WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

Московский Государственный Университет имени М.В.Ломоносова

Биологический факультет

На правах рукописи

Еланский Сергей Николаевич

ВИДОВОЙ СОСТАВ И СТРУКТУРА ПОПУЛЯЦИЙ ВОЗБУДИТЕЛЕЙ ФИТОФТОРОЗА И АЛЬТЕРНАРИОЗА КАРТОФЕЛЯ И ТОМАТА

03.02.12 – «Микология»

Автореферат диссертации на соискание ученой степени

доктора биологических наук

Москва

2012

Работа выполнена на кафедре микологии и альгологии Биологического факультета МГУ имени М.В. Ломоносова

Научный консультант:  доктор биологических наук

Дьяков Юрий Таричанович

Официальные оппоненты: доктор биологических наук

  Ткаченко Олег Борисович

  доктор биологических наук

  Джалилов Февзи Сеид-Умерович

доктор биологических наук,

академик Россельхозакадемии

Левитин Марк Михайлович

Ведущая организация: ГНУ Татарский научно-исследовательский

институт сельского хозяйства

Россельхозакадемии

Защита диссертации состоится 09 ноября 2012 года в 15 часов 30 минут на заседании Диссертационного совета Д. 501.001.46 Биологического факультета МГУ имени М.В. Ломоносова по адресу: 119991, Москва, ГСП-1, Ленинские горы, МГУ, д. 1, стр. 12. Факс (495) 939-39-70.

С диссертацией можно ознакомиться в библиотеке Биологического факультета МГУ имени М.В. Ломоносова.

Автореферат разослан  «____» ____________ 2012 года.

Ученый секретарь

диссертационного совета,

к.б.н. М.А. Гусаковская



Актуальность темы. Оомицет Phytophthora infestans (Mont.) de Bary и несовершенные грибы из рода Alternaria – возбудители фитофтороза и альтернариоза, опасных заболеваний картофеля и томата. Потери урожая картофеля от этих заболеваний за счет преждевременного отмирания ботвы, поражения плодов и клубней во время вегетации и при хранении в среднем составляют около 10%, но в эпифитотийные годы могут возрастать до 30% и более. Потери томата в случае эпифитотийного развития и массового поражения созревающих плодов могут достигать 100%. Борьба с фитофторозом и альтернариозом осложняется очень высокой изменчивостью их возбудителей, позволяющей им быстро приспосабливаться к новым устойчивым сортам растений и к новым фунгицидам. Полностью устойчивых к этим заболеваниям сортов картофеля и томата не существует.

Основой защиты всех возделываемых сортов картофеля и томата является использование химических фунгицидов. Однако мероприятия химической защиты могут быть эффективны только в том случае, если в популяциях возбудителей нет (или очень небольшая доля) высокоустойчивых к используемым фунгицидам штаммов. Для оптимального расчета сроков и кратности применения фунгицидных препаратов необходимо знать устойчивость выращиваемых сортов к распространенным на данной территории штаммам возбудителей. Сведения о клональной структуре популяций (моно- или поликлональная, панмиксная) позволят оценить риск инвазии особо опасных штаммов и клональных линий патогенов (например, их завоз из-за рубежа или из других регионов с партиями семенного картофеля). Вопрос о возможности прохождения в популяции полового процесса особенно важен в борьбе с фитофторозом, т.к. половые споры оомицета (ооспоры) способны длительное время сохраняться в почве и инициировать начало эпифитотий. Для того, чтобы защитные мероприятия были эффективны, необходим постоянный мониторинг структуры популяций возбудителей фитофтороза и альтернариоза.

В последнее время вопросы защиты картофеля от болезней стали особенно актуальными в связи с тем, что эта культура рассматривается как одна из самых перспективных технических культур. Кроме переработки на картофелепродукты (чипсы, замороженный картофель, крахмал, картофельная мука) картофель может быть использован для получения этилового спирта, глюкозы, сахарных сиропов, красителей, антиоксидантов и других веществ. При этом развитие грибных заболеваний вызывает изменение химического состава клубней, что делает их непригодными для переработки.

Целью работы было изучение видового состава и структуры российских популяций возбудителей фитофтороза и альтернариоза картофеля и томата.

В качестве основных задач были определены следующие:

— изучение генотипического состава популяций P. infestans на основе независимых маркерных признаков: тип спаривания, спектр изоферментов пептидазы, гаплотипы митохондриальной ДНК, структура генома;

— оценка хозяйственно-важных биологических показателей штаммов P. infestans: устойчивость к фунгицидам, вирулентность к сортам картофеля и томата;

— исследование закономерностей образования ооспор P. infestans в агроценозах на разных растениях-хозяевах;

— определение видового состава возбудителей альтернариоза картофеля и томата, разработка метода экспресс-идентификации наиболее распространенных видов, изучение устойчивости изолятов Alternaria sp. к фунгицидам.

Научная новизна. В настоящей работе обобщены результаты исследований, проведенных автором в период с 1993 по 2011 годы. Впервые проведен анализ структуры популяций P. infestans на территории России с помощью признанного в мировой практике набора независимых маркерных признаков. Выявлены различия в клональной структуре популяций Европейской и Азиатско-Дальневосточной частей России. Исследовано распределение типов спаривания, определены некоторые закономерности образования ооспор в пораженных органах картофеля и томата. Для изучения структуры популяций впервые использованы такие новые маркерные признаки, как локус пептидазы Pep 2 и полиморфизм участков генома, расположенных между ретропазонами SINE. Исследовано поражение диких видов томата фитофторозом в Московской области, изучены изменения агрессивности при реципрокных заражениях картофеля и томата.

В работе исследован видовой состав возбудителей альтернариоза картофеля и томата из разных регионов России по морфологическим и молекулярно-генетическим (последовательность нуклеотидов участков ядерных и митохондриальных рибосомных генов) характеристикам. На основе полученных последовательностей нуклеотидов созданы ПЦР-праймеры и отработаны методы идентификации видового состава возбудителей альтернариоза в пораженном листе без выделения изолята в чистую культуру.

Исследована устойчивость возбудителей фитофтороза и альтернариоза из разных регионов к некоторым широко используемым фунгицидам.

Теоретическое значение работы. В работе изучены разные в таксономическом и эколого-трофическом планах группы организмов: биотрофный паразит оомицет и некротрофные паразиты – аскомицетные грибы, паразитирующие на одних и тех же растениях – картофеле и томате.

Исследования P. infestans показали, что процессы внутривидовой эволюции при паразитировании на разных растениях, первоначально показывавшие тенденции дивергенции популяций, впоследствии привели к возникновению единой популяции с высокой агрессивностью к обоим видам. Возможной причиной появления подобной популяции является половой процесс, о протекании которого во многих исследованных популяциях свидетельствуют выявленные в работе высокое генотипическое разнообразие в популяциях Европейской части России, присутствие штаммов обоих типов спаривания и ооспор в пораженных фитофторозом образцах.

Исследования возбудителей альтернариоза выявили изменения в видовом составе возбудителей. Так, отмечено практически повсеместное на европейской части России преобладание мелкоспоровых Alternaria как на картофеле, так и на томате. Возможно, это связано с частым применением манкоцеб-содержащих фунгицидов, более эффективных по отношению к крупноспоровым видам.

Практическое значение работы. В результате исследований собрана коллекция чистых культур возбудителей фитофтороза и альтернариоза картофеля и томата из разных регионов России, которая может быть использована при оценке сортов и селекционного материала на устойчивость к фитофторозу и альтернариозу. Изучена устойчивость возбудителей из разных регионов к некоторым зарегистрированным в России фунгицидам, что используется при планировании мероприятий по защите картофеля в этих регионах. Разработан метод ПЦР-идентификации видового состава возбудителей альтернариоза в пораженных образцах, не требующий выделения изолятов в чистую культуру. Метод имеет практическую ценность, т.к. виды Alternaria отличаются по устойчивости к некоторым применяемым фунгицидам и по агрессивности к сортам растений-хозяев. Материалы диссертации используются в лекциях по фитопатологии и спецкурсах кафедры микологии и альгологии Биологического факультета МГУ имени М.В. Ломоносова, кафедры защиты растений РГАУ-МСХА имени К.А. Тимирязева.

Основные положения, выносимые на защиту.

  1. На территории России присутствуют популяции P. infestans разной клональной структуры. В Европейской части и на картофеле, и на томате встречаются все виды популяций: моно- и поликлональные, панмиксные. В Сибири и на Дальнем Востоке преобладают моноклональные, иногда встречаются поликлональные популяции.
  2. Отмечаемое практически повсеместно в Европейской части России высокое генотипическое разнообразие может объясняться гибридизацией при половом процессе. В пользу прохождения полового процесса свидетельствует присутствие в популяциях штаммов с разными типами спаривания и ооспор в пораженных фитофторозом растительных образцах.
  3. Исследованные изоляты P. infestans с картофеля и томата из разных регионов России и Беларуси были чувствительны к большинству используемых против них фунгицидов. Наиболее эффективными оказались азоксистробин и диметоморф. Штаммы с высокой устойчивостью к металаксилу были выявлены в Московской, Смоленской, Тульской областях, в Сибири и на Дальнем Востоке. Изоляты со средним уровнем устойчивости были обнаружены в большинстве популяций европейской части России и Беларуси.
  4. В пораженных листьях картофеля и томата с помощью молекулярно-генетического анализа выявлены виды A. solani, A. infectoria и комплекс мелкоспоровых видов. Мелкоспоровые виды, выделяемые по результатам морфологического анализа (A. alternata, A. tenuissima, A. arborescens), по структуре генома разделить не удалось.
  5. Оценка устойчивости изолятов Alternaria sp., выделенных с картофеля и томата, к фунгицидам, показала, что наиболее эффективными были дифеноконазол и флудиоксонил. Хороший эффект был также отмечен у манкоцеба и флуазинама, причем манкоцеб действовал значительно лучше в отношении A. solani, чем мелкоспоровых видов. Слабой эффективностью отличались азоксистробин и хлороталонил. Мутации G143A, обусловливающей устойчивость мелкоспоровых видов рода Alternaria к азоксистробину в странах Европы и в США, у российских мелкоспоровых устойчивых изолятов не было выявлено.

Личный вклад автора. В настоящей работе приведены результаты, полученные лично автором, при выполнении работ под его руководством или в рамках совместной деятельности. Автором осуществлялась постановка проблемы и методическая разработка путей ее решения, планирование и проведение исследований, обработка, систематизация и интерпретация полученных данных, апробация и публикация результатов. Доля личного участия в публикациях, выполненных в соавторстве, пропорциональна числу соавторов.

Апробация работы. Основные положения и материалы работы были представлены и обсуждены на региональных, всероссийских и международных конференциях, совещаниях и съездах: Международная конференция «Современные проблемы микологии, альгологии и фитопатологии» (Москва, 1998), Международная конференция «Микология и криптогамная ботаника в России» (С.-Петербург, 2000), Научно-практическая конференция «Научное обеспечение картофелеводства России: состояние, проблемы» (Москва, 2001), Первый съезд микологов России (Москва, 2002), The 7-th International Mycological Congress (Oslo, 2002), The 7th International Congress on Aerobiology (Montreal, 2002), Первый всероссийский конгресс по медицинской микологии (Москва, 2003), Первая всероссийская конференция по иммунитету растений к болезням и вредителям (С.-Петербург, 2002), Международная научная конференция «Биология, систематика и экология грибов в природных экосистемах и агрофитоценозах» (Минск, 2004), III съезд ВОГиС «Генетика в 21 веке: современное состояние и проблемы развития» (Москва, 2004), Международная конференция «Грибы в природных и антропогенных экосистемах» (С.-Петербург, 2005), Международная конференция «Грибы и водоросли в биоценозах – 2006» (Москва, 2006), Международный конгресс «Картофель. Россия. 2007» (Москва, 2007), XV Congress of European Mycologists (С.-Петербург, 2007), Второй съезд микологов России (Москва, 2008), Вторая Всероссийская конференция «Современные проблемы иммунитета растений к вредным организмам» (С.-Петербург, 2008), Научно-практическая конференция «Актуальные проблемы современной индустрии производства картофеля (Картофель-2010)» (Чебоксары, 2010), Международная научно-практическая конференция «Теоретические и прикладные аспекты современной фитопатологии и иммунитета растений» (Минск, 2011), 13-th Euroblight workshop (С.-Петербург, 2011) и других.

Публикации. По материалам диссертации опубликовано 107 печатных работ, из них 18 статей в журналах из списка ВАК, 28 – в других периодических изданиях и сборниках, 1 патент, 2 – соавторство в монографиях, 58 – тезисы и материалы конференций.

Объем и структура диссертации. Диссертация изложена на 325 страницах, содержит 46 рисунков и 76 таблиц и состоит из введения, обзора литературы, описания материалов и методов, изложения результатов и обсуждения собственных исследований, заключения, выводов, списка публикаций автора по теме диссертации и списка цитированной литературы. Библиография включает 238 литературных источников, из них 164 – иностранных.

Благодарности. Автор выражает глубокую благодарность проф. Ю.Т. Дьякову за консультации, всестороннюю поддержку, помощь на всех этапах выполнения и написания работы, а также проф. А.Н.Смирнову, проф. W.E.Fry и к.б.н. А.В.Филиппову за помощь в работе, организации исследований, освоении технологий и интерпретации данных. Отдельная благодарность сотрудникам, студентам и аспирантам Биологического факультета МГУ имени М.В.Ломоносова, РГАУ-МСХА им. К.А.Тимирязева, ВНИИ фитопатологии, ВНИИ картофельного хозяйства имени А.Г.Лорха, ВНИИ овощеводства и других организаций, в разное время принимавших участие в совместных работах по теме диссертациии: М.А.Побединской, Л.Ю.Кокаевой, Е.Д.Мыце, А.В.Долговой, С.Ф.Багировой, C.Smart, M.D.Coffey, А.С.Кравцову, Е.В.Морозовой, Б.Н.Козловскому, И.Н.Козловской, Т.И.Сметаниной, С.Спиглазовой, Т.А.Терешонковой, Н.Стацюк, М.А.Кузнецовой, М.К.Деревягиной, В.Н.Зейруку, К.А.Пшеченкову, С.А.Кузнецову, В.П.Апрышко, Ф.Х.Аматхановой, Д.И.Милютиной, Я.В.Петруниной, С.А.Шеину, П.Н.Плуталову.  За помощь в сборе образцов автор благодарит А.В.Николаева, З.З.Салихову, З.Сташевски, Ш.Б.Байрамбекова, К.О.Бутенко, А.В.Биткова.

Глава 1. Обзор литературы.

В обзоре литературы представлены описания цикла развития возбудителя фитофтороза, методы изучения генотипической структуры популяций, проведен сравнительный анализ маркеров, применяемых для популяционных исследований, обобщены исследования, касающиеся динамики генотипического состава популяций. Особое внимание уделено методам борьбы с этим заболеванием, используемым для борьбы с ним химическим фунгицидам, механизмам возникновения устойчивости к препаратам.

