NaN3, DMF O 1M NaOH соединениях 79а-г, на 3) NaBH3CN 44, 71а, 78в,г 79а-г стадии замыкания цикла и OO восстановления с 80а-г O O H2N B' O N B' образованием соединений H (Boc)2O, 80а-г мы могли N N 1M NaOH/iPrOH использовать не O O B' = Ura (а), ABz (б), защищённый по 81а-г O77а-г O- CBz (в), GuaiBu (г) карбоксильной группе глицин. Это, наряду с отсутствием необходимости удаления DMTr-защитной группы, сокращало количество стадий синтеза по сравнению со схемой, описанной ранее. На стадии восстановления азидогруппы в соединениях 80б-г, в отличие от схемы 15, промежуточное фосфониевое соединение гидролизовали раствором NaOH, а не водным раствором аммиака, вследствие наличия чувствительных к аммонолизу ацильных защитных групп гетероциклических оснований. Окончательную очистку мономеров нам удалось осуществить после введения Boc-защитной группы в аминосоединения 81а-г и получения целевых мономеров 77а-г.

Для синтеза олигомеров на основе 2’-аминометил-4’-метиленкарбоксильных морфолиновых нуклеозидов удобно использовать методы пептидной химии. Активацию карбоксикомпонента проводили с помощью дициклогексилкарбодиимида (DCC) в присутствии N-гидроксисукцинимида (SuIm), пентафторфенола, 1-гидроксибензотриазола (HOBt).

B' Оптимальным оказалось B' B' применение O O O O O O пентафторфениловых N Boc N N OH N 82а-б N N активированных эфиров.

H H H B' = Ura (а), ABz (б) Ura Ura Ura Нам удалось получить урацил- и аденинO O O O O O содержащие тетрамеры N N N H2N N N OH 85 n = 82а,б без применения H H 86 n = n дополнительной защиты Ade Ade Ade карбоксильной группы O O O O O O аминокомпонента, N N N OH H2N N N используя метод H H активированных эфиров Рисунок 6. 4'-Метиленкарбоксамидные морфолиновые олигомеры. (рис. 6).

При попытке дальнейшего синтеза олигомеров с помощью этой схемы для сохранения приемлемых выходов необходимо было применять неоправданно высокий избыток аминокомпонента в реакции конденсации. Следующим шагом в разработке метода синтеза метиленкарбоксамидных морфолиновых АО являлось применение временной защиты карбоксильной группы аминокомпонента. Мы выбрали п-нитробензильную защитную группу, которая легко может быть удалена при рН 8.0 под действием дитионита натрия.

На схеме 17 представлена последовательность реакций при получении метиленкарбоксамидных димеров 83а,б с применением временной защиты карбоксильной группы в виде п-нитробензилового эфира.

B' На первой стадии Boc Схема O мы синтезировали Boc HN O O B' Boc N полностью HN OH N O B' H защищённые N DCC, NO2PhCH2OH, мономеры 84а,б, O Na2S2O4/Na2CO3 DCC,HOBt N O O исходя из которых SuIm 77а-б OH 84а,б TEA легко получить TFAOH/CH2ClB' = Ura (а), ABz (б) B' карбокси- и B' B' NOO аминокомпоненты O O O TFA O O N для реакции + O N Boc N H3N O N N NO2 конденсации, удалив H H NO83а-б п-нитробензильную либо Boc-защитные группы, соответственно. С целью повысить эффективность конденсации без применения большого избытка аминокомпонента мы использовали более активные HOBtактивированные эфиры карбоксикомпонентов и безводные растворители. Наличие пнитробензильной защитной группы в аминокомпоненте реакции конденсации повышало его растворимость в органических растворителях. Повторяя последовательность реакций, приведенную на схеме 17, после деблокирования защищённых олигомеров и очистки нам удалось получить урацил-содержащие додека- и гексадекамер 85 и 86 (рис. 6).

Длину промежуточных олигомеров подтверждали по соотношению интегральных интенсивностей сигналов протонов в ПМР-спектре, относящихся к Boc-защитной группе, и ароматических протонов урацильных остатков, а также по отношению поглощения 2(характерно для остатка урацила) и 300 (характерно для нитробензильного остатка).

К сожалению, активация карбоксильной группы аденин-содержащих олигомеров с образованием HOBt-активированных эфиров в присутствии DCC протекала недостаточно эффективно уже для димера (около 50 %), и нам удалось получить только пентамер 87.

Ранее также отмечалась в некоторых случаях низкая эффективность активации пуриновых мономеров в присутствии DCC в синтезе ПНК (Анцыпович С. И., 2002).

Активация карбоксильной группы аденин-содержавших олигомеров в присутствии гесафторфосфата О-(1Н-бензотриазол-1-ил)-N,N,N’,N’-тетраметилурония (HBTU) оказалась достаточно эффективной и была применена на следующем этапе работы. Мы осуществили синтез аденин-содержащих 4’-метиленкарбоксамидных морфолиновых АО в твердофазном варианте (схема 18).

Схема 18 H2N O Ade 77б HBTU, N DIPEA O HN O Ade 1) TFAOH/CH2ClTFAOH/CH2Cl2 77б OBtr O O O N O O O O 2) (CH3)2N(CH2)2NHn HN O Ade TFAOH/CH2Cl2 HN BocHN TFA+H3N O N 88 n = H N H N N O O N BocHN B' O Для очистки олигомеров использовали катионообменную хроматографию на SPсефарозе в градиенте NaCl в присутствии 0.1 % трифторуксусной кислоты (TFAOH), с последующим обессоливанием с помощью ОФХ в градиенте ацетонитрила в воде в присутствии 0.1 % TFAOH. Гомогенность полученных олигомеров 85-88 подтверждали с помощью капиллярного ЭФ в капилляре, обработанном полиэтиленимином, в условиях обращенного электроосмотического потока. Ранее подобные условия использовали для анализа олигоацетилированных по первичным аминогруппам форм лизоцима (Crdova et al., 1997).

При изучении физико-химических свойств метиленкарбоксамидных олигомеров мы обнаружили, что термостабильность их комплементарных комплексов существенно зависит от состава гетероциклических оснований модифицированной цепи (урацил или аденин). Аденин-содержащие метиленкарбоксамидные олигомеры образуют более стабильные комплексы с поли(U), чем природный олигодезоксирибоаденилат такой же длины (55.0 оС для олигомера 87, 52.8 оС для олигомера 88, 48.1 оС для dA5). Комплексы модифицированных пентамеров 87 и 88 обладают бльшей термостабильностью с поли(U) в сравнении с поли(dT) (55.0 и 51.4 оС для 87, 52.8 и 49.3 оС для 88).

Таким образом, мы предложили морфолиновые АО – миметики НК, в которых мономерные звенья связаны морфолидооксалиламидными линкерами. Синтез таких соединений возможен с применением бифункционального реагента диметилоксалата без защиты аминогрупп гетероциклических оснований и атома азота морфолинового кольца.

Для получения ранее предложенных метиленкарбоксамидных морфолиновых АО разработана усовершенствованная методика синтеза мономеров, изучена возможность получения таких олигомеров в растворе и на полимере с помощью методов пептидной химии. Предложена методика анализа протонируемых при физиологических условиях рН морфолиновых АО с помощью капиллярного электрофореза.

4. Разработка подходов к обратимому модифицированию OdN 4.1 Фотолабильные линкеры. В предыдущих разделах описаны методы получения модифицированных OdN. Как правило, стабильность целевого конъюгата или АО является необходимым условием успешного синтеза и последующего применения, обеспечивая неизменность свойств соединений. Чаще всего при этом модифицирование OdN является необратимым. Одним из способов обратимого присоединения лигандов к НК является применение лабильных линкеров, расщепляемых в определенных условиях.

Фотолиз о-нитробензилового спирта и родственных соединений является хорошо изученным процессом (Adams S. R. et al., 1993). Синтезированы соединения нуклеотидной, белковой и иной природы, содержащие остаток о-нитробензилового спирта или аналогичных соединений, для изучения механизма функционирования биополимеров в клетке. Нам представлялось интересным разработать универсальный фотолабильный линкер для обратимого модифицирования OdN. Производные о-нитробензилового спирта 86 (рис. 7) являются подходящими исходными соединениями для этого.

Для использования в качестве линкера желательно ввести в структуру соединения по крайней мере две функциональные группы. Первоначально мы решили использовать в качестве линкера коммерчески доступный о-нитрофенилэтиленгликоль (89, R1=CH2OH, R2=OH, R3=R4=H, смесь энантиомеров), содержащий две гидроксильные группы, и синтезировали амидофосфит 90 (рис. 7).

Однако при попытке синтеза 5’R1 R2 биотинового производного OdN с N NO2 использованием амидофосфита 90 выход O P целевого конъюгата оказался низким (менее CN O R4 DMTrO 10 %). На модельных соединениях мы NORпоказали, что при деблокировании OdN по 89 R3, R4 = H окончании синтеза в водном аммиаке OH H2N происходит расщепление этиленгликолевого NOлинкера по механизму -элиминирования в Рисунок 7. Фоторасщепляемые щелочной среде с отщеплением линкеры, содержащие 91 о-нитробензильный фрагмент. модифицирующего остатка. Таким образом, этот путь синтеза универсального линкера оказался непригодным.

На следующем этапе мы решили ввести в структуру линкера аминогруппу для последующего получения конъюгата постсинтетически. Синтез 1-(о-нитрофенил)-2аминоэтанола 91 осуществляли по схеме 19.

Схема OH O Lev OH O Lev DMTr DMTr O O HO NO2 NO2 HO NONO(Lev)2O DMTrCl, Py AcOH/H2O MeIm 89 R1=CH2OH, R2=OH, R3=R4=H OH OH O Lev Br Br+H3N TFAHN NO2 NO2 NOPh3P/CBrClNH3/MeOH/H2O TFAOEt 95 Защищали первичную гидроксильную группы о-нитрофенилэтиленгликоля (смесь изомеров) обработкой диметокситритилхлоридом, затем защищали вторичную гидроксигруппу с помощью левулинового ангидрида в присутствии MeIm и удаляли диметокситритильную защитную группу. Далее соединение 94 обрабатывали трихлорбромметаном в присутствии трифенилфосфина, затем после обработки бромида водно-метанольным раствором аммиака получили 1-(о-нитрофенил)-2-аминоэтанол 91 в виде гидробромида. Для использования аминоэтанольного линкера 91 в олигонуклеотидном синтезе аминогруппу защищали трифторацетильной группой.

Соединение 96 использовано для введения фотолабильного линкера в OdN с помощью триэфирного синтеза в растворе с последующим получением конъюгатов и комплексов OdN 97-101 (рис. 8).

При облучении водного O O O NH2 раствора соединения 97 УФNH HN P ODN O P TT светом в диапазоне 254-365 нм O OH O2N O- происходит быстрое N S отщепление линкера и O освобождение O2N O немодифицированного NH2 O P ODN динуклеотида рТрТ с периодом O P ODN O OH Биотин O2N O- Авидин N полупревращения около 1.мин (табл. 2). Следует 198 O O2N отметить, что в области 260P ODN 300 нм гетероциклические O O- ODN = d(ATGCCCCTCAAC) H основания НК поглощают с Авидин Биотин N большим коэффициентом 1молярной экстинкции, поэтому O2N при изучении фотолиза Рисунок 8. 5'-Конъюгаты и комплексы OdN, полученные с конъюгатов более длинного помощью фотолабильного линкера на основе аминоэтанола.

OdN 98-101 мы использовали фильтры, пропускающие УФ-излучение в диапазоне 313-365 нм, практически прозрачном для НК. В этой области о-нитробензильный остаток имеет максимум поглощения (=3500 М-1см-1, McCray J. A. et al., 1993). При облучении конъюгатов 98, 99 УФ-светом в диапазоне 313-365 нм происходит освобождение додекануклеотида с периодом полупревращения 6 мин (табл. 2).

Таблица 2. Время полупревращения (1/2) фотолабильных производных OdN при облучении УФ-светом в диапазоне длин волн 313-365 нм.

Производное 1/2, мин 97 1.5 (облучение в диапазоне 254-365 нм) 99 6.100 8.2 (7.5 по данным гель-ЭФ) 101 8.Меньшую скорость процесса по сравнению с УФ-облучением в широком диапазоне можно объяснить тем, что в области 250-300 нм поглощение о-нитробензильным остатком УФ-излучения происходит более эффективно (=260 4700 М-1см-1, McCray J. A. et al., 1993).

При смешивании с авидином производное 99 образует прочный комплекс, не разрушающийся в условиях гель-фильтрации на сефадексе G-75 в 1 М NaCl и в условиях гель-электрофореза (гель-ЭФ). Найдено, что период полупревращения для освобождения OdN из комплекса с белком при облучении УФ-светом производного 100 в диапазоне 313365 нм составляет около 8.0 мин по данным гель-фильтрации и гель-ЭФ. По данным гельЭФ определено, что около 30 % радиоактивной метки остаются связанными с белком даже после 60 мин облучения. Скорость освобождения олигонуклеотида соответствует скорости фотолиза соединения 99 (табл. 2).