Отдельный раздел главы 1 посвящен исследованиям возбудителя альтернариоза. В нем обсуждается систематика рода и проблемы, возникающие при классификации видов рода Alternaria, паразитирующих на картофеле и томате. Описано развитие заболевания на картофеле и томате и биологические особенности вызывающих его видов гриба. Особое внимание уделено использованию молекулярных методов исследований в таксономии рода Alternaria.

Глава 2. Материалы и методы.

Сбор пораженных образцов и выделение изолятов в чистую культуру.

Пораженные фитофторозом и альтернариозом образцы собирали с растений (1 - 2 образца на одно растение), отстоящих друг от друга на расстояние не менее 1 (огороды) или 3 метров (крупные поля). Выделение изолятов в чистую культуру проводили с использованием влажных камер. После появления спороношения на поверхности пораженного органа его микроскопировали под бинокулярным микроскопом и остро заточенной препаровальной иглой, смоченной в агаризованной среде, переносили конидии, отличающиеся по морфологии, на агаризованную овсяную среду (для выделения Alternaria использовали также сусло-агар) с добавлением пенициллина (1000 ед/мл) и инкубировали до тех пор, пока диаметр колонии не достигал 4-5 см, после чего кусочек мицелия с края колонии переносили на другую чашку со средой.

За период с 1991 по 2011 годы в чистую культуру были выделены 3358 изолятов P. infestans из 210 полевых популяций России и Беларуси. Изоляты из Сахалина, Ленинградской, Тульской, Новгородской, Мурманской, Брянской, Ярославской областей были переданы сотрудниками Лаборатории грибных болезней картофеля и овощных культур ВНИИ фитопатологии, Белорусские штаммы – Центром картофелеводства и плодоовощеводства республики Беларусь. В сборе пораженных образцов и выделении изолятов в чистую культуру принимали участие М.А. Побединская, А.В. Филиппов, Т.И. Уланова, В.П. Апрышко, А.Н. Смирнов, А.С. Кравцов, Ф.Х. Аматханова, С.А. Кузнецов, Я.В. Петрунина, Д.И. Милютина, С.Ф. Багирова, А.В. Николаев, Ш.Б. Байрамбеков, З. Сташевски, З.З. Салихова и другие. Выделение изолятов в 1991 – 1994 годах было проведено А.Н. Смирновым.

Изоляты возбудителей альтернариоза были выделены из образцов, собранных в 2007–2010 годах в Ленинградской, Московской, Астраханской, Костромской, Смоленской областях, в Марий Эл и Татарстане. Изоляты из Ставропольского края были переданы сотрудниками лаборатории грибных болезней картофеля и овощных культур ВНИИ фитопатологии; штаммы A. solani, собранные на Дальнем Востоке, часть штаммов из Ленинградской области, а также референтные штаммы, необходимые для уточнения идентификации видов, – сотрудниками лаборатории микологии и фитопатологии ВНИИ защиты растений. Всего в работе использовано 311 изолятов разных видов рода Alternaria из разных регионов.

Оценка устойчивости к фунгицидам проводилась на агаризованной овсяной (сусло-агар – для Alternaria) среде с добавлением фунгицида в концентрациях 0,1; 1; 10; 100 и 1000 мкг/мл и на среде без фунгицида (контроль). Эксперименты проводили в трёх повторностях. Для каждого изолята определяли показатель EC50 (50% эффективной концентрации), т.е. концентрацию фунгицида, необходимую для замедления скорости радиального прироста колонии в 2 раза относительно бесфунгицидного контроля.

Определение типов спаривания у P. infestans проводили методом попарного сращивания исследуемых изолятов на овсяной агаризованной среде с тестерными штаммами с известными типами спаривания. Чашки инкубировали в темноте при 18°С в течение 14 дней, после чего определяли наличие или отсутствие ооспор в месте контакта гиф между штаммами с помощью светового микроскопа. Если исследуемый изолят образовывал ооспоры c тестером А2 и не образовывал их с тестером А1, то его относили к типу спаривания А1, если наоборот – то к А2. Штаммы, образующие ооспоры с обоими тестерами, относили к группе А1А2, а не образующие ни с одним – к группе 00.

Оценка вирулентности изолятов. Для идентификации генов вирулентности P. infestans использовали тест-набор, полученный из Международного картофельного центра (CIP, Перу). Для тестов отбирали листья из среднего яруса возрастом 6-8 недель. Листовые пластинки помещали во влажные камеры нижней стороной вверх и инокулировали суспензией зооспорангиев с концентрацией 0,5-1,5 Х 105 шт/мл, после чего листья инкубировали при температуре 18єС и фотопериодизме свет/темнота=16ч/8ч. Результаты учитывали через 5-6 дней после инокуляции. В каждом эксперименте в качестве контроля использовали не имеющий R-генов генотип картофеля 702514. Эксперимент считали удачным только в том случае, если при заражении 702514 были получены большие, спорулирующие пятна заражения. В качестве положительного результата учитывали только спорулирующие пятна диаметром более 5 мм. Если штамм давал на тестируемых листьях очень мелкие пятна или некрозы без спороношения, либо не было никаких видимых симптомов заражения, результат считали отрицательным. Все эксперименты проводили в 3-х повторностях.

Морфологическое определение видовой принадлежности изолятов Alternaria проводили по методике, предложенной Симмонсом (Simmons, 1992, 2007). При определении учитывались следующие признаки: наличие и тип ветвления конидий (у апекса и у основания), поверхность спор и др. Изоляты выращивали в стеклянных чашках Петри на картофельно-морковном агаре (КМА) при 25°С и естественном фотопериодизме. На 7-10 день роста колонии микроскопировали, описывали особенности формирования конидиальных цепочек и морфологию спор.

В случае отсутствия конидиальных спороношений у A. solani колонии подвергали воздействию УФ-излучения в течение 180 сек. (лампа Mineralight (2х30 Вт), модель CS-215, производство Ultra-Violet Products, Inc.; длина волны 260 нм, расстояние от ламп до культуры 7 см.). После этого чашки инкубировали при комнатной температуре в течение 3–5 суток в условиях естественного освещения.

Исследование спектра изоферментов пептидазы и глюкозо-6-фосфат изомеразы. Мицелий наращивали в чашках Петри с жидкой гороховой средой. Спектр изоферментов определяли на целлюлозоацетатных гелях согласно рекомендации производителя Helena Laboratories Inc. (Hebert, Beaton, 1993). В исследовании учитывали генотипы изолятов по двум локусам пептидазы Pep1 и Pep2 и по локусу GPI1 глюкозо-6-фосфат изомеразы.

Выделение ДНК. Мицелий, выращенный в чашках с жидкой гороховой средой, растирали в жидком азоте, после чего лизировали в СTAB–буфере. Очистку от белков проводили с использованием хлороформа. После выделения ДНК из пораженной растительной ткани проводили определение концентрации ДНК в растворе на спектрофотометре «Specord 50» (фирмы “Analyticjena”, Германия). После определения концентрацию ДНК доводили до значения 4 нг/мкл. Хранили выделенную ДНК в деионизованной воде при –20єС.

Гаплотипы митохондриальной ДНК идентифицировали согласно методике, разработанной Griffith и Shaw (1998). Продукты амплификации разделяли в 0,8% агарозном геле, продукты рестрикции – в 1,5%. Гели готовили на трис-боратном буфере с добавлением бромистого этидия.

Проведение ПЦР для амплификации региона, предназначенного для секвенирования. Амплификацию проводили в амплификаторе «Biometra T1» по следующей программе: 95 °C, 3 мин.; 25 циклов: 94 °C, 40 сек., температура отжига указанная в таблице 1, 40 сек., 72 °C , 60 сек.; конечная элонгация 72 °C, 3 мин. Для амплификации специфичных участков ДНК использовали праймеры, приведенные в таблице 1.

Конечный объем реакционной смеси составлял 25 мкл и содержал 2,5 мкл 10x PCR buffer (Helicon), 2 мкл 25mM MgCl2, 0,5 мкл Taq-полимеразы (5 ед/мкл), 2 мкл dNTP mix (содержащей по 0,2 mM каждого dNTP), по 4пмоль каждого праймера, 1 мкл раствора ДНК. Объем смеси доводили деионизированной водой до 25 мкл.

Таблица 1.

Праймеры, использованные в работе.

Назва-ние

Последовательность ДНК

Ссылка

Температура отжига, C

Регион ядерных рибосомных генов (для P. infestans)

ITS6

ITS4

5’-GAGGGACTTTTGGGTAATCA

5'-TCCTCCGCTTATTGATATGC

Cooke et al., 2000

White et al., 1990

55

Регион ядерных рибосомных генов (для Alternaria sp.)

ITS5

ITS4

5'-GGAAGTAAAAGTCGTAACAAGG

5'-TCCTCCGCTTATTGATATGC

White et al., 1990

White et al., 1990

58

Регион большой субъединица (mt LSU) митохондриальных рибосомных генов

(для Alternaria sp.)

ML1

MLR1

5'-GTACTTTTGCATAATGGGTCAGC

5'-GCCCTTCCGAGAGCAAATAC

White et al., 1990

Peever et al., 2004

52

Секвенирование. ПЦР-продукт вырезали из геля (1,2% на TBE буфере) после электрофоретического разделения, после чего из него выделяли фрагмент ДНК с использованием набора «Цитокин». Секвенирование ДНК проводилось компанией «Евроген» с помощью набора реактивов BigDye®Terminator v3.1 Cycle Sequencing, с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК Applied Biosystems 3730 xl. В качестве праймеров для секвенирования использовались те же праймеры, по которым проводилась амплификация исследуемого участка. Чтение каждой последовательности проводили 2 раза – с прямого и обратного праймеров. Все полученные при секвенировании нуклеотидные последовательности ДНК исследуемых изолятов были объединены в базу данных, использованную при реконструкции таксономических взаимоотношений, которые осуществлялись с помощью программы Mega методом максимального правдоподобия (Maximum likelihood).

Проведение интер-SINE-ПЦР. Праймер (100 пмоль) метили с помощью [γ32P]-ATP (1МБк) и полинуклеотидкиназы. ПЦР проводили в объеме 20 мкл реакционной смеси, содержащей стандартный Taq-буфер (50 mМ KCl, 10 mM  буферTris-HCl, pH 8.3, 2.5 mM MgCl2  и 0.001% желатин), 0.2 mM dNTP, 4пмоль каждого праймера, 1 ед. Taq-полимеразы и 25 нг геномной ДНК. Программа ПЦР: денатурация – 95єС, 1 мин.; отжиг – 48 єС, 1 мин.; синтез – 72 єС, 1 мин. Число циклов – 30. Предварительная денатурация продолжалась 5 мин. при 95єС; конечный синтез – 5 мин. при 72єС. Эксперименты выполняли на термоциклере Biometra T1. Продукты ПЦР денатурировали и разделяли с помощью электрофореза в 6%-ом полиакриламидном геле размером 50х28х0,4мм, содержащем 0,089 М трис-боратный буфер и 8 М мочевину. Электрофорез проводили в течение 7 часов при постоянной мощности тока 75 Вт. Радиоавтографию проводили, экспонируя высушенный гель с рентгеновской пленкой RETINA в течение 16-48 ч.

Глава 3. Систематическое положение возбудителя фитофтороза картофеля и томата.

Для подтверждения результатов морфологической идентификации P. infestans было проведено секвенирование участка ДНК, амплифицируемого парой праймеров ITS6 – ITS4, включающего внутренний транскрибируемый спейсер ITS1, участок, кодирующий 5,8S субъединицу рибосомы, а также регион ITS2. Были исследованы 57 изолятов из 17 регионов России. Результаты работы показали, что все исследованные изоляты имели практически идентичные последовательности нуклеотидов, совпадающие с типичными для P. infestans (Cooke et al., 2000). Некоторые штаммы имели незначительные отличия, вызванные ограниченным числом нуклеотидных замен. Таким образом, по данным анализа региона ITS6 – ITS4 показано, что все исследованные изоляты принадлежат к виду P. infestans. В пользу этого свидетельствуют и данные других проведенных анализов: изучения гаплотипов митохондриальной ДНК, анализа спектров изоферментов пептидазы и глюкозо-6-фосфат изомеразы.

Глава 4. Анализ независимых маркерных признаков P. infestans.

4.1. Изучение типов спаривания

За период с 1991 по 2011 годы тип спаривания был определен у 3203 изолятов из 166 полевых популяций. По соотношению штаммов с разными типами спаривания популяции разделились на 2 группы: популяции сибирско-дальневосточного региона, представленные штаммами какого-либо одного типа спаривания, и популяции европейского региона, в состав которых, как правило, входили штаммы с разными типами спаривания. Эта тенденция прослеживалась в популяциях на обоих растениях-хозяевах – картофеле и томате.

Очень высоким генотипическим разнообразием и распределением типов спаривания близким к 1:1 отличались популяции Московской области, Северного Кавказа и Беларуси, а также многие популяции европейской части России. В некоторых популяциях были встречены отдельные изоляты, которые образовывали ооспоры с обоими тестерами (группа А1А2)  или не образовывали ни с одним из тестеров.

Изучение соотношения штаммов P. infestans с разными типами спаривания на одном и том же поле в течение вегетационного сезона показало, что общей тенденцией был рост частоты типа спаривания, соответствующего типу спаривания первичного инокулюма, в начальный период эпифитотии, и его падение в более поздний период (с приближением соотношений типов спаривания к 1:1), как на листьях картофеля, так и на листьях томата.

Самофертильные штаммы. Существуют штаммы P. infеstans, которые при анализе типа спаривания ведут себя как А1 или А2, но через некоторое время хранения на агаризованной среде в монокультуре (обычно около 2-х месяцев) начинают самопроизвольно образовывать ооспоры. Такие изоляты мы называли самофертильными (СФ). Доля таких штаммов различалась год от года; в 1997, 2003 и 2004 годах их доля в популяциях составляла от 21 до 34 %, в 1998, 1999, 2001 и 2006 годах – менее 10%. При сращивании с тестерными штаммами СФ в большинстве случаев вели себя как А2 (табл. 2). После хранения на косяках с овсяным агаром при +4С и нескольких пересевов большинство изолятов теряло способность образовывать ооспоры в монокультуре.

Таблица 2.

Доли самофертильных штаммов среди определенных как А1, А2 и А1А2 в пробах с тестерами.

Год

Проверено изолятов

Доля самофертильных штаммов среди, %:

А1

А2

А1А2

1997

183

6

80

-

2003

387

9

56

100

2004

279

27

39

-

Прим. «–» в 1997 и 2004 годах штаммов группы А1А2 не было.

4.2. Изоферментный анализ.

Традиционно используемые при анализе популяций изоферментные маркеры локус 1 пептидазы и локус 1 глюкозо-6-фосфат изомеразы оказались малопригодными для исследования российских популяций P. infestans из-за низкой вариабельности. Локус 1 глюкозо-6-фосфат изомеразы (GPI1), традиционно используемый в популяционных исследованиях, был исследован у 129 изолятов сборов 1997-1998 годов (Elansky et al, 2001) и у 38 изолятов 2000-2001 годов. Все исследованные штаммы имели один и тот же генотип 100/100 по этому локусу, поэтому дальнейшее тестирование этого локуса посчитали не представляющим интереса. Встречавшаяся ранее аллель 86, характерная для широко распространенного до начала 90-х годов 20 века клона US 1, после 1993 года не выявлялась. Поэтому проводился поиск новых изоферментных маркеров. Была проанализирована вариабельность малик-энзима, малатдегидрогеназы, супероксиддисмутазы (для каждого фермента проанализировали выборку из 20 изолятов, выделенных из разных региональных популяций). Спектры изоферментов этих белков также были мономорфны, что совпадает и с результатами, полученными другими исследователями (Tooley et al., 1985). Достаточно высокий полиморфизм был отмечен у аллозимов второго локуса пептидазы. При электрофорезе на целлюлозоацетатных гелях локус 2 прокрашивается одновременно с локусом 1, что делает этот маркер удобным в работе и недорогим в применении.