Мы оценили также степень освобождения OdN в случае, когда авидин ковалентно связан с полимерным носителем (авидин-ультрагель А2). Порции сорбента с сорбированным конъюгатом (комплекс 101) облучали УФ-светом в диапазоне 313-365 нм.

За 20 мин освобождается около 50 % олигонуклеотида, дальнейшее облучение не приводит к дополнительному выходу OdN в раствор. Время полупревращения в этих экспериментах соответствует времени полупревращения аналогичного комплекса в растворе (см. табл. 2). Неполное освобождение OdN при облучении комплексов 100, 101 в гомогенной и гетерогенной среде можно объяснить специфическим окружением фотореакционного центра в комплексе с белком. Возможно, присоединение биотина к производному 98 через дополнительный линкер способствовало бы полному освобождению олигонуклеотида из комплекса. При облучении конъюгата 99, не содержавшего авидин, происходит практически количественное освобождение OdN.

Следует отметить, что фотолабильный линкер 91, конъюгаты и комплексы 97-101, синтезированные с его использованием представляют собой смесь изомеров по асимметрическому атому углерода. Нами предпринята попытка сконструировать дополнительно к рацемическому линкеру 91 фотолабильный линкер с двумя функциональными группами, не содержащий дополнительных хиральных центров. Как отмечено выше, при фотолизе биологически значимых объектов (НК и других биополимеров) предпочтительно использовать длинноволновое УФ-облучение. Согласно литературным данным, о-нитровератрильные производные (R3 = R4 = OCH3, рис. 7) более эффективно поглощают УФ-излучение в области 300-400 нм (=350 5000 М-1см-1), чем онитробензильные (McCray J. A. et al., 1993).

Учитывая более низкий квантовый выход о-нитровератрильных производных и сравнив доступность исходных соединений, мы решили использовать в качестве второй функциональной группы в соединении 89 заместитель R3 = СООН. Синтез целевого ахирального фоторасщепляемого линкера начинали с легкодоступной коммерчески п(аминометил)бензойной кислоты 102 (схема 20).

На первой стадии защищали аминогруппу, Схема 20 затем вводили нитрогруппу в соединение 103.

H2N TFAHN TFAHN Для демонстрации возможностей применения NOTFAOEt/TEA HNO3/H2SOфотолабильного линкера 104 при решении задачи поиска наиболее эффективных 102COOH 11COOH конструкций искусственных РНКаз с COOH помощью комбинаторного подхода мы синтезировали конъюгат 105. Синтез модельного соединения 105 начинали с введения фотолабильного линкера 104 в модифицированный по гетероциклическому основанию аминоалкильным линкером защищённый по 5’-гидроксигруппе дезоксицитидин.

Применение линкера, содержащего группы-предшественники, позволяет реализовать прекурсорную стратегию синтеза комбинаторных библиотек, использованную ранее для введения в OdN на 5’-конец остатков имидазола, имитирующих активный центр РНКазы (Белоглазова Н. Г. и др., 1999). Поэтому на следующей стадии после удаления трифторацетильной защитной группы мы обработали получившееся аминопроизводное диметилоксалатом. В качестве модельного соединения, имитирующего каталитически активную группу низкомолекулярной РНКазы, применили гистамин. Таким образом, соединение 105 содержит все необходимые блоки модельного адресованного РНКазомиметика.

При облучении соединения 105 УФ-светом с длиной волны 313-365 нм исходное соединение исчезает с периодом полупревращения около 5 мин, что согласуется с данными для производных 99-101 (табл. 2). Согласно известному механизму фотолиза производных, содержащих о-нитробензильный фрагмент (McCray J. A. et al., 1993), в результате фотолиза соединения 105 помимо цитидин-содержащего фрагмента можно ожидать образования амидооксалилгистамида 106 (схема 21).

линкер-прекурсор адресующая O ON O O2N Схема часть O N O H H H HN H2N N N УФ 313-365 нм HN HN O + N O O HN N N N фотолабильный N O N O H линкер 1N dR каталитически dR 105 HN активный остаток Для подтверждения состава продуктов фотолиза мы синтезировали соединение 1встречным синтезом, исходя из диметилоксалата. С использованием многоволновой детекции в УФ-диапазоне при хроматографии облученных образцов соединения 105 и заведомого контроля соединения 106, было подтверждено образование амидооксалилгистамида в реакционной смеси в количестве, соответствующем количеству исходного соединения 105. ЯМР-, УФ- и масс-спектры полученного в результате фотолиза соединения соответствовали заведомому образцу 106.

Таким образом, мы сконструировали и синтезировали 2 фотолабильных линкера на основе о-нитробензильного фрагмента. В процессе фотолиза конъюгатов и комплексов, полученных с использованием фотолабильных линкеров 96 и 104, продемонстрировано освобождение исходного олигомера либо модифицирующей части, соответственно, что позволяет использовать эти линкеры для разнообразных целей.

4.2 Блокированные фотолабильными остатками по межнуклеотидной фосфатной группе OdN. Для создания так называемых транспортных форм антисмысловых олигонуклеотидов в литературе описаны группы для модифицирования фосфодиэфирных межнуклеотидных связей, удаляющиеся в биологически активной среде в результате действия клеточных карбоксиэстераз (Barber I. et al., 1995). Развивая изложенные в предыдущем разделе подходы по контролированию процессов расщепления конъюгатов OdN с помощью применения фотолабильных линкеров и учитывая опыт по синтезу и применению фосфотриэфирных производных олиготимидилатов, мы предложили блокирование межнуклеотидных фосфатных групп в OdN фотолабильными фосфотриэфирными группировками. В отличие от защитных групп, удаляющихся в присутствии эстераз, фотолабильные блокирующие группы можно удалять независимо от внутриклеточного окружения, причем начало и степень деблокирования могут контролироваться путем включения облучения, в том числе лазерного.

В ходе разработки методов получения и для изучения свойств фотолабильных триэфирных аналогов OdN мы синтезировали производные дитимидинфосфата, несущие о-нитробензильный и о-нитровератрильный остатки, этерифицирующие межнуклеотидную фосфатную группу. Соединения 107-111 получены с помощью переэтерификации защищённого по 5’- и 3’-гидроксигруппам п-хлорфенилового эфира динуклеозидфосфата 112 в присутствии соответствующего спирта и CsF (схема 22).