Всего на спектр изоферментов пептидазы были исследованы 1195 изолятов, представляющих 99 полевых популяций. В исследуемых популяциях локусы 1 и 2 пептидазы представлены двумя аллелями: 92 и 100 для пептидазы локус 1 (Pep-1), 100 и 112 для пептидазы локус 2 (Pep-2). Генотип Pep-1 92/92  был обнаружен за все время исследований только 2 раза: у изолята, выделенного в 1997 г из картофеля в Москве, и у изолята, выделенного в 2007 году в Беларуси. Чаще всего встречался генотип 100/100, 92/100 – значительно реже.

Больший полиморфизм отмечен у второго локуса пептидазы (Pep-2). В полевых популяциях встречаются часто как гомозиготы 100/100, 112/112, так и гетерозиготы 100/112. Локус 2 пептидазы оказался более информативным, чем локус 1. Так, многие популяции по спектру изоферментов Pep-1 были мономорфны, тогда как анализ Pep-2 позволил выделить в этих популяциях определенные группы. Гетерозигота 100/112 не была выявлена в Костромской области, хотя там были отмечены штаммы как типа спаривания А2 с генотипом 100/100, так и типа спаривания А1 с генотипом 112/112. Это может свидетельствовать об отсутствии полового процесса и гибридизации на исследуемых полях.

В Московской области популяции на картофеле по локусу 1 были мономорфны до 1996 года, а также в 2000 и 2001 годах. В остальные годы (1997, 1998, 2003, 2006, 2008) в подмосковных популяциях наблюдалось разнообразие, связанное с присутствием гетерозиготы 92/100. Усредненные данные за весь период наблюдений (1991 – 2008 годы) показывают, что и на картофеле, и на томате генотип 92/100 присутствовал в 11% образцов. Разнообразие популяций Московской области по 2-му локусу было отмечено во все годы наблюдений (1999-2008). Если обратиться к усредненным многолетним данным за все годы наблюдений, то заметны различия в соотношениях генотипов локуса РЕР2 на картофеле и томате. Соотношение генотипов РЕР2 100/100:100/112:112/112 на картофеле было 69/24/7, а на томате – 24/68/8 соответственно.

Очень высоким разнообразием по всем исследованным маркерным признакам отличались популяции Северного Кавказа. По локусу Pep–2 обнаружены все три возможных аллельных состояния (две гомозиготы и гетерозигота). Анализ соотношения частот аллелей локуса Pep-2 показал, что в популяциях из Кисловодска, Северной Осетии и Ингушетии они находятся в равновесном состоянии, удовлетворяющем уравнению Харди – Вайнберга, что свидетельствует в пользу их панмиксной структуры

4.3. Анализ гаплотипов митохондриальной ДНК.

Гаплотипы мтДНК были исследованы у 899 изолятов из 86 полевых популяций. На территории России и Беларуси были выявлены штаммы с двумя гаплотипами мтДНК: Ia и IIa. Других гаплотипов не было выявлено, хотя на присутствие Ib и IIb были протестированы 120 штаммов из разных регионов, собранные в 1999-2007 годах. Гаплотип Ib, характерный для клональной линии US-1, последний раз обнаруживали в 1993 году на листьях томата. Соотношение гаплотипов Ia и IIa в разных популяциях сильно варьировало. Были обнаружены как популяции, представленные штаммами с обоими гаплотипами в разных соотношениях (таких большинство), так и содержащие изоляты только с гаплотипом Ia либо только с IIa. Усредненые данные за весь период наблюдений (1991 – 2008 годы) в Московской области показали, что соотношение Ia/IIa на картофеле составило 62/38, а на томате 61/39.

4.4. Изучение гетероплазмоза у P. infestans.





Основным отличием гаплотипа II мтДНК от I является присутствие вставки размером 1881 пн. К фрагменту этой вставки длиной 709 пн с помощью программы Oligo были сконструированы праймеры VSFor (5'-GCAGCCCAAATATCTCGAAA) и VSRev (5' GCAATGGCGCATCAATTATT). Условия амплификации: 1x (60 сек. 92С), 30x (25 сек. 92С, 25 сек. 52С, 60 сек. 72С); 1x (180 c. 72С), состав реакционной смеси – как при определении гаплотипов мтДНК. Если в геноме штамма, имеющего тип mtDNA Ia согласно пробе PCR-RFLP, обнаруживали фрагмент вставки, то штамм считали гетероплазматическим, в противном случае – гомоплазматическим.

Для доказательства гетероплазматической природы штаммов, несущих вставку, изолят 3МОБТЛ139, содержащий вставку и имеющий Ia тип mtDNA согласно пробе PCR-RFLP, был расклонирован на 4 монозооспоровых клона. Все они содержали вставку. Далее один из клонов был еще раз расклонирован на 16 изолятов (К1 – К16). Все монозооспорвые клоны и родительский штамм показали тип Ia при тестировании методом PCR-RFLP. Анализ вставки выявил различия в количестве ПЦР-продукта (рис. 1), причем один клон (9) не содержал вставки. Вероятно, в процессе монозооспорового клонирования в этот изолят попали только митохондрии с геномом типа Ia.

Рис. 1. Амплификация вставки (709 пн) у монозооспорового потомства штамма 3МОБТЛ139. Прим.: 1-16 монозооспоровые потомки штамма 3МОБТЛ139.

Наличие гетероплазмонов может затруднить интерпретацию результатов стандартных тестов, проводимых по методу PCR-RFLP. С другой стороны, митохондриальный геном выполняет ряд жизненно важных функций, гетероплазматическое состояние может иметь значение в адаптациях оомицетов.

Глава 5. Генотипический анализ популяций

5.1. Анализ на основании независимых маркерных признаков (тип спаривания, спектр изоферментов пептидазы, тип митохондриальной ДНК).

Анализ взаимного влияния изучаемых маркеров (тип спаривания, Pep 1, Рер 2, тип MtDNA) методом 2 не выявил взаимосвязи между этими признаками (р>0,05) (Пляхневич, Еланский, 2008). Независимость исследуемых маркерных признаков позволила провести генотипический анализ изучаемых изолятов.

Для оценки генотипического разнообразия были выбраны популяции, в которых достаточно большое число штаммов было одновременно исследовано по всем маркерным признакам. Мультилокусные генотипы были определены у 567 изолятов из 19 полевых популяций, выделенных в 2000 – 2009 годах из пораженных фитофторозом образцов, собранных в разных регионах Европейской части России, а также 78 изолятов, выделенных в 2006 – 2007 годах в Беларуси.

В большинстве исследуемых популяций встречались штаммы обоих типов спаривания, разные генотипы по локусам Рер1 и Рер2, два гаплотипа митохондриальной ДНК Ia и IIa и было отмечено высокое генотипическое разнообразие. Наиболее высоким генотипическим разнообразием отличались популяции из Ставропольского края (13 генотипов), Марий Эл (12), Беларуси (12), Московской области (8), Северной Осетии (7). Генетически однородными и, по-видимому, моноклональными, были популяции из Тульской, Ленинградской и Астраханской областей. Остальные популяции (выделенные из образцов, собранных в Вологодской, Рязанской, Костромской, Смоленской областях, в республиках Мордовия и Ингушетия) были представлены штаммами 2-4 генотипов и были, вероятно, поликлональны. Высокое число генотипов штаммов из Беларуси может объясняться тем, что белорусские штаммы были выделены из образцов, собранных в разных точках республики, в то время как все остальные региональные популяции состояли из штаммов, выделенных на одном поле или на нескольких соседствующих частных огородах. Наиболее часто встречающиеся генотипы включали А1 или А2 тип спаривания, Ia или IIa тип митохондриальной ДНК, генотипы 100/100 по локусу Рер1 и 100/100 или 100/112 по Рер2.

Максимальное число генотипов отмечалось в популяциях, соотношение типов спаривания в которых было близко к 1:1. Ранее проведенные исследования (Еланский и др., 1999) также показали увеличение в популяциях генетического разнообразия, вычисленного по изоферментным маркерам, с приближением соотношения А1:А2 к 1:1. Эти данные свидетельствуют о высокой вероятности скрещивания и гибридизации в полевых популяций Европейской части России.

Причины высокого генотипического разнообразия в полевых популяциях могут быть разные: гибридизация при половом процессе, интенсивный обмен семенным материалом невысокого качества, распространение зооспорангиев в атмосфере. По-видимому, все они играют роль в образовании современной структуры популяций возбудителя фитофтороза в России.

5.2. Оценка генотипического разнообразия с использованием INTER-SINE PCR.

Работами некоторых авторов была показана возможность использования коротких диспергированных ядерных элементов (Short Interspersed Nuclear Elements, SINEs) в качестве генетических маркеров, позволяющих получать надежную информацию о филогенезе таксономических групп среднего уровня – семейств и отрядов (Банникова и др., 2002, Kaukinen, Varvio, 1992, Buntjer, 1997). Это возможно благодаря содержанию внутри SINEs–подобных элементов консервативных участков ДНК, к которым можно подобрать ПЦР-праймер. При ПЦР такого типа происходит амплификация фрагментов, расположенных между копиями SINEs. Поскольку SINEs в геноме ориентированы в обоих направлениях, то для анализа достаточно одного праймера на консервативную часть.

В задачи предлагаемой работы, проводимой совместно с О.И. Лавровой, входило проведение  интер-SINE-ПЦР с целью сравнительного анализа изолятов P. infestans из удаленных регионов: Тульская, Рязанская, Московская, Брянская области, в республики Марий Эл, Ингушетия, Северная Осетия, о. Сахалин, Беларусь, а также из коллекции Scotland Crop Research Institute – из Аргентины, Эквадора, Мексики, Дании. В работе использовали праймер revSINE: 5 GGGATCGAACCAGAAGTGACTACGG. ПЦР продукт амплификации тотальной ДНК P. infestans с праймером RevSINE был представлен большим числом полос разного веса. Кластерный анализ бинарных матриц, соответствующих фингерпринтам ДНК, не выявил групп изолятов ни по признаку географического происхождения, ни по растению – хозяину. Достоверно выделялся один изолят  из Сахалина, который отличался и по другим характеристикам – имел самую высокую агрессивность к картофелю, максимально возможное число генов вирулентности к сортам картофеля, уникальный генотип по RG 57 (Elansky et al, 2001).

5.3. Исследования генотипического разнообразия в Московской области, в Сибири и на Дальнем Востоке с использованием гибридизационной пробы RG57.

В 1997-1998 годах были исследованы изоляты P. infestans, выделенные из образцов, собранных А.В. Долговой и А.В. Филипповым вдоль Транссибирской железнодорожной магистрали (Екатеринбург, Омск, Красноярск, Иркутск, Улан-Уде, Чита, Биробиджан, Хабаровск, Владивосток), на острове Сахалин, а также в Московской области (Рузский, Одинцовский районы и в г. Москва), и изоляты из старых коллекций (Московская и Томская области). Все изоляты были проанализированы на набор признаков, традиционно используемых при идентификации клональных линий: тип спаривания, спектр изоферментов пептидазы и глюкозо-6-фосфат изомеразы, тип мт ДНК, фингерпринтинг с гибридизационной пробой RG 57 (25 локусов, Goodwin et al., 1992). Анализ RG57 проводился совместно с C. Smart и W.E. Fry по протоколу, принятому в лаборатории W.E. Fry в Корнельском Университете, (http://www.plantpath.cornell.edu/Fry/Protocols.html).

Анализ генотипов по всему комплексу независимых маркерных признаков был сделан у 70 изолятов. В результате проведенной работы были выявлены сильные различия в структуре популяций сибирско-дальневосточного региона и Московской области. Большинство популяций вдоль Транссиба (Екатеринбург, Омск, Томск, Красноярск, Иркутск, Чита) и с острова Сахалин были представлены штаммами одной клональной линии Sib1 (табл. 3). Во Владивостоке популяция была биклональной, сложенной из штаммов клональных линий Sib1 и Sib3. В окрестностях Биробиджана и Хабаровска популяции были также моноклональными, но представлены штаммами другой клональной линии, Sib2. Штаммы с генотипом Sib2 были отмечены как на картофеле, так и на томате. Все выявленные в азиатской части России штаммы имели гаплотип митохондриальной ДНК IIa.

Популяции Московской области, напротив, отличались очень высоким генотипическим разнообразием. Из 27 протестированных изолятов, собранных в Московской области в 1993-1998 годах, 25 имели уникальные мультилокусные генотипы. Штаммы клональной линии US-1, ранее широко распространенные по всему Земному шару, последний раз были выявлены в 1993 году на листьях томата в Одинцовском р-не Московской области (Смирнов и др., 1996). Интересна клональная линия МО17, мультилокусный генотип которой практически идентичен US1, но имеются отличия в структуре изоферментов первого локуса пептидазы. Вероятно, это объясняется произошедшей мутацией. Штаммы клональной линии Sib1 также выявлялись в значительном числе на полях Московской области в 1993 году, причем все они имели очень высокий уровень устойчивости к металаксилу.

Если сравнить фенотипические признаки штаммов (исследованы вирулентность к сортам картофеля и устойчивость к металаксилу), то заметны сильные вариации этих признаков у штаммов одной клональной линии. Так, среди изолятов с мультилокусным генотипом Sib1 наблюдалась вариабельность как средней вирулентности (от максимально возможной, равной 10, у штаммов Сахалинской популяции, до 6,2 в Омске и 6,4 в Чите), так и устойчивости к металаксилу. По видимому, на проявления устойчивости и вирулентности сильно влияют применение на конкретных полях фунгицидов и наличие генов резистентности у возделываемых сортов картофеля.

Таблица 3.

Мультилокусные генотипы исследованных изолятов.