Схема Thy Thy DMTr Thy O HO DMTr O O O O 1) NH2NH2.H2O O O O ROH, CsF O P OR O P OR O P O Cl 2) AcOH/H2O Thy Thy Thy O O O O O O 1OLev OH OLev 107-11H3CO 107 R = 108 R = 109 R = O H3CO NO2 NO2 H3CO H3CO NO110 R = 111 R = H3CO H3CO S O NONO При очистке продуктов 107-111 с помощью ОФХ для каждого из триэфиров наблюдалось появление двух пиков продукта, соответствующих двум диастереомерам по атому фосфора. В дальнейшей работе использовали смесь диастереомеров без разделения.

Выход очищенных производных составил до 80 %, за исключением соединения 111, которое оказалось нестабильным в кислых условиях и получено с выходом 20 %.

Фоточувствительность блокированных фосфотриэфирных аналогов проверяли при облучении их водных растворов УФ-светом в диапазонах 254-365 и 330-390 нм. При анализе облученных в диапазоне 254-365 нм растворов соединения 107 наблюдали появление ТрТ с периодом полупревращения около 10 мин (табл. 3).

Таблица 3. Время полупревращения (1/2, мин) фотолабильных производных 107-111, 1при облучении Уф-светом в диапазоне длин волн 254-365 нм и 330-390 нм.

Соединение 1/2, мин Диапазон облучения Диапазон облучения 254-365 нм 330-390 нм 107 10.2 3108 1.8 109 60.0 1110 - 111 - 9.114 3.0 При облучении УФ-светом в диапазоне 330-390 нм, который оказывает меньшее повреждающее влияние на биологические объекты, соединение 107 деблокируется значительно медленнее, что объясняется меньшим коэффициентом молярного поглощения и меньшим квантовым выходом реакции при облучении в этом диапазоне (см. пред.

раздел). Фоточувствительность соединения 107 оказалась значительно меньше (табл. 3), чем можно было предположить, исходя из данных по фотолизу модельного соединения онитробензилового эфира тимидин-5’-фосфата 114 (рис. 9), содержащего такую же фотолабильную защитную группу.

Thy HO Возможно, наличие ионизированного остатка O O фосфорной кислоты в соединении 1Thy O P O O O (фосфодиэфирной группы) способствует OH O отщеплению протона, необходимому, согласно O P O OH установленному механизму фотолиза подобных Thy O O O2N соединений (McCray J. A. et al., 1993), на первой 114 1стадии фотолиза. Данные по скорости OH Рисунок 9. Модельные соединения, фотодеблокировния для соединения 1синтезированные для изучения фотолиза согласуются с данными для соединения фотолабильных триэфиров дитимидилатов.

(табл. 2), представляющего собой подобное 5’производное динуклеотида.

о-Нитровератрильное производное 109 деблокировалось приблизительно в 3 раза быстрее, чем аналогичное о-нитробензильное производное 107 при облучении в диапазоне 330-390 нм. При обучении в коротковолновом УФ-диапазоне наблюдалась обратная зависимость (табл. 3). Введение дополнительного оксиэтильного линкера между фотореакционным центром и межнуклеотидной фосфатной группой приводит к увеличению скорости фотолиза в 5-10 раз (см. данные для производных 107 и 108, 109 и 110), что, вероятно, объясняется природой расщепляемой связи (фосфоэфирная или алкилэфирная).

При фотолизе соединений 108 и 110 образуется сравнительно стабильное промежуточное соединение, которое при анализе методом ОФХ совпадает с этиленгликолевым фосфотриэфирным производным 115 (рис. 9), полученным встречным синтезом. При инкубации реакционных смесей после облучения соединений 108 и 110 в темноте в течение нескольких часов содержание промежуточного продукта 1уменьшается и накапливается продукт, соответствующий ТрТ, с периодом полупревращения около 6 ч. При выдерживании в концентрированном водном аммиаке соединение 115 полностью разлагается в течение 1 ч с образованием ТрТ.

С целью получения при фотолизе менее стабильного соединения, чем в случае триэфиров 108, 110, и ускорения образования ТрТ синтезирован триэфир 111, содержавший меркаптоэтильный фрагмент вместо оксиэтильного. Более нуклеофильная тиольная группа, образующаяся при фотолизе соединения 111, способствует быстрому элиминированию линкера, так что промежуточное соединение в этом случае не регистрируется. Скорость исчезновения исходного соединения совпадает со скоростью накопления ТрТ (1/2 9.0 мин, табл. 3). Следует отметить, что введение атома серы несколько ускорило фотолиз (см. соединения 110 и 111, табл. 3).

Стабильность фосфотриэфирных производных 107-111 по отношению нуклеазам исследовали в присутствии очищенной фосфодиэстеразы змеиного яда и в клеточном экстракте. Все исследованные соединения, кроме производного 111, устойчивы по отношению к ФДЭ. Производное 111 разлагается в этих условиях с периодом полупревращения около 4 ч, однако это соединение нестабильно в нейтральных растворах даже в отсутствие фермента. Сходные результаты получены в экстрактах клеток HeLa.

Динуклеозидфосфат ТрТ в условиях экспериментов полностью гидролизуется менее чем за час.

Thy DMTr O Для получения фотолабильных O H3CO триэфиров OdN стандартным 116-1амидофосфитным методом с O 119 R = H3CO O использованием коммерчески P RO N NOдоступных амидофосфитов с H3CO защитными группами по гетероциклическим основаниям, 120 R = H3CO 116 R= S удаляющимся при мягкой NONOаммиачной обработке или в 117 R = нейтральных условиях мы O синтезировали амидофосфитные H3CO NOпроизводные 116-120 (рис. 10). С Рисунок 10. Амидофосфиты 118 R = использованием стандартного для синтеза фотолабильных H3CO фосфотриэфирных аналогов амидофосфитного протокола OdN.

NO2 синтезированы димеры 107-111, идентичные по данным ОФХ и УФспектроскопии соединениям, полученным реакцией переэтерификации в растворе.