Клональная линия

Место сбора образцов

ТС

GPI

Pep 1

RG 57 фингерпринт

MtDNA

Число изолятов

Изоляты, выделенные с картофеля

SIB 1

*1

A1

100/100

100/100

1000100011001101000110011

IIa

31

SIB 2

Хабаровск

A2

100/100

100/100

1000100001001101000110011

IIa

5

SIB 3

Владивосток

A1

100/100

100/100

1100101010001101000110011

IIa

1

MO 1

M1*2 (97)

A2

100/100

100/100

1000100011001101000110011

IIa

1

MO 2

M1 (97)

A2

100/100

100/100

1000100001001101000110011

Ia

1

MO 3

M1 (97)

A1

100/100

100/100

1010100001001101000110011

IIa

1

MO 4

M1 (97)

A1

100/100

92/100

1010111011001101000110011

IIa

3

MO 5

M2 (97)

A1

100/100

100/100

1000101001001101010110011

IIa

1

MO 6

M2 (97)

A1

100/100

100/100

1010101001001101000110011

Ia

1

MO 7

M4 (97)

A1

100/100

92/100

1000100011001100000110011

IIa

1

MO 8

M4 (97)

A1

100/100

92/92

1010110001001100000110011

IIa

1

MO 9

M1 (98)

A1

100/100

92/100

1000100001001101000110011

IIa

1

MO 10

M2 (98)

A1

100/100

100/100

1010110000001100000110011

Ia

1

MO 11

M3 (98)

A1

100/100

92/100

1010101001001100000110011

Ia

1

MO 12

M3 (98)

A2

100/100

100/100

1010101001001101000110011

Ia

1

Изоляты, выделенные с томата

SIB 2

Биробиджан

A2

100/100

100/100

1000100001001101000110011

IIa

3

MO 13

M2 (97)

A1

100/100

100/100

1010101000001101000110011

Ia

1

MO 14

M3 (98)

A1

100/100

100/100

0010101001001100000110011

Ia

1

MO 15

M3 (98)

A1

100/100

100/100

0110111001001100010110011

Ia

1

MO 16

M3 (98)

A1

100/100

100/100

1000100000001101000110011

IIa

1

Изоляты из старых коллекций

US 1

M3 (93)

A1

86/100

92/100

1010101011001101000110011

Ib

2

SIB 1

*1

A1

100/100

100/100

1000100011001101000110011

IIa

5

MO 17

M3 (93)

A1

86/100

100/100

1010101011001101000110011

Ib

1

MO 18

M3 (93)

A1

100/100

100/100

1010111001001101000010011

IIa

1

MO 19

M3 (93)

A1

100/100

100/100

1010101000001101010110011

IIa

1

MO 20

M3 (93)

A2

100/100

100/100

1010101000001101000110011

IIa

1

MO 21

M3 (93)

A2

100/100

100/100

1010101000001100010110011

IIa

1

Прим.: *1 – генотип Sib 1 был обнаружен у изолятов из окрестностей городов Омск, Красноярск, Иркутск, Чита, Екатеринбург, Владивосток, с острова Сахалин и из старых сборов (1993 г.) с картофеля в Московской области.

Глава 6. Изучение ооспорообразования в природных популяциях P. infestans

Ооспоры имеют большое значение в инфекционном цикле P. infestans как на картофеле, так и на томате. Они могут служить источником первичной инфекции, способствовать повышению генетической изменчивости и появлению новых форм гриба, в том числе высокопатогенных. Целью настоящего исследования, в котором участвовали А.Н. Смирнов, С.А. Кузнецов, В.П. Апрышко, Ф.Х. Аматханова, было изучение закономерностей образования ооспор в полевых популяциях P. infestans.

Всего на наличие ооспор исследованы 2695 фитофторозных образцов, представляющих 73 полевых популяции. Сборы проведены в 1997, 1999, 2000, 2001, 2003, 2006 и 2007 годах. Ооспоры были обнаружены в пораженных фитофторозом образцах листьев, стеблей и клубней картофеля, листьев и плодов томата, собранных в Московской области, республиках Северного Кавказа, Ставропольском крае, Астраханской области и Марий Эл. Максимальная доля содержащих ооспоры образцов была выявлена среди пораженных плодов томата. Меньшая доля ооспоросодержащих образцов отмечена среди листьев томата и минимальная – среди листьев картофеля (табл. 4).

Таблица 4.

Встречаемость ооспор в пораженных фитофторозом образцах разных органов растений-хозяев (суммарные данные).

Орган растения

Общее число протестированных образцов за 1997-2006 года

Число образцов с ооспорами.

Листья картофеля

1815

115 (6,3%)

Листья томата

255

49 (19,2%)

Плоды томата

360

119 (33%)

Исключительно благоприятные для развития фитофтороза погодные условия 2003 года позволили провести специальное исследование, посвященное изучению встречаемости ооспор в пораженных образцах с одним и несколькими очагами фитофтороза. Было показано, что 31% образцов с 2 и более пятнами содержал ооспоры, в то время как среди образцов с 1 пятном содержали ооспоры лишь 12%. Это свидетельствует в пользу того, что при сильном развитии фитофтороза, когда на листовой пластинке образуется несколько пятен, значительная часть ооспор имеет гибридную природу.

Ооспоры в образцах с одним очагом фитофтороза встречались как в тех полевых популяциях, в которых были выявлены изоляты только одного типа спаривания, так и в тех, из которых выделяли изоляты обоих типов спаривания. Ооспоры были отмечены как в образцах с мицелием P. infestans А1 типа спаривания (13% образцов содержали ооспоры), так и в образцах с типом спаривания А2 (15%). Преимущества в образовании ооспор мицелием какого-либо типа спаривания не было обнаружено. Это представляется интересным фактом, поскольку на агаризованной среде штаммы типа спаривания А2 значительно чаще образовывали ооспоры в монокультуре, чем штаммы А1 (см. раздел 4.1).

Морфология ооспор была различной. В полевых популяциях P. infestans обнаружены ооспоры как типичной морфологии, так и нетипичной (ооспороподобные тела). Первые имели шаровидную форму и средние размеры (от 20 до 40 мкм), последние характеризовались малыми (до 20 мкм) или большими (более 40 мкм) размерами, а также наличием продолговатых оогониев. Антеридии встречались редко. В образцах с одним очагом фитофтороза большинство ооспор имело мелкие размеры.

Глава 7. Устойчивость к фунгицидам.

С.Ф. Багировой были получены мутанты с повышенной устойчивостью к диметоморфу. Летальная концентрация мутантных штаммов выросла с 2 мкг/мл у дикого типа до 6 мкг/мл, показатель ЕС50 – с 0,3 мкг/мл до 2,0 мкг/мл. Полученные мутанты по морфологии колоний, структур мицелия и скорости роста на агаризованной среде не отличались от дикого типа. После повторной обработки раствором НММ были получены 4 мутантных изолята Dm 1B, Dm3B1, F7 и F42, способных расти на среде с концентрацией диметоморфа до 8 мкг/мл. Приобретение устойчивости у этих штаммов сопровождалось нарушением частоты ветвления гиф и редким образованием зооспорангиев неправильной формы.

Через два года культивирования на среде без добавления диметоморфа изоляты с одним мутантным локусом полностью утратили устойчивость. Летальная концентрация двойных мутантов Dm3b1 и F42, первоначально способных расти на концентрации 8 мкг/мл, понизилась до 4 мкг/мл, у Dm1b – до 3 мкг/мл, а F7 полностью утратил устойчивость. Изучение скорости роста на овсяном агаре без фунгицида показало, что утративший резистентность мутант F7 не отличалcя по скорости роста от чувствительного дикого типа К27, а сохранившие устойчивость мутанты F42, Dm3B1 и Dm1B росли значительно медленнее дикого типа.

Устойчивость к диметоморфу была исследована у 240 изолятов P. infestans, выделенных в 1993 – 2003 г.г. из пораженных фитофторозом растений картофеля и томата в 12 регионах России. В опыты были включены изоляты с посадок картофеля на о. Сахалин и в Костромской области, где применяли содержащий диметоморф препарат Акробат-МЦ. Исследования проводились совместно с М.К. Деревягиной, С.Ф. Багировой, Ань Цзянли, Б.Е. Козловским. Все исследованные изоляты были чувствительны к диметоморфу (Деревягина и др. 1999).

Таким образом, устойчивость к диметоморфу является полигенной и аддитивной и не отличается стабильностью. Вероятно, устойчивые изоляты отличаются низкой конкурентоспособностью и после снижения фунгицидного пресса исчезают из популяции.

В 2007-2009 годах была исследована устойчивость к некоторым фунгицидам штаммов P. infestans, выделенных с посадок картофеля и томата в разных регионах европейской части России и Беларуси (табл. 5). Изучение устойчивости к манкоцебу показало, что во всех изученных популяциях преобладали чувствительные штаммы. В большинстве популяций устойчивость штаммов варьировала от 0,5–1 до 22–26 мкг/мл. К хлороталонилу все исследованные изоляты были чувствительны, показатель ЕС50 не превышал 10 мкг/мл (за исключением одного изолята из Минской области с ЕС50 равным 16,75 мкг/мл). Не было выявлено и изолятов, устойчивых к флуазинаму. Самый устойчивый штамм имел показатель ЕС50 равный 30,1 мкг/мл; в большинстве же популяций не выявлялись изоляты с ЕС50  более 7 мкг/мл. Все проверенные изоляты были высокочувствительны к диметоморфу, ни в одной из исследованных популяций не было обнаружено изолятов с ЕС50 более 0,1 мкг/мл. Все исследованные на устойчивость к азоксистробину штаммы были высокочувствительными, их показатель ЕС50 не превышал 0,1 мкг/мл.

Фунгициды сильно различаются по вероятности появления в популяциях устойчивых к ним штаммов. Повышение устойчивости к мультисайтовым фунгицидам происходит медленно, путем ступенчатого мутагенеза. По-видимому, именно благодаря этому обработка манкоцебом, флуазинамом, хлороталонилом и диметоморфом не ведет к появлению высокоустойчивых изолятов и не оказывает существенного влияния на состав популяций.

Исследование устойчивости к манкоцебу не выявило штаммов с уровнем ЕС50, превышающим 31 мкг/мл, хотя в нескольких популяциях были представлены штаммы с близкими значениями этого показателя. Возможно, это пороговое значение, и штаммы с более высокой устойчивостью оказываются нежизнеспособны или неконкурентоспособны в агроценозах.

Отдельно следует сказать об устойчивости к азоксистробину. Во всех протестированных популяциях были обнаружены только высокочувствительные изоляты, хотя по литературным данным риск появления устойчивости к азоксистробину оценивается как высокий (Bartlett et al., 2002). Возможно, это связано с редким применением Квадриса в Европейской части России, т.к. он зарегистрирован только для обработки томата. Мы специально исследовали штаммы, выделенные с коммерческих полей томата в Астраханской области, где применяют азоксистробин и другой стробилуриновый фунгицид крезоксим-метил. Однако и там были обнаружены только высокочувствительные к азоксистробину изоляты. По-видимому, появление устойчивости к азоксистробину у P. infestans является крайне редким событием. В литературных источниках найти сведения об обнаруженных устойчивых к азоксистробину мутантных изолятах нам также не удалось.

Исследование устойчивости к металаксилу показало, что в большинстве исследованных популяций преобладали чувствительные штаммы. Среди изолятов, выделенных из образцов, собранных в Астраханской, Ленинградской областях и в Марий Эл не было найдено ни одного с ЕС50 более 5 мкг/мл.

Таблица 5.

Устойчивости к фунгицидам штаммов из разных регионов России и Беларуси.

Фунги-цид

Регион сбора образцов

Колво протести-рованных изолятов

Вариабельность ЕС50 , мкг/мл

Среднее ЕС50, мкг/мл

Число штаммов с различными ЕС50:

<1

110

10100

>100

Манкоцеб

Московская

23

0,6 – 22,4

5,51

5

16

2

0

Ленинградская

19

0,98 - 26

10,9

1

10

8

0

Смоленская

Костромская

25

0,5 – 25,6

6,48

3

20

2

0

Астраханская

20

0,6 – 18,6

5,31

4

14

2

0

Марий Эл

45

0,5 – 27

8,42

2

30

13

0

Беларусь

57

0,64 – 30,8

10,2

6

31

20

0

Металаксил

Московская

31

0,52 - 398

100,0

14

4

5

8

Ленинградская

12

0,54 – 4,7

2,0

7

5

0

0

Смоленская

48

0,51 – 380,0

168,9

2

2

12

32

Костромская

52

0,51 – 38,75

1,67

44

7

1

0

Астраханская

25

0,51 – 2,85

0,85

22

3

0

0

Марий Эл

47

0,5 – 4

0,76

42

5

0

0

Беларусь

64

0,5 – 151,5

5,5

55

4

2

2

Азоксистробин

Московская

15

0,05 – 0,07

0,05

15

0

0

0

Ленинградская

10

< 0,05

< 0,05

10

0

0

0

Смоленская

10

< 0,05

< 0,05

10

0

0

0

Костромская

14

0,05 – 0,07

0,05

14

0

0

0

Астраханская

10

< 0,05

< 0,05

10

0

0

0

Марий Эл

10

< 0,05

< 0,05

10

0

0

0

Беларусь

27

< 0,05

< 0,05

27

0

0

0

Хлороталонил

Московская

8

0,51 – 0,79

0,6

8

0

0

0

Ленинградская

5

0,53 – 5,5

3,0

2

3

0

0

Смоленская

8

0,64 – 4,95

2,17

4

4

0

0

Костромская

6

0,81 – 11,5

4,48

3

2

1

0

Астраханская

10

0,55 – 5,5

3,18

3

7

0

0

Марий Эл

4

1,82 – 3,45

2,67

0

4

0

0

Беларусь

23

0,69 – 16,75

4,85

3

19

1

0

Флуазинам

Московская

8

0,53 – 5,24

2,03

4

4

0

0

Ленинградская

5

0,59 – 5,34

2,36

2

3

0

0

Смоленская

7

0,52 – 6,83

2,48

4

3

0

0

Костромская

8

0,53 – 5,99

1,7

6

2

0

0

Астраханская

9

0,75 – 4,26

1,92

5

4

0

0

Марий Эл

4

4,21 – 8,43

5,51

0

4

0

0

Беларусь

21

0,5 – 30,12

6,98

3

14

4

0

Диметоморф

Московская

9

0,05 – 0,09

0,06

9

0

0

0

Ленинградская

5

0,05 – 0,07

0,06

5

0

0

0

Смоленская

7

< 0,05

< 0,05

7

0

0

0

Костромская

7

0,05 – 0,06

0,05

7

0

0

0

Астраханская

7

0,05 – 0,09

0,06

7

0

0

0

Марий Эл

5

0,05 – 0,06

0,06

5

0

0

0

Беларусь

34

< 0,05

< 0,05

34

0

0

0

Прим.:— исследования не проводились.

Не было выявлено ни одного изолята с ЕС50 более 40 мкг/мл в Костромской области, хотя в 2009 году специально был проведен сбор с полей, обрабатываемых Ридомил Голд МЦ. Из 64 изолятов, выделенных в разных областях Беларуси с коммерческих посадок картофеля, большей частью обрабатываемых фениламидными фунгицидами, лишь у 5 показатель ЕС50 превышал 10 мкг/мл, а высокоустойчивых (ЕС50 более 100 мкг/мл) из них было только 2. В популяции из Московской области из 31 исследованного изолята у 8 показатель ЕС50 превышал 100 мкг/мл, хотя образцы были собраны с необрабатываемого фунгицидами поля. Наибольшей долей высокоустойчивых изолятов отличалась популяция из Смоленской области.

В целом, как показывают полученные результаты, популяции возбудителя фитофтороза состоят преимущественно из чувствительных к наиболее популярным фунгицидам штаммов, и устойчивость даже самых резистентных изолятов будет с успехом преодолена рекомендованной концентрацией фунгицида в рабочей жидкости. Исключение составляют только изоляты, устойчивые к металаксилу, контроль которых с помощью фениламидных фунгицидов в некоторых регионах (Московская, Смоленская области, Беларусь) может не принести желаемых результатов.