5. Дизайн и синтез 5’-трифосфатов природных и модифицированных динуклеотидов и модифицированных нуклеозидов Ферментативные способы введения заместителей в олигонуклеотиды с помощью модифицированных нуклеозидтрифосфатов (NTP) нашли широкое применение во множестве областей молекулярной биологии и медицины. NTP стали важнейшими инструментами исследования биологических процессов и объектов. Среди наиболее важных применений ферментативного подхода, значение которых трудно переоценить, можно упомянуть секвенирование НК и методы генной диагностики с использованием ПЦР. Большое значение имеет ферментативный синтез НК с расширенными функциональными возможностями. Что касается 5’-трифосфатных производных олиго- и полинуклеотидов, их биологическая роль несколько уже, хотя известно, что вновь синтезированные матричные РНК содержат 5’-трифосфатные фрагменты. В дальнейшем происходит кэпирование 5’-конца полимера, процессинг, транспорт из ядра в цитоплазму и другие важнейшие биологические процессы, которые в настоящее время интенсивно изучаются (del Campo E. M., 2009).

С учетом большого значения 5’-трифосфатов нуклеозидов и полинуклеотидов в биохимии и молекулярной биологии, разработка новых методов синтеза природных и модифицированных трифосфатов нуклеозидов и полинуклеотидов является важнейшей задачей.

5.1 Введение 5’-трифосфатного фрагмента в динуклеотиды постсинтетически. В разделах 1 и 2 описаны результаты работы по успешному синтезу 5’-фосфорилированных OdN, а в разделе 3.1 представлены примеры использования 5’-фосфата синтезированных олигомеров как места для введения заместителей в OdN постсинтетически, либо в процессе синтеза. С использованием полученных результатов мы применили метод активации 5’-фосфомоноэфирной группы с образованием активных цвиттерионных соединений (Годовикова Т. С. и др., 1989) для синтеза 5’-трифосфатов ди- и олигонуклеотидов.

На схеме 23 представлена последовательность реакций, протекающих при синтезе 5’трифосфатов динуклеотидов, по данным 31Р-ЯМР спектроскопии и анализа реакционных смесей с помощью анионообменной хроматографии.

O Схема 23 Реакции проводили в смеси O - + B O P O В O Ph3P O P O Ph3P/(PyS)2 O DMF/DMSO с предварительной OOO O - активацией концевой фосфатной B O P O PyS- B O O P O O O группы в присутствии O 1OH OH нуклеофильного катализатора и H2O последующим добавлением MeIm неорганического пирофосфата к B O O O B H3C N N+P O O O реакционной смеси без выделения P - O OMeIm O B O P O промежуточных соединений и O O B O 122 O P O O удаления избытка реагентов.

OH O 1OH Чтобы оптимизировать синтез 5’H2P2O72H2P2O72O O O трифосфодезоксидинуклеотидов 124, B O P O P O P O O мы изучили зависимость выхода O- O- OO продукта от типа противоиона к B 124 O P O O O фосфатным группам, времени B = Ade, Gua, Cyt, Thy OH активации, типа нуклеофильного.

.

катализатора и времени реакции с пирофосфатом. Обнаружено, что степень активации межнуклеотидной фосфатной связи зависит от типа используемой соли динуклеотида 121. Установлено, что выход тем больше, чем больше радиус и гидрофобность используемых катионов.

Следующим этапом нашего исследования было определение оптимального времени активации. При концентрации 0.1-0.5 М соединения 121 и 5-10-кратном избытке окислительно-восстановительной активирующей пары реагентов активация заканчивается за 5-7 мин. При добавлении на стадии активации MeIm или DMAP образуется цвиттерионное соединение по концевому атому фосфора 122, обладающее высокой реакционной способностью. Мы выбрали MeIm из серии нуклеофильных катализаторов главным образом из-за лучшей растворимости пирофосфата в присутствии избытка MeIm в реакционной среде.

Интенсивность пика, идентифицированного как циклопирофосфат 123, увеличивалась с уменьшением концентрации MeIm. При замене пирофосфата на второй стадии реакции 50-кратным избытком морфолина наблюдали быстрое образование соответствующего 5’морфолидофосфата с выходом более 90 %. Этот факт свидетельствует в пользу образования фосфамидов как через промежуточное цвиттерионное соединение 122, так и внутримолекулярный пирофосфат 123. Более низкий выход 5’-трифосфатов олигонуклеотидов (55-85 %) по сравнению с соответствующими морфолидами можно объяснить более низкой нуклеофильнотью аниона пирофосфата. Нам не удалось повысить выход целевого продукта путем увеличения времени реакции с пирофосфатом. При выдерживании реакционной смеси дольше 15-20 мин после добавления пирофосфата в реакционной смеси наблюдалось появление полизаряженных соединений. Подобные результаты также получены при увеличении избытка пирофосфата более 10-кратного.

5.2 Введение 5’-трифосфатного фрагмента в процессе синтеза динуклеотидов.

Ограничения по наличию функционально активных групп в модифицированных олигомерах, накладываемые методом синтеза 5’-трифосфатов олигонуклеотидов, рассмотренным в предыдущем разделе, побудили нас разработать универсальный подход, пригодный для получения 5’-трифосфатов, содержащих функционально активные группы.

Синтез начинали с построения нуклетидной части молекулы, содержащей необходимые модификации и функциональные группы. Схему синтеза нуклеотидного фрагмента выбирали с учетом строения и местоположения вводимого заместителя.

На схеме 24 в качестве B1 Схема HO примера представлен синтез {2’DMTrO B' O O d-[цитидилил(3’-фосфо-5’)-51) TPSCl, MeIm аминоаллилуридин]}-5’X R3 + OR2 R3 2) AcOH/H2O трифосфата (B’ = N4O P O11O бензоилцитозин, В1= 5Rтрифторацетамидоаллилурацил, O O O B' HO O В2 = цитозин, В3 = 5BO P O P O P O O аминоаллилурацил, R1 = О-пO- O- OX Rхлорфенил, R2 = ацетил, R = R3= X R B1 1) POClO P O O Н, R4 = О-, Х = О).

2)[(C4H9)3N]2+H2P2O72BO P O O O Исходные защищённые ROR2 R3 3) NH3/H2O.

Rмономеры для синтеза OH R 127 1динуклеотидов (соединения 125 и 126, схема 24) при необходимости получали с помощью различных методов, используемых для введения функциональных групп в нуклеозиды, рассмотренных в предыдущих разделах.

Соответствующим образом защищённые динуклеозидфосфаты, содержавшие свободную 5’- оксигруппу (соединения 127) в большинстве случаев получали с помощью триэфирного метода синтеза олигонуклеотидов,. Для 3’-N5’-О-фосфамидов и химерных (рибо)дезоксирибодимеров более удобной оказалась конденсация с помощью амидофосфитного метода синтеза олигонуклеотидов, однако синтез проводили в растворе, а не на полимере, как обычно. В случае метилфосфонатов применяли фосфонодиимидазолидный метод. Примеры модификаций приведены в таблице 4.

Таблица 4. Модификации, введенные в 5’-трифосфаты динуклеотидов (схема 24, соединения 128).

Модификации рибозофосфатного Модификации гетероциклических остова оснований B2 и BX = NH, O, S 4-N-(аминоалкил)цитозин, в том числе 5R = H, OH, N3 (в том числе метилированный арабиноконфигурация), NH2 (в том числе 5-(3-аминоаллил)урацил арабиноконфигурация), OCH3 5-(3-аминопропилоксиметил)урацил R4 = O, S, CH3 6-N-(аминоалкил)аденин «Locked»-нуклеозиды Таким образом, схему синтеза нуклеотидной части молекулы выбирали в зависимости от строения целевого соединения, используя богатый арсенал методов олигонуклеотидной химии. Проведение синтеза в растворе позволяет получать практически любые количества модифицированных димеров. Так как ключевое соединение 127 содержит только одну свободную функциональную группу, фосфорилирование с помощью POCl3 с последующей реакцией активного хлорфосфатного производного с пирофосфатом проходит селективно и с высоким выходом.

В некоторых случаях модифицирование динуклеотида может быть осуществлено постсинтетически. Например, введение аминоалкильного остатка по N4-положению цитидина осуществлено с помощью реакции переаминирования трифосфата динуклеотида в присутствии бисульфит-аниона. В случае 2’-амино-2’-дезоксинуклеозидов предшественником аминогруппы являлась азидная группировка, восстановление которой проведено газообразным водородом в присутствии Pd/C после завершения синтеза. С целью расширения ассортимента функциональных групп, присутствующих в 5’трифосфатах динуклеотидов, мы синтезировали соединения с репортерными или реакционноспособными группами (биотин, флюоресцеин, фотоаквируемый пазидотетрафторбензоильный остаток), а также с остатками, имитирующими различные боковые радикалы природных аминокислот.

Как отмечено выше, одним из важнейших применений 5’-трифосфатов модифицированных нуклеозидов является использование так называемых терминаторов синтеза ДНК для секвенирования. В настоящее время для этого обычно применяются 2’,3’-дидезоксинуклеозид-5’-трифосфаты. Синтез дидезоксинуклеозидтрифосфатов, особенно содержащих модифицированные гетероциклические основания с присоединенными репортерными (флуоресцентными) группами, является многостадийным процессом. Вследствие неустойчивости гликозидной связи в таких соединениях выход целевых продуктов обычно низкий.

Принимая во внимание результаты по синтезу модифицированных аналогов нуклеозидов (морфолиновых нуклеозидов, см. раздел 3), а также разработанный нами подход к синтезу 5’-трифосфатов модифицированных олигонуклеотидов, мы решили применить накопленный опыт для синтеза новых трифосфатов морфолиновых нуклеозидов, перспективных для использования в качестве терминаторов в процессе секвенирования ДНК (схема 25). Соединения 131а-г использовали для синтеза флуоресцентно меченных производных.

O O B' B' HO HO Схема B' 1) POCl3, затем HO O 1) NaIO4/EtOH+H2O TFAOEt/TEA [(C4H9)3N]2+H2P2O72N 2) NH2RNH2/H3BO3 N OH OH 2) NH3/H2O.

3) NaBH3CN R R 44, 71а, 78в,г 129а-г NH2 130а-г NH O O O O CFO B O P O P O P O B' = Ura (a), N6-Bz-Ade (б), B = Ura (а), Ade (б), O- O- O N4-Bz-Cyt (в), N2-iBu-Gua (г) Cyt (в), Gua (г) N R = (CH2)3O(CH2)4O(CH2)131а-г R NH––– * ––– Таким образом, в результате исследования выполнены все поставленные задачи, касающиеся осуществления дизайна и разработки подходов к синтезу модифицированных OdN, их аналогов и миметиков НК. Разработанная методология получения модифицированных OdN обеспечивает гибкую стратегию изменения физико-химических свойств природных олигомеров с целью создания новых инструментов молекулярнобиологических исследований.

ВЫВОДЫ Настоящая работа представляет собой систематическое исследование, посвященное разработке комплекса подходов к синтезу модифицированных олигодезоксирибонуклеотидов (OdN), в результате которого создана методология получения модифицированных OdN, в том числе в препаративных количествах.

Предложенная в работе методология позволяет создавать новые инструменты молекулярно-биологических исследований на основе природных и модифицированных OdN.

1. Модернизирована синтетическая база получения 5’-фосфорилированных природных и модифицированных OdN с использованием 5’-фосфо-2’-дезоксинуклеотидов в качестве исходных соединений.

• Разработан новый экономичный и эффективный метод получения 5’фосфорилированных защищённых мономеров. Метод отличается применением временных силильных защитных групп при ацилировании гетероциклических оснований 5’-фосфо-2’дезоксинуклеотидов и новым способом введения п-хлорфенильной защитной группы путем активации 5’-фосфата под действием трифенилфосфина и 2,2’дипиридилдисульфида в присутствии нуклеофильных катализаторов.

• Разработан оригинальный протокол крупномасштабного синтеза 5’фосфорилированных OdN блочным триэфирным методом в растворе. Протокол обеспечивает эффективное протекание стадий деблокирования и конденсации.

• Разработан эффективный препаративный метод получения природных и модифицированных OdN в растворе в рамках триэфирного подхода. Впервые синтезированы серии OdN и их конъюгатов с различными остатками (алкилирующими, гидрофобными, стабилизирующими комплементарные комплексы), а также аналоги OdN, модифицированные по сахарофосфатному остову (фосфотриэфиры и метилфосфонаты) в препаративных количествах.

2. Сформирован комплекс подходов к получению OdN, модифицированных по сахарофосфатному остову и/или по гетероциклическим основаниям. Выбор метода синтеза модифицированных OdN в рамках разработанного комплекса подходов определяется типом вводимых функциональных, модифицирующих, реакционноспособных или репортерных групп и задачами дальнейшего использования производных OdN как инструментов молекулярно-биологических исследований.

Предложенные подходы и методы позволяют получить OdN, модифицированные по любому положению, в том числе обратимо.

• Для модифицирования OdN по 5’- и/или 3’- концам разработан подход к получению конъюгатов 5’-фосфорилированных OdN, основанный на эффективном препаративном варианте синтеза в растворе с помощью триэфирного метода.

Присоединение модифицирующих остатков возможно как в процессе синтеза, так и постсинтетически – с предварительным введением линкерных групп во время синтеза.