Глава 8. Вирулентность к сортам картофеля и томата.

8.1. Картофельные расы.

В 2000-2003 г. гены вирулентности были исследованы у 550 изолятов. В определении генов вирулентности в разные года участвовали И.Н. Козловская, Т.И. Сметанина, Е.В. Морозова, А.Н. Смирнов, С.А. Кузнецов, Ф.Х. Аматханова, С.Ф. Багирова.

Популяция P. infestans на территории России представлена в основном сложными расами, содержащими 5 – 10 генов вирулентности. В разных популяциях их содержание составляло от 50 до 70 %, и выше. Самая сложная раса 1.2.3.4.5.6.7.8.9.10.11, включающая 11 генов, была идентифицирована в 6 областях РФ (Брянская, Тульская, Тамбовская, Ленинградская, Мурманская области и р. Мордовия), при этом в Тульской и Брянской областях ее содержание  достигало 50 – 57 %. За 2001-2003 годы исследований с высокой частотой в различных популяциях P. infestans отмечены следующие расы: 1.2.3.4.7.8.10.11, 1.2.3.4.6.7.8.10.11, 1.2.3.4.5.6.7.8.10.11, 1.2.3.4.5.6.7.8.9.10.11. Превалировали гены вирулентности 1-4, 7, 8, 10, 11; редко встречались 5, 6, 9. Относительно простые расы идентифицированы только в двух областях  - в Ярославской (раса 3.4) и в Костромской (раса 4.10).

Во всех исследованных популяциях Сибири также были отмечены сложные расы с большим числом генов вирулентности. Чаще всего встречались гены 1, 2, 3, 4, 7, 8, 10, 11. Наиболее редкими были гены 5 и 6. Среднее число генов вирулентности на один изолят составляло от 5,5 (Биробиджан, томат) до 10 (Сахалин, картофель). Максимальное число генов вирулентности было выявлено на Сахалине в моноклональной популяции, представленной штаммами линии Sib 1 (Elansky et al., 2001). Исследование, проведенное на Сахалине позднее (2003 г) показало снижение числа генов вирулентности на изолят. Это совпало и с повышением генотипического разнообразия: популяция в 2003 году уже не была моноклональной.

8.2. Вирулентность к сортам томата

Гены вирулентности к тестерным сортам томатов Талалихин (Ph0, заражается штаммами P. infestans без генов вирулентности (Т0) и с геном Т1), и Оттава (Ph1, штаммами без гена Т1 не заражаются) определена у 521 изолята P. infestans, выделенных из картофеля и томата в 1991-2003 годах. Доля штаммов с геном Т1 (усредненные по году данные) среди выделенных из томата изменялась в промежутке от 34 до 95%, среди выделенных из картофеля – от 0 до 30%. В популяциях, выделенных с картофеля в других регионах, доля штаммов расы Т1 тоже сильно варьировала – от 0 до 97%. Очень высокая доля Т1 отмечена среди изолятов из Тульской обл., но надо отметить что это специфическая популяция – моноклональная, и все штаммы выделены на одном поле со стеблей картофеля в самом начале эпифитотии. Популяции из Тульской области и с о. Сахалин, в которых преобладали штаммы расы Т1, были наиболее агрессивны к картофелю.

Глава 9. Оценка агрессивности при реципрокных заражениях картофеля и томата в лабораторных условиях.

В задачи наших опытов входило изучение возможности селекции патогенных свойств генетически маркированных штаммов P. infestans в течение нескольких вегетативных генераций на листьях картофеля и томата и изучение изменений агрессивности по отношению и к картофелю, и к томату, возникающих при этом. Данная работа проводилась совместно с О.И. Лавровой.

Для опыта использовали монозооспоровые штаммы двух изолятов, выделенных из картофеля и томата в Тульской и Московской областях. Суспензией цистоспор обоих изолятов опрыскивали газоны из листьев картофеля (сорт Санте) и томата (сорт Талалихин), разложенные на смоченной водой фильтровальной бумаге в одинаковых кюветах площадью 0,1 кв.м., закрытых стеклянными крышками для создания в них условий влажной камеры. Инкубировали кюветы в течение 5-7 суток при 19єС и фотопериоде свет/темнота=16/8 до появления видимых симптомов заражения. После этого проводили учет всех очагов фитофтороза, появившихся в кювете, результаты учетов представлены в таблице 6. С одного из листьев производили смыв зооспорангиев, получали зооспоры, которые опять распыляли на листья того же растения (с картофельных – на картофельный газон, с томатных – на томатный). Эта процедура была повторена 4 раза. После 4-х пассажей из очагов фитофтороза на листьях были выделены в чистую культуру изоляты P. infestans. Их характеристики не отличались от характеристик соответствующих исходных изолятов, что показывает отсутствие перезаражения в процессе пассажей.

Из таблицы 6 видно, что результаты данного эксперимента показали, что раса Т0 из картофеля (Т16) исходно (в 1-м пассаже) образовала больше пятен на листьях томата, чем на листьях картофеля, а раса Т1 из томата (1МШаТП2/2) исходно образовала больше пятен на листьях картофеля, чем на листьях томата. Однако в дальнейшем все стало на свои места: скорость роста агрессивности была значительно более высокой на своем хозяине, нежели на чужом, так что после 4-х пассажей раса из картофеля стала более агрессивной для картофеля, чем для томата, а раса из томата – более агрессивной для томата, чем для картофеля.

Результаты пассажей «томатного» изолята на листьях томата и картофельного на листьях картофеля по всем измеренным показателям (агрессивность, величина коэффициента q, скорость роста на искусственной среде) значительно превышали результаты пассажей томатного изолята на листьях картофеля и картофельного на листьях томата.

Таблица 6.

Число пятен некрозов после опрыскивания одинаковым титром споровой суспензии

Номера

пересевов

Т16

1МШаТП2/2

на

картофеле

на

томате

на

картофеле

на

томате

I

75

120

150

92

II

200

213

254

235

II

308

155

265

280

IV

310

245

275

335

Глава 10. Развитие P. infestans на диких Licopersicon hirsutum в Московской области

В 2000 году профессором Калифорнийского университета М.Д. Коффей нам были переданы семена диких высокорослых Licopersicon hirsutum из Южной Америки (Перу), используемых в качестве доноров устойчивости при селекции томата на фитофтороустойчивость в США. Благодаря этому нам представилась возможность изучить поражаемость диких Lycopersicon российскими штаммами возбудителя фитофтороза и, с другой стороны, исследовать штаммы, отселектированные на L. hirsutum в полевых условиях, когда он выращивался среди посадок картофеля и томата. Пораженные фитофторозом образцы L. hirsutum, L. esculentum и S. tuberosum с экспериментального поля были исследованы на присутствие ооспор. В работе, проведенной совместно с Т.И. Улановой, использовали 8 линий диких L. hirsutum.

Тестируемые образцы диких пасленовых показали высокий уровень устойчивости к фитофторозу, но и сильное запаздывание фаз развития по сравнению с культурными томатами. Выделенные с них изоляты P. infestans уступали по агрессивности «томатным», но превосходили картофельные. По вирулентности к сортам картофеля и томата, а также по встречаемости ооспор в листьях, изоляты, выделенные с разных растений-хозяев, не имели существенных отличий.

Глава 11. Возможные механизмы изменчивости популяций P. infestans

Практически все изученные популяции возбудителя фитофтороза в Европейской части России отличались более или менее значительным разнообразием. В этом разделе разобраны механизмы (мутационный процесс, миграции, половая и парасексуальная рекомбинации, интрогрессии генов), которые могли оказать влияние на сложившееся распределение генотипов в Российских популяциях.

Глава 12. Особенности развития фитофтороза в России.

В данной главе рассматривается ситуация с развитием фитофтороза в России, влияние на развитие заболевания первичного инокулюма, сортов растений-хозяев и химических обработок на приусадебных огородах и на полях крупных производителей. Отмечено, что частные огороды являются глобальным «плавильным котлом», в котором в результате обмена генетическим материалом перерабатываются существующие генотипы и появляются абсолютно новые. При этом их селекция проходит в условиях, сильно отличающихся от создаваемых для картофеля в крупных хозяйствах: отсутствие фунгицидного пресса, сортовой выравненности посадок, преобладание растений, пораженных разными формами вирусной и бактериальной инфекции, соседство с томатами и дикими пасленовыми, активное скрещивание и ооспорообразование, возможность для ооспор вызывать возобновление заболевания на следующий год. Все это приводит к очень высокому генотипическому разнообразию приусадебных популяций P. infestans. В условиях эпифитотии на огородах происходит очень быстрое распространение фитофтороза и выброс огромных количеств спор, перелетающих на близлежащие коммерческие посадки. Однако, попав на коммерческие поля с правильной системой агротехники и химзащиты, прилетевшие споры практически не имеют возможности к инициации тяжелой эпидемии на поле, что связано с отсутствием устойчивых к фунгицидам и специализированных к выращиваемому сорту клональных линий патогена.

Глава 13. Изучение возбудителей альтернариоза картофеля и томата.

Видовой состав возбудителей альтернариоза.

Целью работы было изучение видовой структуры возбудителей альтернариоза картофеля и томата, выделенных на территории России, на основании морфологических и молекулярно-генетических маркерных признаков и создание тест-набора для быстрой ПЦР-диагностики видов по структуре генома.

Для идентификации видового состава по структуре генома были взяты образцы ДНК 7 крупноспоровых и 25 мелкоспоровых штаммов, выделенные из картофеля и томата в разных регионах России. Для сравнительного изучения была отобрана последовательность ядерной рДНК, ограниченная праймерами ITS5 и ITS4 (рис. 2). Этот участок исследован у многих видов живых организмов и широко используется для анализа таксономических взаимоотношений.

В результате работы были определены нуклеотидные последовательности исследуемого участка (ITS5 – ITS4) длиной 595 пн для мелкоспоровых, 605 пн для A. solani и 627 пн для A. infectoria.

Рис. 2. Взаиморасположение генов и межгенных последовательностей участка ядерной рДНК и локализация внутри него праймеров ITS5, ITS4, MR и SR.

Исследуемые штаммы распределились на 3 группы (рис. 3).

В первую группу вошли представители всех исследованных мелкоспоровых изолятов, за исключением A. infectoria, включая типовые штаммы A. arborescens и A. tenuissima (последовательности взяты из Генбанка, http://www.ncbi.nlm.nih.gov).

Вторая группа содержала все исследованные крупноспоровые изоляты, включая взятые из Генбанка последовательности типовых штаммов A. tomatophyla и A. solani. Однако штамм A. tomatophyla заметно отличался от других штаммов своей группы. По-видимому, исследованные крупноспоровые штаммы, выделенные с томата, являются не A. tomatophyla, а A. solani (что подтверждается и результатами морфологической диагностики), хотя это и противоречит мнению Симмонса (Simmons, 2007), утверждающего отсутствие вида A. solani на томате. Небольшие отличия имели штаммы A. solani, выделенные с картофеля и томата на Дальнем Востоке.

В третью группу попали изолят A. infectoria, выделенный в Костромской области, типовой изолят из США, переданный сотрудниками лаборатории микологии и фитопатологии ВНИИ защиты растений, а также последовательность типового штамма из Генбанка.

Рис. 3. Дендрограмма, построенная с помощью метода максимального правдоподобия по структуре участка ITS5-ITS4.

Обозначения: Видовая принадлежность по результатам морфологического изучения: A.ALT – A. alternata, A.TEN. – A. tenuissima, A.ARB – A. arborescens, A.SOL – A. solani, A.INF – A. infectoria. Органы растений, с которых проводилось выделение: PL – листья картофеля, TL – листья томата, TF – плоды томата.

Видовая принадлежность используемых в работе изолятов была определена также и по морфологическим признакам. В результате проведенной работы были выявлены штаммы четырёх мелкоспоровых видов: A. alternata, A. tenuissima, A. arborescens и A. infectoria, и одного крупноспорового – A. solani. При исследовании последовательностей ДНК A. solani и A. infectoria попали в соответствующие отдельные группы. Морфологические виды A. alternata, A. tenuissima, A. arborescens различий по структуре генома не имели, в результате чего все они попали в одну группу вместе с типовыми A. arborescens и A. tenuissima.

Сравнение штаммов проводили и по структуре последовательностей ДНК большой субъединицы митохондриальных рибосомальных генов (mtLSU). Дендрограмма, построенная по полученным данным, также позволила разделить проанализированные изоляты на две группы: первая группа – мелкоспоровые штаммы, включая A. infectoria; вторая группа – A. solani. Внутри групп штаммы были практически идентичны.

Таким образом, анализ генома Alternaria показал разделение исследуемых штаммов на три клады: A. solani, A. infectoria и мелкоспоровые. Объединение мелкоспоровых штаммов в одну кладу и их отличие от A. infectoria совпадает с результатами исследований, проведенных на других растениях-хозяевах (Pryor and Lichailides, 2002, Hoog and Horre, 2002).

Глава 14.

Устойчивость возбудителей альтернариоза к фунгицидам

В работе изучены изоляты возбудителей альтернариоза картофеля и томата, выделенные в 2007–2010 годах в Ленинградской, Московской, Астраханской, Костромской, Смоленской областях, в Марий Эл и Татарстане. Всего было выделено в чистую культуру и исследовано 285 изолятов.

Исследование устойчивости изолятов (табл. 7, 8) показало, что наиболее чувствительны они были к фунгицидам флуазинам и дифеноконазол (показатель ЕС50 не превышал 1 мкг/мл). Несколько менее эффективным оказался флудиоксонил (ЕС50 не более 10 мкг/мл). Достаточно эффективным фунгицидом показал себя манкоцеб, устойчивость к которому варьировала для разных изолятов в пределах 6,7–604 мкг/мл. При этом уровни устойчивости к манкоцебу существенно различались для мелкоспоровых видов и A. solani. Согласно данным, представленным в таблицах 9 и 10, среднее значение ЕС50 для мелкоспоровых видов равнялось 128,4 мкг/мл, в то время как для A. solani – 15,5 мкг/мл. Статистическая достоверность отличий подтверждается критерием Т-тест при уровне значимости 0,01 (р=2,35х10-6). Различия в эффективности воздействия других фунгицидов (кроме манкоцеба) на A. solani и мелкоспоровые виды были статистически недостоверны.

Выявленное отличие в уровнях устойчивости имеет важное практическое значение, т.к. манкоцеб является самым популярным фунгицидом в России и входит в состав многих смесевых препаратов. Возможно, именно применение содержащих манкоцеб препаратов привело к наблюдающемуся в настоящее время практически повсеместному преобладанию мелкоспоровых видов на картофеле и томате.

Слабым фунгицидным эффектом по отношению как к мелкоспоровым видам, так и к A. solani, отличались хлороталонил и азоксистробин. Среди всех исследованных видов из разных региональных популяций (за исключением A. solani из Марий Эл) были выявлены изоляты с ЕС50 более 1000 мкг/мл.

Таблица 7.

Устойчивость мелкоспоровых изолятов Alternaria к фунгицидам

Регион сбора образцов

Колво протес-тирован-ных изолятов

Вариабель-ность ЕС50 , мкг/мл

Среднее ЕС50, мкг/мл

Число штаммов с различными ЕС50, мкг/мл

< 1

110

10100

1001000

> 1000

Манкоцеб

Костромская

24

7.1 – 237.0

71.1

0

3

18

3

0

Марий Эл

35

7.3 – 604

80.4

0

4

27

4

0

Астраханская

43

6.7 – 596.2

145.4

0

3

24

16

0

Ленинградская

21

29.6 – 421.6

152.3

0

1

11

9

0

Татарстан

20

9.6 – 588.8

193.0

0

2

8

10

0

Все регионы

143

6.7 – 604

128.4

0

13

88

42

0

Азоксистробин

Костромская

21

8 – 4600

1057.8

0

7

3

3

8

Марий Эл

24

9.3 – 2800

747.4

0

2

8

8

6

Астраханская

32

8.7 – 6175

1072.7

0

0

13

8

11

Ленинградская

17

7.9 – 2800

1106.4

0

2

4

5

6

Татарстан

18

9.5 – 2500

867.6

0

3

3

5

7

Все регионы

112

7.9 – 6175

970.4

0

14

31

29

38

Флудиоксонил

Костромская

19

0.1 – 4.2

0.86

15

4

0

0

0

Марий Эл

18

0.5 – 1.3

0.7

16

2

0

0

0

Астраханская

28

0.5 – 45.3

2.3

26

1

1

0

0

Ленинградская

17

0.5 – 1.5

0.7

14

3

0

0

0

Татарстан

19

0.5 – 5.3

1.3

15

4

0

0

0

Все регионы

101

0.5 – 45.3

1.2

86

14

1

0

0

Хлороталонил

Костромская

12

64 – 1900

864.8

0

0

2

6

4

Марий Эл

11

9.4 – 2050

632.8

0

2

3

3

3

Астраханская

12

9.7 – 2200

634.9

0

2

3

3

4

Ленинградская

11

25 – 1450

611.5

0

1

3

5

2

Татарстан

14

8.5 – 1250

396.9

0

2

5

5

2

Все регионы

60

6.4 – 2050

628.2

0

7

16

22

15

Дифеноконазол

Все регионы

45

0.05 – 0.2

0.08

45

0

0

0

0

Флуазинам

Все регионы

49

0.51 – 0.78

0.62

49

0

0

0

0

Азоксистробин, по оценке коллектива экспертов (Bradshaw, 2007), признан одним из лучших фунгицидов против альтернариоза. Однако при лабораторной оценке он показал крайне низкую фунгицидную активность в отношении всех исследованных видов возбудителей альтернариоза картофеля и томата. Чем же может быть вызвано подобное несоответствие?

Мутации устойчивости к стробилуриновым фунгицидам хорошо известны и описаны в литературе (Bartlett et al., 2002, Pashe et al., 2005, Grasso et al., 2006, Peters et al, 2008, Ishii, 2009). В Европе и США выявлена мутация G143A гена цитохрома b, вызывающая устойчивость мелкоспоровых Alternaria. Генотипически она проявляется в виде однонуклеотидной замены (G у дикого штамма и С – у мутанта) в последовательности гена цитохрома b.

Таблица 8.

Устойчивость изолятов A. solani к фунгицидам

Регион сбора образцов

Кол-во протести-рованных изолятов

Вариабель-ность ЕС50 , мкг/мл

Среднее ЕС50, мкг/мл

Число штаммов с различными ЕС50, мкг/мл

< 1

110

10100

1001000

> 1000

Манкоцеб

Марий Эл

16

6.9 – 20.1

8.7

0

15

1

0

0

Астраханская

14

5.9 – 85.3

28.9

0

5

9

0

0

Приморский край

9

6.7 – 9.2

7.5

0

9

0

0

0

Все регионы

39

5.9 – 85.3

15.5

0

29

10

0

0

Азоксистробин

Марий Эл

10

6.4 – 700

103.2

0

3

6

1

0

Астраханская

10

5.5 – 3812

1075.4

0

2

3

1

4

Приморский край

9

8.2 – 2350

530.2

0

1

5

1

2

Все регионы

29

5.5 – 3812

562

0

6

14

3

6

Флудиоксонил

Марий Эл

10

0.6 – 4,1

1.5

7

3

0

0

0

Астраханская

11

0.6 – 7

1.7

9

2

0

0

0

Приморский край

9

0.54 – 0,7

0.6

9

0

0

0

0

Все регионы

30

0.54 – 7

1.26

25

5

0

0

0

Дифеноконазол

Все регионы

23

0.05 – 0.42

0.09

23

0

0

0

0

Хлороталонил

Все регионы

17

5.8 – 1440

486.8

0

5

4

5

3

Флуазинам

Все регионы

19

0.51 – 0.63

0.54

19

0

0

0

0

Проведенные нами эксперименты по аллель-специфичной ПЦР–идентификации этой мутации показали её отсутствие у 33 исследованных изолятов с разными уровнями устойчивости к азоксистробину, выделенными из пораженных образцов картофеля и томата в разных регионах России. Определение последовательности нуклеотидов гена цитохрома b (сиквенирование) было проведено у 6 изолятов мелкоспоровых видов из Костромской, Астраханской, Ленинградской областей, Марий Эл и Татарстана. Показатель устойчивости ЕС50 у этих штаммов варьировал от 10 до 6170 мкг/мл. Однако ни в одном случае мутации G143A выявлено не было. По-видимому, устойчивость российских штаммов обусловлена другими механизмами.

С другой стороны, устойчивость мицелия к азоксистробину может и не быть решающим фактором эффективного воздействия на патогена при полевом применении. Возможно, азоксистробин более эффективно воздействует на прорастающие конидии возбудителей, а не непосредственно на рост мицелия. Для проверки этого предположения мы (совместно с П.Н. Плуталовым) изучили прорастаемость конидий и ветвление ростковых гиф 39 изолятов разных видов мелкоспоровых возбудителей альтернариоза и 5 изолятов A. solani при разных концентрациях азоксистробина (табл. 9 и 10).

Таблица 9.

Прорастаемость конидий разных видов рода Alternaria на среде с азоксистробином

Вид

Доля проросших конидий при разных концентрациях азоксистробина, %

1 мкг/мл

10 мкг/мл

100 мкг/мл

Мелкоспоровые виды

41/80

27/66

21/63

A. solani

53/58

32/41

21/43

Прим.: данные приведены в виде x/y, где: x – процент проросших конидий относительно бесфунгицидного контроля через 5 часов инкубации, y – через 20 часов инкубации в темноте при 25°С.

В таблице 10 представлена доля ветвящихся ростковых гиф среди всех проросших конидий при учёте через 20 часов после нанесения суспензии конидий на среду. В присутствии азоксистробина интенсивность ветвления молодых гиф падала.

Таблица 10.

Доля ветвящихся ростковых гиф разных видов рода Alternaria на среде с азоксистробином

Вид

Доля ветвящихся ростковых гиф при разных концентрациях азоксистробина, %

0 мкг/мл

1 мкг/мл

10 мкг/мл

100 мкг/мл

Мелкоспоровые виды

45,3

5,5

3,2

0,6

A. solani

45

3

0

0

Прим. В таблице приведена доля (в %) ветвящихся ростковых гиф относительно общего числа проросших конидий через 20 часов инкубации в темноте при 25°С.

В присутствии азоксистробина прорастание конидий не было подавлено полностью, но было замедлено. Доля проросших конидий на среде с фунгицидом, измеренная через 20 часов, была в 2-3 раза выше, чем измеренная через 4 часа. Следует также отметить, что конидия считалась проросшей, если длина ростковых гиф превышала длину самой конидии. Через 20 часов экспозиции наблюдалась значительная доля конидий с меньшими проростками. Возможно, через некоторое время эти конидии тоже можно будет считать проросшими. Учета через 36 часов инкубации провести не удалось, т.к. гифы достигли значительной длины, переплелись между собой и затруднили просмотр.

Защитные мероприятия могут быть эффективны только в том случае, если концентрация фунгицида в рабочей жидкости в несколько раз превосходит максимальные выявленные показатели устойчивости штаммов. Рекомендованная концентрация фунгицида в рабочей жидкости более чем в 100 раз превосходит максимальный выявленный показатель ЕС50 для флуазинама, дифеноконазола и флудиоксонила и в 2-8 раз – для манкоцеба. Такая концентрация позволит успешно контролировать развитие альтернариоза с помощью этих препаратов. Концентрация хлороталонила в рабочей жидкости примерно равна максимально выявленному ЕС50. В этом случае при использовании фунгицида для обработок во время вегетации устойчивые штаммы могут сохранить жизнеспособность и развиваться на растении даже после контакта с препаратом. Концентрация азоксистробина в рабочей жидкости в 24–35 раз ниже, чем выявленный показатель ЕС50 наиболее устойчивых изолятов. Это будет препятствовать лечебному действию азоксистробина, но защитная активность может сохраниться за счет фунгистатического действия.

Глава 15. Разработка праймеров, позволяющих дифференцировать разные виды рода Alternaria.

       Обнаруженные различия между последовательностями крупноспоровых и мелкоспоровых штаммов позволили нам подобрать специфичные праймеры для избирательной амплификации участков генома мелкоспоровых Alternaria, A. solani и A. infectoria (табл. 11). Разделение групп мелко- и крупноспоровых видов имеет высокую практическую значимость, т.к. виды из этих групп имеют разную устойчивость к фунгицидам (Побединская и др., 2011, Kapsa, 2008), вирулентность к сортам растений, разные температурные оптимумы роста (Иванюк и др., 2005).

Подбор праймеров проводили к наиболее различающимся участкам последовательностей ядерных рибосомных генов (ITS5 – ITS4) крупно- и мелкоспоровых групп и A. infectoria с использованием программы Oligo. Участки ДНК крупно- и мелкоспоровых штаммов, использованные для посадки праймеров, отмечены на рисунках 4 и 5.

На следующем этапе был проведен ряд контрольных реакций с использованием ДНК чистых культур секвенированных штаммов, в процессе которых была оптимизирована методика, подобраны температурные режимы и определены необходимые концентрации ДНК для реакции ПЦР.

Таблица 11.

Последовательности диагностических праймеров.

Название праймеров

Нуклеотидная последовательность

Прямой праймер ITS5

5’ – GGAAGTAAAAGTCGTAACAAGG

Обратный праймер для мелкоспоровых (MR)

5’ – GACCTTTGCTGATAGAGAGTG

Обратный для крупноспоровых (SR)

5’ – CTTGGGGCTGGAAGAGAGCGC

Обратный праймер для A. infectoria (Inf.obr.)

5' – GACACCCCCCGCTGGGGCACTGC

Прямой праймер для A. infectoria (Inf.pr)

5' – GGTTGGTCCTGAGGGCGGGCGA

Рис. 4. Места посадки подобранных видоспецифичных обратных праймеров для амплификации крупно и мелкоспоровых видов.

Рис. 5. Места посадки подобранных видоспецифичных обратных праймеров для амплификации A. infectoria

       

В результате амплификация участков генома Alternaria с подобранными парами праймеров крупноспоровым и мелкоспоровым штаммам и A. infectoria соответствуют фрагменты длиной 505, 516 и 123 пн соответственно.

При практическом использовании метода наибольшие трудности вызывает выделение изолятов в чистую культуру. Провести выделение сразу после сбора образцов, как правило, невозможно. В практике часто используют засушивание собранных образцов после сбора, транспортировку в лабораторию, помещение во влажные камеры и последующее выделение изолятов в чистую культуру. Однако при подобном методе выделения высока вероятность контаминации вторичной микобиотой, в т.ч. и мелкоспоровыми видами Alternaria.

В нашей работе была предпринята попытка диагностики видового состава в образцах листьев, фиксированных сразу после сбора в 70% растворе этилового спирта. ДНК выделяли из целой листовой пластинки с несколькими некрозами. Пример электрофореграммы приведен на рис. 6. В некоторых образцах пораженных листьев было выявлено одновременное присутствие нескольких исследуемых видов.

Рис. 6. Идентификации видов Alternaria в заспиртованных листьях с помощью диагностических праймеров.

ITS5-MR- специфичные праймеры для мелкоспоровых штаммов, ITS5-SR - специфичные праймеры для крупноспоровых штаммов, Inf.pr-inf.obr - специфичные праймеры для A. infectoria, М – DNA ledder 1kb., 1-20- образцы тестируемых штаммов (представлена часть электрофореграммы).

Исследование образцов пораженных альтернариозом листьев картофеля из Московской и Костромской областей, а также из Монголии (всего исследовано 70 образцов) показало присутствие во всех исследованных регионах штаммов A. solani, A. infectoria и мелкоспоровых (табл. 12). Данные, полученные с помощью ПЦР-диагностики законсервированных в спирте образцов, отличались от результатов морфологической диагностики выделенных в чистую культуру штаммов. Во всех трех регионах в чистую культуру выделялись только мелкоспоровые изоляты, лишь в Костромской области был изолирован единственный штамм A. infectoria.

Таблица 12.

Результаты идентификации видов в законсервированных образцах с помощью ПЦР.

Виды

Количество образцов, содержащих видоспецифичные участки ДНК

Московская обл

Костромская обл

Монголия

Только А. solani

15

2

1

Только Мелкоспоровые

12

10

2

Только A. infectoria

4

3

1

А.solani +A.infectoria

2

2

-

А. solani+ мелкоспоровые

6

1

1

Мелкоспоровые+ A.infectoria

2

2

-

Все 3 группы

3

1

-

Всего образцов исследовано

44

21

5

Подобранные праймеры могут быть использованы для специфичной амплификации видов Alternaria и способствовать успешному определению данных видов в случаях, когда их идентификация по морфологическим признакам вызывает затруднения.

Заключение

Проведенные исследования вывели Россию в ряд стран с наиболее исследованными популяциями P. infestans. На территории России выявлены самые разные типы популяций – от моно- и поликлональных до панмиксных, в которых наблюдается высокое генотипическое разнообразие, присутствуют штаммы обоих типов спаривания, в пораженных образцах часто образуются ооспоры.

Наблюдающееся в большинстве популяций P. infestans европейской части России высокое генотипическое разнообразие позволяет нам не опасаться завоза из-за рубежа особо опасных клональных линий, поскольку их генотипы будут вовлечены в половой процесс и переработаны на менее опасные комбинации генов. Половой процесс и образование ооспор идут, преимущественно, на участках без интенсивного применения фунгицидов, с высоким разнообразием сортов и со слабым контролем семенного материала. В России такие условия создаются на частных огородах ЛПХ, где выращивается основная часть картофеля. Таким образом, частные огороды играют буферную роль, не позволяя массово развиваться высокоагрессивным и устойчивым к фунгицидам штаммам.

Длительный период исследований показал изменения, произошедшие в популяциях P. infestans. Прежде всего, это касается особенностей развития популяций на разных растениях-хозяевах, картофеле и томате. Если в конце 1980-х годов инициатором заражения томата всегда выступал картофель, то в последние годы стали нередки случаи, когда наоборот, пораженная рассада томата заражала картофель. Эпифитотии стали начинаться раньше, в посадках картофеля увеличилась доля расы Т1. Самые агрессивные популяции на картофеле состояли исключительно из штаммов расы Т1, причем штаммы были одинаково агрессивны и к картофелю, и к томату.