• Для получения OdN, модифицированных по любому положению цепи, впервые предложено использовать оригинальные амидофосфитные синтоны, содержащие реакционноспособные метоксиоксалильные группы-предшественники, присоединенные по гетероциклическим основаниям или по углеводному остатку нуклеозида. В препаративном варианте триэфирного метода синтеза в растворе использованы нуклеозиды, содержащие присоединенные к гетероциклическому основанию или к углеводному остатку защищённые аминоалкильные группы или предшественник (азидогруппу).

• Разработан подход к обратимому модифицированию OdN по концам олигомера и внутри цепи с использованием новых фотолабильных линкерных групп, содержащих онитробензильный фрагмент. Линкерные группы присоединяли по концевой фосфатной группе или по гетероциклическому основанию. Показано, что при облучении конъюгатов OdN, полученных с помощью этих линкеров, и их комплексов с биополимерами возможно освобождение немодифицированного олигомера или репортерного остатка в зависимости от дизайна линкерной группы.

• Предложен новый подход к обратимому блокированию межнуклеотидных фосфатных групп OdN, заключающийся в применении фотолабильных фосфотриэфирных аналогов OdN, содержащих о-нитробензильный фрагмент. Разработан метод синтеза новых триэфирных фотолабильных аналогов OdN в растворе. Получены новые амидофосфитные синтоны для синтеза соответствующих производных на полимерном носителе.

3. Комплекс подходов к получению модифицированных OdN, сформированный в настоящей работе, позволяет осуществить дизайн и синтез новых производных ди- и олигонуклеотидов, перспективных в качестве инструментов молекулярно-биологических исследований.

• Впервые получены конъюгаты OdN с хромонами, кумаринами и фталоцианинами, перспективными соединениями для использования в качестве репортерных (хромоны, кумарины) и реакционоспособных (фталоцианины) остатков. Эти конъюгаты образуют комплементарные комплексы с повышенной по сравнению с немодифицированными дуплексами термостабильностью.

• Получены конъюгаты OdN, содержащие новые фотолабильные линкерные группы. Впервые получены фотолабильные фосфотриэфирные аналоги OdN. Определены условия расщепления новых фотолабильных производных OdN и их комплексов с биополимерами в растворе и на полимерном носителе.

• Разработан новый эффективный метод синтеза 5’-трифосфатов динуклеотидов с использованием 5’-монофосфорилированных димеров в качестве исходных соединений и активации 5’-монофосфата под действием трифенилфосфина и 2,2’-дипиридилдисульфида в присутствии нуклеофильных катализаторов.

• Разработан новый подход к получению 5’-трифосфатов модифицированных моно- и динуклеотидов, заключающийся в синтезе в растворе нуклеозидной части молекулы, содержащей необходимые модификации и защитные группы, последующем введении трифосфатного остатка по свободной 5’-гидроксигруппе и в дополнительной постсинтетической обработке в случае необходимости. Созданы серии новых 5’трифосфатов природных и модифицированных динуклеотидов – потенциальных субстратов для ферментов матрично-зависимого синтеза олигонуклеотидов.

• Предложены новые миметики НК на основе морфолиновых аналогов нуклеозидов, соединенных оксалилдиамидными связями. Разработана стратегия синтеза оксалилдиамидных морфолиновых миметиков НК, основанная на существенной разности в реакционных способностях функциональных групп мономеров. Стратегия отличается использованием бифункциональных реагентов и минимально необходимого количества защитных групп.

• Разработаны основанные на методах пептидной химии новые подходы к синтезу N-метилкарбоксамидных морфолиновых олигомеров – протонируемых при физиологических рН миметиков НК. Показано, что аденин-содержащие олигомеры образуют более стабильные комплексы с поли(U), чем природный олигодезоксирибоаденилат такой же длины. Комплексы модифицированных аденинсодержащих олигомеров с поли(U) обладают бльшей термостабильностью в сравнении с поли(Т).

Основные результаты диссертации изложены в следующих работах:

Обзоры 1. Abramova T.V., Kassakin M.F., Silnikov V.N. Novel oligonucleotide analogues based on morpholino nucleoside subunits – Antisense technologies: new chemical possibilities // Ind. J. Chem. 2009. V. 48B. P.

1721-1726.

2. Абрамова Т.В., Сильников В.Н. Синтез и свойства модифицированных по углеводофосфатному остову аналогов олигонуклеотидов и миметиков нуклеиновых кислот // Успехи химии. 2011. Т.80. С.

452-476.

Статьи в научных журналах 3. Подуст Л.М., Гайдамаков С.А., Абрамова Т.В., Власов В.В., Горн В.В., Фёдорова О.С.

Специфичная к последовательности модификация двуцепочечной ДНК олигодезоксирибонуклеотидом рТ(СТ)6 // Биоорг. химия. 1989. Т. 15. № 3. С.363-369.

4. Абрамова Т.В., Комарова Н.И., Мундус Д.А., Перебоева О.С. Эффективный синтез 5’фосфорилированных дезоксирибоолигонуклеотидов в препаративных количествах // Изв. СО АН СССР. 1990. Сер. хим. наук. Вып. 5. С. 45-51.

5. Mazzei M., Balbi A., Grandi T., Sottofattori E., Garzoglio R., Abramova T., Ivanova E. Synthesis in solution of oligonucleotides and some their 5’- and 3’-linked derivatives // Il Farmaco. 1993. V.48. P. 16491661.

6. Покровский А.Г., Плясунова О.А., Блинов В.М., Власов В.В., Свинарчук Ф.П., Абрамова Т.В., Горн В.В., Коневец Д.А. Ингибирование репродукции вируса иммунодефицита человека смысловыми и антисмысловыми олигонуклеотидами // Мол. биология. 1993. Т. 27. С. 1039-1043.

7. Balbi A., Sottofattori E., Grandi T., Mazzei M., Abramova T.V., Lokhov S.G., Lebedev A.V. Synthesis and complementary complex formation properties of oligonucleotides covalently linked to new stabilizing agents // Tetrahedron. 1994. V.50. P. 4009-4018.

8. Mazzei M., Grandi T., Balbi A., Abramova T., Damonte G., Silvestro L. Protected 5-fluoro-2’deoxyuridine monophosphate for solution-phase synthesis of oligonucleotides // Il Farmaco. 1994. V. 49. P.

793-797.