Штаммы, выделенные из томата, перестали отличаться от штаммов из картофеля по вирулентности и агрессивности к обоим растениям-хозяевам. Изменения эти связаны, вероятно, с появлением в популяциях штаммов разных типов спаривания, половым процессом, повышением роли ооспор как источника первичного инокулюма. В целом, по-видимому, произошла конвергенция популяций – возникновение единой популяции на двух растениях-хозяевах с одинаково высокой агрессивностью к обоим видам.

Молекулярная идентификация видов рода Alternaria по структуре участков генома показала, что во многих случаях и на картофеле, и на томате инфекция вызывается исключительно мелкоспоровыми видами. Это указывает на изменения в популяциях возбудителей альтернариоза, т.к. в 1960-70-х годах многими авторами было показано преобладание A. solani, а мелкоспоровые виды встречались, преимущественно, как вторичная инфекция. Повышение роли мелкоспоровых видов связано, возможно, с повсеместным применением фунгицида манкоцеб, обладающего значительно более высокой эффективностью против A. solani.

В ближайшем будущем следует, видимо, ожидать дальнейшего роста агрессивности мелкоспоровых видов по отношению к возделываемым сортам картофеля и томата, появления устойчивых к фунгицидам штаммов. Существенную роль в этом может сыграть завоз штаммов из Европы вместе с партиями семенного и продовольственного картофеля.

Роль полового процесса у возбудителей альтернариоза до сих пор не ясна, поэтому судьба завозных генотипов не очень понятна. По-видимому, они продолжат существовать в виде клональных линий, которые будут претерпевать изменения и приспосабливаться к выращиваемым сортам и используемым фунгицидам благодаря мутациям и парасексуальному процессу.

Исследования популяций возбудителей фитофтороза и альтернариоза необходимо продолжать, т.к. только постоянный мониторинг популяционной структуры может помочь в разработке оптимальных способов борьбы с этими заболеваниями.

Выводы.

1. На территории Европейской части России преобладают популяции P. infestans с высоким генотипическим разнообразием, в Сибири и на Дальнем Востоке - моно- или биклональные.

2. Широко распространенная в прошлом клональная линия US-1 к середине 90-х годов 20 века полностью исчезла из российских популяций. Последний раз штаммы этой клональной линии были выявлены в 1993 году на листьях томата в Московской области.

3. Присутствие в популяциях штаммов с разными типами спаривания и ооспор в пораженных фитофторозом растительных образцах свидетельствует в пользу прохождения полового процесса в популяциях. Отмечаемое практически повсеместно в Европейской части России высокое генотипическое разнообразие популяций может объясняться гибридизацией при половом процессе.

4. Практически все исследованные в работе штаммы имели число генов вирулентности к сортам картофеля, близкое к максимальному. В конце 90-х годов 20 века отмечено резкое возрастание агрессивности и вирулентности штаммов, выделенных из томата, что, возможно, обусловлено повышением роли ооспор как источника первичной инфекции томата.

5. Исследованные изоляты P. infestans с картофеля и томата из разных регионов России и Беларуси были чувствительны к большинству применяемых против них фунгицидов. Наиболее эффективными оказались азоксистробин и диметоморф.

6. В Московской, Смоленской, Тульской областях, в Сибири и на Дальнем Востоке были выявлены штаммы с высокой устойчивостью к металаксилу. Изоляты со средним уровнем устойчивости были обнаружены в большинстве популяций европейской части России и Беларуси.

7. Исследование возбудителей альтернариоза показало присутствие в пораженных листьях картофеля и томата видов A. solani, A. infectoria и комплекса мелкоспоровых видов. Мелкоспоровые виды, выделяемые по результатам морфологического анализа (A. alternata, A. tenuissima, A. arborescens), по структуре генома разделить не удалось.

8. На основании полученных данных по строению участков генома A. solani, A. infectoria и комплекса мелкоспоровых видов были созданы наборы для их ПЦР-диагностики. ПЦР-идентификация показала, что заражение листовых пластинок может быть вызвано разными видами; при этом внешних различий в симптомах поражения не обнаружено.

9. Оценка устойчивости изолятов рода Alternaria, выделенных с картофеля и томата, к фунгицидам, показала, что наиболее эффективными были дифеноконазол и флудиоксонил. Хороший эффект был также отмечен у манкоцеба и флуазинама, причем манкоцеб действовал значительно лучше в отношении A. solani, чем мелкоспоровых видов. Слабой эффективностью отличались азоксистробин и хлороталонил.

10. Мутации G143A, обусловливающей устойчивость мелкоспоровых видов Alternaria к азоксистробину в странах Европы и в США, у российских мелкоспоровых устойчивых изолятов не выявлено.

Список публикаций автора по теме диссертации.

Публикации в журналах из списка ВАК

Смирнов А.Н., Еланский С.Н., Долгова А.В. Ооспоры Phytophthora infestans в плодах томатов в Московской области//Защита и карантин растений. 1998. №5. С. 41.

Еланский С.Н., Лекомцева С.Н. Встречаемость спор грибов различных систематических групп в приземном слое атмосферы средних широт России// Микология и фитопатология. 1998. Т.32(1).

Еланский С.Н., Рыжкин Д.В. Концентрация спор грибов в атмосфере Москвы в связи с метеопараметрами // Микология и фитопатология, 1999, 33, 3, с. 188-192.

Деревягина М.К., Еланский С.Н., Дьяков Ю.Т. Резистентность Phytophthora infestans к фунгициду диметоморфу// Микология и фитопатология, 1999, 33, 3. С. 208-213.

Еланский С.Н., Долгова А.В., Смирнов А.Н., Дьяков Ю.Т. Популяции Phytophthora infestans в Московской области. 1. Системы размножения. //Микология и фитопатология, 1999, т. 33, в.5, с. 346-352.

Еланский С.Н., Багирова С.Ф., Смирнов А.Н., Дьяков Ю.Т. Популяции Phytophthora infestans в Московской области. 2. Сравнение популяций, паразитирующих на картофеле и томатах// Микология и фитопатология, 1999, т. 33, в.5, с. 353-359.

Смирнов А.Н., Еланский С.Н. Образование ооспор в полевых популяциях Phytophthora infestans в Московской области // Микология и фитопатология, 1999, т. 33, в.6, с. 421-425.

Апрышко В.П., Лихачев А.Н., Еланский С.Н. Биология и культурально-морфологические признаки российских штаммов Stachybotrys chartarum//Доклады ТСХА, 2001, вып. 273, ч. 1, с. 215-221.

Смирнов А.Н., Кузнецов С.А., Еланский С.Н. Изучение биологии возбудителя фитофтороза картофеля// Доклады ТСХА, 2001, вып. 273, ч. 1, с. 226-232.

Еланский С.Н., Петрунина Я.В., Лаврова О.И., Лихачев А.Н. Сравнительный анализ российских штаммов Stachybotrys chartarum// Микробиология. 2004. Т. 73 (1). С. 73-79.

Аматханова Ф.Х., Дьяков Ю.Т., Петрунина Я.В., Побединская М.А., Еланский С.Н., Козловская И.Н., Козловский Б.Е., Морозова Е.В., Смирнов А.Н. Популяции Phytophthora infestans на Северном Кавказе// Микология и фитопатология, 2004, т. 38, в. 3, с. 71-78.

Еланский С.Н., Апрышко В.П., Милютина Д.И., Козловский Б.Е. Устойчивость российских штаммов Phytophthora infestans к фунгицидам металаксил и диметоморф// Вестник московского университета, серия 16. Биология, 2007, N 1, С. 14-18.

Еланский С.Н., Милютина Д.И. Гетероплазмоз у Phytophthora infestans //Генетика. 2007. Т. 43. N 3. С. 333-336.

С. А. Шеин, Д. И. Милютина, И. Н. Козловская, Е. В. Морозова, М. А. Побединская, С. Н. Еланский. Генотипическое разнообразие Phytophthora infestans в республике Марий Эл// Микология и фитопатология. 2009. Т. 43. В. 4. С. 358 – 363.

Еланский С.Н., Побединская М.А., Романова С.С., Александрова А.В., Пляхневич М.П. Устойчивость возбудителей фитофтороза и альтернариоза картофеля и томата к некоторым фунгицидам // Иммунопатология. Аллергология. Инфектология. 2010. № 1. С. 234-235.

М.А. Побединская, П.Н. Плуталов, С.С. Романова, Л.Ю. Кокаева, А.В. Николаев, А.В. Александрова, С.Н. Еланский Устойчивость возбудителей альтернариоза картофеля и томата к фунгицидам// Микология и фитопатология. 2012.(в печати.)

С.Н. Еланский, М.А. Побединская, М.П. Пляхневич Устойчивость возбудителя фитофтороза картофеля и томата к фунгицидам// Микология и фитопатология. 2012.(в печати.)

S. Elansky, A. Smirnov, Y. Dyakov, A. Dolgova, A. Filippov, B. Kozlovsky, I. Kozlovskaya, P. Russo, C. Smart, W. Fry  Genotypic analysis of Russian isolates of Phytophthora infestans from the Moscow region, Siberia and Far East//J. Phytopathology. 2001. V. 149 (10). P. 605-611.

Статьи в других периодических изданиях.

Рыжкин Д.В., Еланский С.Н., Желтикова Т.М. Мониторинг концентрации спор грибов Cladosporium и Alternaria в атмосферном воздухе г. Москвы//Атмосфера. Пульманология и аллергология, 2002, 2, 30-31.

Еланский С.Н., Рыжкин Д.В. Распределение основных групп грибных спор в приземном воздухе Москвы. 1999 г.// Летопись погоды, климата и экологии Москвы, 2000г. Вып. 1, М., 2002 г. С. 65-67.

Еланский С.Н., Рыжкин Д.В. Распределение основных групп грибных спор в приземном воздухе Москвы. 2000 г.//Летопись климата, погоды и экологии Москвы, Вып. 2, 2001 г. Москва, 2002г. с. 86-89

Лаврова О.И., С.Н. Еланский, Ю.Т. Дьяков Cелекция штаммов Phytophtora infestans в бесполых генерациях// Журнал российского фитопатологического общества, 2003, т. 4, с. 1-7.

Уланова Т.И., Еланский С.Н., Филиппов А.В., Козловский Б.Е., Дьяков Ю.Т., Апрышко В.П., Смирнов А.Н., Коффей М.Д. Устойчивость к фитофторозу некоторых перспективных линий диких Lycopersicon hirsutum// Журнал Российского фитопатологического общества, 2003, 4, с. 9-15.

Лаврова О.И., С.Н. Еланский Идентификация SINE-подобных элементов в геноме Phytophthora infestans и оценка возможности их применения для сравнительного анализа штаммов//Журнал Российского фитопатологического общества, 2003, т.4, с. 39-45.

Дьяков Ю.Т., Еланский С.Н. Популяционная генетика Phytophthora infestans. В кн.: Микология сегодня. Т. 1. Под ред. Дьякова Ю.Т., Сергеева Ю.В. М.: Национальная академия микологии, 2007. С. 107-139.

Кокаева Л.Ю., Кокаева З.Г., Березов Ю.И., Еланский С.Н. Молекулярно – генетические подходы к исследованию фитопатогенного оомицета Phytophthora infestans // Защита картофеля. 2011. В. 2(3). С. 2-9.

С.Н. Еланский М.А. Побединская, П.Н. Плуталов, С.С. Романова, Л.Ю. Кокаева, А.В. Александрова. Устойчивость российских штаммов возбудителей альтернариоза картофеля и томата к азоксистробину// Защита картофеля. 2011. В. 2(3). С. 14-19.

Зейрук В. М., Пшеченков К. А., Еланский С. Н., Давыденкова О. Н., Мальцев С. В. Пути повышения качества свежего столового картофеля и картофелепродуктов в Центральном регионе России. Картофелеводство.// Сб. науч. трудов. Минск. т.13. 2007. С. 197–205.

Симаков Е.А., Анисимов Б.В., Склярова Н.П., Яшина И.М., Еланский С.Н. Сорта картофеля, возделываемые в России. Каталог-2005.// М., Картофелевод, 2005, 112 с.

Симаков Е.А., Анисимов Б.В., Еланский С.Н. Сорта картофеля, возделываемые в России. Каталог-2007.// М., Картофелевод, 2007, 80 с.

Симаков Е.А., Анисимов Б.В., Еланский С.Н. Сорта картофеля, возделываемые в России. Каталог-2008.// М., Картофелевод, 2008, 88 с.

Е.А. Симаков, Б.В. Анисимов, Н.П. Склярова, И.М. Яшина, С.Н. Еланский Сорта картофеля, возделываемые в России. Каталог 2009// М.: Агроспас. 2009 г. 5,5 п.л., 92 стр.

С.Н. Еланский, М.А. Побединская П.Н. Плуталов, С.С. Романова, А.В. Николаев, Л.Ю. Кокаева, А.В. Александрова. Устойчивость возбудителей альтернариоза картофеля и томата к азоксистробину // Картофелеводство. Минск, 2011. Т. 19. С. 277-286.

Л.Ю. Кокаева, М.А. Побединская, А.В. Николаев, А.В. Александрова, С.Н. Еланский. Видовой состав возбудителей альтернариоза картофеля и томата //  Картофелеводство. Минск, 2011. Т. 19. С. 333-342.

Bagirova S.F., An Zsan Li, Dolgova A.V., Elansky S.N., Shaw D.S., Dyakov Y.T. Mutants of Phytophthora infestans resistant to dimethomorph fungicide//J. Russian Phytopathol. Soc., 2001, v. 2, p. 19-25.

Kokaeva L., Pobedinskaya M., Alexandrova A., N.V. Statsyuk, Elansky S. Composition of species of potato and tomato early blight pathogens// Materials of the 13 EuroBlight workshop. PPO-Special Report no. 15. 2011. (In press).

M.A. Pobedinskaya, S.N. Elansky, N.V. Statsyuk, M.P. Plyakhnevich Resistance of Phytophthora infestans to fungicides// Materials of the 13 EuroBlight workshop. PPO-Special Report no. 15. 2011. (In press).

Elansky S.N., Petrunina Ya.V., Likhachev A.N. Growth of Stachybotrys chartarum (Ehrenb.) Hughes strains on natural and artificial substrates //Botanica Lithuanica, 2003, 9(2): 171–177.

Elansky S. N., Smirnov A. N. Second locus of Peptidase as a marker for genetic investigations of Phytophthora infestans //Botanica Lithuanica, 2003, 9(3), 275-283.

Elansky S.N., Milyutina D.I. Heteroplasmosis in Phytophthora infestans// Russian Journal of Genetics, 2007, V 43, N 3, P 255-258.

N.V. Statsyuk, M.A. Kuznetsova, I.N. Kozlovskaya, B.E. Kozlovsky, S.N. Elansky, E.V. Morozova, E.V. Valeva, and A.V. Filippov Characteristics of the Phytophthora infestans population in Russia// Proceedings of the 12 EuroBlight Workshop, 3-6 May, 2010, Arras, France. P. 247-254.

Патенты

Шевелев С.А., Дутов М.Д., Попков С.В., Еланский С.Н., Кокуркина Г.В., Побединская М.А. Замещенные 2-фенилиндолы, способ их получения и фунгицидные композиции на их основе// Патент РФ № 2440339

Соавторство в монографиях.

Пшеченков К.А., Зейрук В.Н., Еланский С.Н., Мальцев С.В. Технологии хранения картофеля // М. Картофелевод. 2007. 192 с.

Б. В. Анисимов, Г. Л. Белов, Ю. А. Варицев, С. Н. Еланский, Г. К. Журомский, С. К. Завриев, В. Н. Зейрук, В. Г. Иванюк, М. А. Кузнецова, М. П. Пляхневич, К. А. Пшеченков, Е. А. Симаков, Н. П. Склярова, З. Сташевски, А. И. Усков, И. М. Яшина. Защита картофеля от болезней, вредителей и сорняков. // М. Картофелевод. 2009. 272 с.

Статьи в сборниках

Н.Ф. Еланский, И.Б. Беликов, Е.В. Березина, К.А.М. Бреннинкмайер, Н.Н. Букликова, Л. Вайсфлог, Е. Вартианен, Г.С. Голицын, Г.И. Горчаков, И.Г. Гранберг, А.М. Грисенко, С.Н. Еланский, А.С. Елохов, К.В. Жерников, А.И. Игаев, А.А. Козлова, В.М. Копейкин, П. Крутцен, С. Куокка, О.В. Лаврова, Л.В. Лисицына, К.Б. Моисеенко, Е. Оберландер, Ю.И. Обвинцев, Н.В. Панкратова, О.В. Постыляков, Е. Путц, П.А. Ромашкин, А.Н. Сафронов, А.И. Скороход, О.А. Тарасова, Дж. С. Турнбулл, Д.Ф. Хёрст, Р. Хользингер, К.П. Шенфельд, Р.А. Шумский, Дж.В. Элкинс  Состав атмосферы над Северной Евразией:эксперименты TROICA// Под ред. Н.Ф Еланского. М.: Агроспас. 2009 г. 10 п.л., 80 стр. Тираж 900 экз.

Elansky S.N. Analysis of Phytophthora infestans isolates from Siberian, Far Eastern and the Moscow Regions populations.// in: Cornell-Eastern Europe-Mexico International Collaborative project in Potato Late Blight Control. Progress report, July 1999.

S.N. Elansky, Yu.T. Dyakov, D.I. Milyutina, V.P. Apryshko, M.A. Pobedinskaya,  A.V. Filippov, B.E. Kozlovsky, M.A. Kuznetsova, A.N. Rogozhin, N.V. Statsyuk Late blight of potato in Russia// Potato production and innovative technologies. Ed. A.J. Havenkort, B.V. Anisimov, Wageningen Academic Publishers, The Netherlands, 2007, P. 262-274.

Zeyruk V.N., Pshechenkov K.A., Elansky S.N., Davydenkova O.N., Maltsev S.V. Influence of potato growth and storage conditions on the quality of fresh table potato and potato products in the central part of Russia// Potato production and innovative technologies. Ed. A.J. Havenkort, B.V. Anisimov, Wageningen Academic Publishers, The Netherlands, 2007, P. 262-274.

N.F. Elansky, I.B. Belikov, E.V. Berezina, C.A.M. Brenninkmeijer, N.N. Buklikova, P.J. Crutzen, S.N. Elansky, J.V. Elkins, A.S. Elokhov, G.S. Golitsyn, G.I. Gorchakov, I.G. Granberg, A.M. Grisenko, R. Holzinger, D.F. Hurst, A.I. Igaev, A.A. Kozlova, V.M. Kopeikin, S. Kuokka, O.V. Lavrova, L.V. Lisitsyna, K.B. Moeseenko, E.A. Oberlander, Yu.I. Obvintsev, N.V. Pankratova, O.V. Postylyakov, E. Putz, P.A. Romashkin, A.N. Safronov, K.P. Shenfeld, A.I. Skorokhod, R.A. Shumsky, O.A. Tarasova, J.C. Turnbull, E.Vartiainen, L. Weissflog, K.V. Zhernikov Atmospheric composition observations over Northern Eurasia using the mobile laboratory. TROICA experiments.// Ed. N.F. Elansky. М.: Агроспас. 2009 г. 9 п.л., 72 стр. Тираж 900 экз.

Избранные тезисы и материалы конференций

Еланский С.Н., Попова И.И. Устойчивость фитопатогенного гриба Phytophthora infestans (Mont.) de Bary к индукторам окислительного стресса // Сборник трудов международной конференции «Современные проблемы микологии, альгологии и фитопатологии», 1998, Москва, Муравей, с. 38-40.

Долгова А.В., Смирнов А.Н., Еланский С.Н., Багирова С.Ф., Малеева Ю.В., Дьяков Ю.Т. Структура и динамика генотипического состава популяций Phytophthora infestans на территории бывшего СССР // Сборник трудов международной конференции «Современные проблемы микологии, альгологии и фитопатологии», 1998, Москва, Муравей, с. 35-37.

Еланский С.Н., Рыжкин Д.В. Споры грибов в атмосфере Москвы, 1996 г. // Сборник трудов международной конференции «Современные проблемы микологии, альгологии и фитопатологии», 1998, Москва, Муравей, с. 197-198.

Смирнов А.Н., Еланский С.Н., Дьяков Ю.Т. Роль ооспорообразования в изменчивости подмосковных популяций Phytophthora infestans // Сборник трудов международной конференции «Современные проблемы микологии, альгологии и фитопатологии», 1998, Москва, Муравей, с. 109-111.

Еланский С.Н., Смирнов А.Н., Долгова А.В. Популяции Phytophthora infestans на территории России// Материалы Всероссийской конференции «Экологические проблемы и пути их решения в зоне среднего поволжья», Саранск, 1999, с. 132-133.

Еланский С.Н. Изменения в подмосковной популяции Phytophthora infestans в 1991-1999 годах// Тезисы международной конференции «Микология и криптогамная ботаника в России», Санкт-Петербург, 2000, с. 118.

М.К. Деревягина, С.Ф. Багирова, С.Н. Еланский, Ю.Т. Дьяков Влияние фунгицидов на популяции фитопатогенных грибов//Материалы докладов международной научно-практической конференции "Биологизация защиты растений: состояние и перспективы, Краснодар, 2001, с. 95-96.

Смирнов А.Н., Кузнецов С.А., Кравцов А.С., Апрышко В.П., Побединская М.А., Еланский С.Н. Происхождение ооспор Phytophthora infestans в пораженных фитофторозом образцах в Подмосковье// Международный симпозиум «Проблемы изучения и охраны биоразнообразия и природных ландшафтов Европы» Сборник материалов. Пенза, 2001, с. 135.

Смирнов А.Н., Кравцов А.С., Кузнецов С.А., Апрышко В.П., Еланский С.Н. Встречаемость и возможное происхождение ооспор Phytophthora infestans в Московской обл. в 1999 г. // Материалы научной конференции «Памяти Грегора Менделя», Москва, изд. МСХА, 2001, с. 122-123.

Кравцов А.С., Еланский С.Н. Гаплотипы митохондриальной ДНК российских штаммов фитопатогенного оомицета Phytophthora infestans// V всероссийский популяционный семинар «популяция, сообщество, эволюция», ч.1, Казань, 2001, с. 116-119.

А.Н. Смирнов, С.А. Кузнецов, А.С. Кравцов, В.П. Апрышко, С.Н. Еланский Распространение и возможное происхождение ооспор Phytophthora infestans в Московской области//Материалы научно-практической конференции «Научное обеспечение картофелеводства России: состояние, проблемы», Москва, 2001, с. 313-324.

Еланский С.Н., Рыжкин Д.В., Лихачев А.Н. Грибы и качество воздуха//Современная микология в России. Тезисы докладов первого съезда микологов, Москва, 2002, с. 49.

Еланский С.Н., Смирнов А.Н., Кравцов А.С., Апрышко В.П., Дьяков Ю.Т. Популяции Phytophthora infestans в Московской области//Современная микология в России. Тезисы докладов первого съезда микологов, Москва, 2002, с. 179.

Смирнов А.Н, Кузнецов С.А., Побединская М.А., Кравцов А.С., Еланский С.Н. Встречаемость, морфологические особенности и возможное происхождение ооспор Phytophthora infestans в Московской области// Современная микология в России. Тезисы докладов первого съезда микологов, Москва, 2002, с. 207.

Smirnov A.N., Kuznetsov S.A., Elansky S.N. Investigations of Phytophthora infestans oospores in Moscow region.// The 7-th International Mycological Congress, Book of abstracts, Oslo, 2002,p.268.

Еланский С.Н., Смирнов А.Н., Кравцов А.С., Дьяков Ю.Т., Козловская И.Н., Козловский Б.Е., Морозова Е.В., Аматханова Ф.Х. Популяции Phytophthora infestans в европейской части России// Первая всероссийская конференция по иммунитету растений к болезням и вредителям. Научные материалы, Санкт-Петербург, 2002, с. 81-82.

Еланский С.Н., Петрунина Я.В., Побединская М.А., Смирнов А.Н. Сравнительный анализ популяций Phytophthora infestans (Mont.) de Bary на основании типов спаривания и спектров изоферментов пептидазы// Актуальные проблемы генетики. Материалы 2-й конференции Московского общества генетиков и селекционеров им. Н.И. Вавилова, посвященной 115-летию со дня рождения академика Н.И. Вавилова. М., издательство МСХА, Т.2, с. 72-73.

Аматханова Ф.Х., Дьяков Ю.Т., Петрунина Я.В., Побединская М.А., Еланский С.Н., Козловская И.Н., Козловский Б.Е., Морозова Е.В., Смирнов А.Н. Сравнительный анализ северокавказских популяций Phytophthora infestans// Сб. материалов юбилейной конференции Микология и альгология 2004, М., Прометей, 2004, с. 17-18.

Аматханова Ф.Х., Еланский С.Н., Дьяков Ю.Т. Сравнение штаммов Phytophthora infestans из разных регионов России по способности к линейному росту при разных температурах// Сб. материалов юбилейной конференции Микология и альгология 2004, М., Прометей, 2004, с. 18-19.

Апрышко В.П., Петрунина Я.В., Побединская М.А., Еланский С.Н. Ооспоры Phytophthora infestans в природных очагах фитофтороза в Московской области в 2003 году// Сб. материалов юбилейной конференции Микология и альгология 2004, М., Прометей, 2004, с. 21-22.

Лаврова О.И., Еланский С.Н. Идентификация SINE-подобных элементов в геноме Phytophthora infestans и оценка возможности применения INTER-SINE-ПЦР для сравнительного анализа штаммов// Сб. материалов юбилейной конференции Микология и альгология 2004, М., Прометей, 2004, с. 85-86.

Еланский С.Н., Лаврова О.И., Петрунина Я.В. Поиск новых маркеров для сравнительного исследования штаммов Phytophthora infestans// Материалы международной научной конференции «Актуальные вопросы ботаники и физиологии растений», Саранск, 2004, с. 90-92.

Еланский С.Н., Рыжкин Д.В. Вариации концентрации грибных спор в приземном воздухе Москвы// Материалы международной научной конференции «Биология, систематика и экология грибов в природных экосистемах и агрофитоценозах», Минск, 2004, с. 92- 95.

Еланский С.Н., Смирнов А.Н., Кузнецов С.А., Апрышко В.П., Дьяков Ю.Т. Возможные причины изменения структуры популяций Phytophthora infestans в европейской части России на рубеже 20-21 веков// Материалы международной научной конференции «Биология, систематика и экология грибов в природных экосистемах и агрофитоценозах», Минск, 2004, с. 96- 100.

Лаврова О.И., Еланский С.Н. Идентификация SINE-подобных элементов в геноме Phytophthora infestans и применение INTER-SINE-ПЦР для сравнительного анализа штаммов грибов// Сб. материалов III съезда ВОГиС «Генетика в 21 веке: современное состояние и проблемы развития», Москва, 6-12 июня 2004 г., с. 359.

Еланский С.Н., Апрышко В.П. Самофертильные штаммы Phytophthora infestans в природных популяциях// Труды международной конференции «Грибы в природных и антропогенных экосистемах», С.-Пб., 2005, с. 189-189.

Еланский С.Н., Апрышко В.П., Милютина Д.И., Козловский Б.Е. Устойчивость российских штаммов Phytophthora infestans к системным фунгицидам // Материалы международной конференции «Грибы и водоросли в биоценозах – 2006», М., МАКСпресс, 2006, с. 56-58.

Еланский С.Н., Дьяков Ю.Т., Милютина Д.И., Апрышко В.П., Побединская М.А., Филиппов А.В., Козловский Б.Е., Кузнецова М.А., Рогожин А.Н., Стацюк Н.В. Популяции возбудителя фитофтороза в России// Картофелеводство России. Актуальные проблемы науки и практики. Материалы Международного конгресса «Картофель. Россия. 2007»М. 2007. С. 211–222.

Еланский С.Н., Пляхневич М.П., Романова С.С., Шеин С.А., Александрова А.В., Милютина Д.И. Устойчивость к манкоцебу штаммов Phytophthora infestans и Alternaria sp. из России и Беларуси// Современная микология в России. Том 2. Материалы 2-го съезда микологов России. М.: Национальная академия микологии, 2008. С. 290–291.

Милютина Д.И., Шеин С. А., Апрышко В.П., Еланский С.Н. Популяции Phytophthora infestans в республике Марий Эл// Современная микология в России. Том 2. Материалы 2-го съезда микологов России. М.: Национальная академия микологии, 2008. С. 193–194.

Пляхневич М.П., Еланский С.Н. Генотипический анализ белорусских штаммов возбудителя фитофтороза картофеля// Вторая Всероссийская конференция «Современные проблемы иммунитета растений к вредным организмам» С.-Пб., 29 сентября – 2 октября 2008 г. С. 79-83

С.Н. Еланский, М.П. Пляхневич Генотипический анализ штаммов возбудителя фитофтороза картофеля из Беларуси и Марий Эл// Сборник материалов научно-практической конференции «Перспективы инновационного развития картофелеводства». Чебоксары, 19-20 февраля 2009 года. Стр. 74-76.

С.Н. Еланский, М.А. Побединская, Л.Ю. Кокаева, Ю.Т. Дьяков, М.П. Пляхневич Устойчивость Phytophtora infestans, возбудителя фитофтороза картофеля и томата, к некоторым фунгицидам. // Материалы научно-практической конференции «Актуальные проблемы современной индустрии производства картофеля (Картофель-2010)».  Чебоксары. 2011 г. С. 157-162.

Elansky, S., Ryzhkin D. Airborne fungal spores in the atmosphere of Moscow city// The 7th International Congress on Aerobiology, Abstracts, Canada, Montreal, 2002, p. 169.

S.N. Elansky, D.I. Milyutina Mitochondrial haplotypes of Russian Phytophthora infestans strains // XV Congress of European Mycologists. S.-Pb., Russia, September 16-21, 2007. Book of Abstracts. P. 245.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.