9. Абрамова Т.В., Бугреев Д.В., Добриков М.И., Леблё Б., Леонетти Ж.-П. Фотолабильный линкер для обратимого введения лигандов в олигонуклеотиды // Биоорг. химия. 1999. Т. 25. С. 195-202.

10. Abramova T., Ivanova T., Koval V., Fedorova O. Synthesis of new oligonucleotide derivatives with porphyrins and phtalocyanins // Nucleosides Nucleotides. 1999. V. 18. P. 1515-1516.

11. Абрамова Т.В., Леонетти Ж.-П., Власов В.В., Леблё Б. Синтез и свойства блокированных фотолабильными группами фосфотриэфирных производных динуклеозидфосфатов // Биоорг. химия.

2000. Т. 26. С. 197-205.

12. Карягин А.Ю., Абрамова Т.В., Сильников В.Н., Шишкин Г.В. Реагенты для направленной модификации биополимеров. Сообщение 11. Синтез N-Im-2,4-динитрофенильных производных гистидина, урокановой и имидазолилуксусной кислот для введения остатков имидазола в олигонуклеотиды // Изв. РАН. Сер. хим. 2000. № 3. С. 536-541.

13. Коваль В.В., Черноносов А.А., Абрамова Т.В., Иванова Т.М., Федорова О.С., Кнорре Д.Г. Синтез конъюгата тетракарбоксифталоцианина кобальта (II) с дезоксирибоолигонуклеотидом, реагента для направленной модификации ДНК // Биоорг. химия. 2000. Т. 26. С. 118-125.

14. Koval V.V., Chernonosov A.A., Abramova T.V., Ivanova T.M., Fedorova O.S., Derkacheva V.M., Lukyanets E.A. Photosensitized and catalytic oxidation of DNA by metallophtalocyanine-oligonucleotide conjugates // Nucleosides Nucleotides Nucleic Acids. 2001. V. 20. P. 1259-1262.

15. Thiviyanathann V., Vyasovkina K.V., Gozansky E.K., Bichenkova E.V., Abramova T.V., Luxon B.A., Lebedev A.V., Gorenstein D.G. Structure of hybrid backbone methylphosphonate DNA-heteroduplexes:

effect of R and S stereochemistry // Biochemistry. 2002. V. 41. P. 827-838.

16. Абрамова Т.В., Васильева С.В., Иванова Т.М., Шишкин Г.В., Сильников В.Н. Мономеры для олигонуклеотидного синтеза с линкерами, несущими реакционноспособные остатки. I. Синтез производных дезоксинуклеозидов с метоксиоксалиламидными группами, присоединенными к гетероциклическим основаниям // Биоорг. химия. 2004. Т. 30. С. 254-263.

17. Abramova T.V., Bakharev P.A., Vasilyeva S.V., Silnikov V.N. Synthesis of morpholine nucleosides triphosphates // Tetrahedron Lett. 2004. V. 45. P. 4361-4364.

18. Sottofattori E., Anzaldi M., Mazzei M., Miele M., Balbi A., Pyshnyi D.V., Zakharova O.D., Abramova T.V. Synthesis and hybridization properties of the conjugates of oligonucleotides and stabilization agents.

Part 3 // Bioorg. Med. Chem. 2005. V. 13. P. 1515-1522.

19. Abramova T.V., Silnikov V.N. A photocleavable linker for oligonucleotides containing combinatorial libraries // Nucleosides Nucleotides Nucleic Acids. 2005. V. 24. P. 1333-1343.

20. Васильева С.В., Красноусова Е.Е., Донина А.А., Абрамова Т.В., Жданова Л.Г., Коваленко С.П., Сильников В.Н. Синтез флюоресцентно меченных олигонуклеотидов, несущих метку в 2’-положении модифицированных аденозина и арабиноаденозина // Изв. АН. Сер. хим. 2006. С. 1618-1624.

21. Abramova T.V., Kassakin M.F, Lomzov A.A., Pyshnyi D.V., Silnikov V.N. New oligonucleotide analogues based on morpholine subunits joined by oxalyl diamide tether // Bioorg. Chem. 2007. V. 35. P.

258–275.

22. Abramova T.V., Vasileva S.V., Serpokrylova I.Yu., Kless H., Silnikov V.N. A facile and effective synthesis of dinucleotide 5’-triphosphates // Bioorg. Med. Chem. 2007. V. 15. P. 6549-6555.

23. Abramova T.V., Vasileva S.V., Koroleva L.S., Kasatkina N.S, Silnikov V.N. Design and synthesis of dinucleotide 5’-triphosphates with expanded functionality // Bioorg. Med. Chem. 2008. V. 16. P. 9127–9132.

24. Касакин М.Ф., Абрамова Т.В., Сильников В.Н. Синтез 2’-аминометилморфолиновых аналогов нуклеозидов // Биоорг. химия. 2011. Т. 37. С. 830-835.

Патенты 25. Абрамова Т.В., Васильева С.В., Серпокрылова И.Г., Власов В.В., Сильников В.В. Способ получения солей 5’-трифосфатов дезоксирибо- и рибоолигонуклеотидов. Патент RU 2326888 С1.

Офиц. бюлл. фед. службы по интел. собств., патентам и тов. знакам. № 17, 2008, от 20.06.2008.

26. Абрамова Т.В., Васильева С.В., Королева Л.С., Власов В.В., Сильников В.В. Способ получения солей 5’-трифосфатов природных и модифицированных дезоксирибо- и рибоолигонуклеотидов.

Патент RU 2348643 С1. Офиц. бюлл. фед. службы по интел. собств., патентам и тов. знакам. № 7, от 10.03.2009.

Благодарности Автор посвящает эту работу памяти Ивановой Евгении Михайловны, друга и коллеги.

Считаю своим приятным долгом выразить искреннюю благодарность всем коллегам, верившим в меня и в мой труд.

Отдельная благодарность к.х.н. Лебедеву Александру Васильевичу, к.х.н. Старостину Владимиру Петровичу, д.х.н. Сильникову Владимиру Николаевичу, как моим непосредственным руководителям, учителям и коллегам в разные периоды моей научной деятельности. Академика Дмитрия Георгиевича Кнорре и доктора химических наук Валентину Филипповну Зарытову искренне благодарю за благожелательное внимание и ценные советы при обсуждении работы.

Моим многочисленным коллегам, особенно бывшим и нынешним сотрудникам НИОХ СО АН СССР, НИБХ СО АН СССР, ИХБФМ СО РАН, в соавторстве с которыми получены некоторые данные и написаны научные статьи, химическая часть результатов которых вошла в диссертацию, сердечное спасибо за сотрудничество.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.