WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Дильмухаметова Лилия Кадыровна

РОЛЬ КАТЕХОЛАМИНОВ МОЗГА В РАЗВИТИИ ГИПЕРПРОЛАКТИНЕМИИ

03.03.01 – физиология 03.03.04 – клеточная биология, цитология, гистология

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Москва - 2012

Работа выполнена в лаборатории гормональных регуляций Федерального государственного бюджетного учреждения науки Института биологии развития им. Н.К. Кольцова Российской академии наук (ИБР РАН) Научные руководители:

доктор биологических наук, профессор, академик РАН Угрюмов Михаил Вениаминович (ИБР РАН) кандидат биологических наук Пронина Татьяна Сергеевна (ИБР РАН)

Официальные оппоненты:

Базян Ара Саакович - доктор биологических наук, Федеральное государственное бюджетное учреждение науки Институт высшей нервной деятельности и нейрофизиологии РАН, заведующий лабораторией нейрохимических механизмов обучения и памяти Бабичев Василий Николаевич - доктор биологических наук, профессор, Федеральное государственное бюджетное учреждение «Эндокринологический научный центр» Минздравсоцразвития РФ, главный научный сотрудник

Ведущая организация: Федеральное государственное бюджетное учреждение «Научно-исследовательский институт общей патологии и патофизиологии» РАМН, Москва

Защита диссертации состоится « 25 » апреля 2012 г. в 1400 часов на заседании диссертационного совета Д 002.238.01 при Федеральном государственном бюджетном учреждении науки Институте биологии развития им. Н.К. Кольцова Российской академии наук по адресу: 119334, Москва, ул. Вавилова,

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждения науки Института биологии развития им. Н.К. Кольцова Российской академии наук по адресу: 119334, Москва, ул. Вавилова, Автореферат разослан « » марта 2012 г.

Ученый секретарь диссертационного совета, кандидат биологических наук Е.Б. Абрамова e-mail: ele0806@yandex.ru

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Пролактин, синтезирующийся лактотрофами передней доли гипофиза, является одним из трех гормонов, играющих важную роль в регуляции репродуктивной функции организма (Freeman et al., 2000).

Секреция (синтез и выделение) пролактина находится под ингибиторным контролем дофамина (ДА), синтезирующегося дофаминергическими (ДА-ергическими) нейронами аркуатного ядра гипоталамуса (Moore, 1987).

Ранее было показано, что ДА синтезируется не только в ДА-ергических нейронах, содержащих оба фермента синтеза ДА – тирозингидроксилазу (ТГ) и декарбоксилазу ароматических аминокислот, но и в так называемых моноферментных неДА-ергических нейронах, экспрессирующих только один из ферментов (Ugrumov, 2008). В регуляции секреции пролактина принимает участие и норадреналин (НА) (Thomas et al., 1989), который помимо прямого влияния на лактотрофы гипофиза, может оказывать влияние на секрецию пролактина опосредованно через нейроны аркуатного ядра (Koshiyama et al., 1987).

При спонтанной прогрессирующей дегенерации ДА-ергических нейронов аркуатного ядра развивается синдром гиперпролактинемии, характеризующийся повышенной секрецией пролактина. Гиперпролактинемия относится к хроническим нейродегенеративным заболеваниям, но в отличие от хорошо известных болезней Паркинсона и Альцгеймера, приводит к бесплодию и ею страдают люди в репродуктивном периоде жизни (Serri et al., 2003). Это заболевание встречается у женщин чаще, чем у мужчин (7:1) и является причиной женского бесплодия в 25-40% всех случаев. Снятие ингибиторного влияния ДА на секрецию пролактина при дегенерации ДА-ергических нейронов приводит не только к гиперсекреции этого гормона, но и к усилению пролиферативной активности лактотрофов, а в конечном итоге к развитию опухоли гипофиза – пролактиномы (Velkeniers, 1998). Нередко гиперпролактинемия диагностируется на этой уже необратимой стадии развития, и лечение начинается с малоэффективной коррекции секреции пролактина с помощью лекарственных веществ, а кончается хирургическим удалением части гипофиза или даже целого гипофиза (Nomikos, 2001).

Учитывая то, что через гипофиз осуществляется нейроэндокринная регуляция водно-солевого обмена и практически всех эндокринных функций, даже частичное его удаление требует проведения обширной гормонотерапии в течение всей последующей жизни пациента. Эти обстоятельства указывают на необходимость разработки ранней диагностики и превентивного лечения гиперпролактинемии, что возможно только после тщательного изучения механизмов ее развития на адекватных экспериментальных моделях.

Дегенерация НА-ергических нейронов также вносит серьезный вклад в патогенез синдрома гиперпролактинемии (Srinivasan and Schmidt, 2003).

Однако, до сих пор при моделировании гиперпролактинемии не предпринимались попытки предотвратить дегенерацию НА-ергических нейронов для того, чтобы оценить вклад в развитие указанной патологии каждой из катехоламинергических компонент – ДА-ергической и НА-ергической.

Цель исследования состояла в изучении роли ДА и НА в развитии гиперпролактинемии при функциональной недостаточности ДА-ергических нейронов аркуатного ядра.

Для достижения данной цели были поставлены следующие задачи:

1. Экспериментально смоделировать функциональную недостаточность ДА-ергических нейронов аркуатного ядра в условиях дефицита или сохранности НА-ергического влияния:

а) оценить эффективность действия 6-гидроксидофамина (6-ГДА) – нейротоксина, и десметилимипрамина (ДМИ) – ингибитора обратного захвата НА и токсина НА-ергическими нейронами, по изменению уровня ДА и НА в нигростриатной системе;

б) определить содержание НА, ДА и его метаболитов в тубероинфундибулярной системе при введении 6-ГДА в сочетании с ДМИ.

2. На моделях дефицита НА и ДА или только ДА оценить:

а) секреторную активность НА-ергических аксонов и ДА-ергических нейронов в аркуатном ядре;

б) количественные и качественные изменения дофамин-гидроксилаза-содержащих терминалей и тирозингидроксилазасодержащих нейронов аркуатного ядра;

в) чувствительность лактотрофов к ДА путем измерения уровня мРНК Д2-рецепторов в передней доле гипофиза;

г) динамику развития гиперпролактинемии по изменению уровня пролактина в крови и в передней доле гипофиза.

Научная новизна и практическая значимость работы.

Впервые:

разработана фармакологическая модель гипоталамически-обусловленной некомпенсируемой гиперпролактинемии;

показано, что гиперпролактинемия, вызванная дегенерацией ДА-ергических нейронов аркуатного ядра и дефицитом ДА, не компенсируется при сохранении НА-ергических аксонов в аркуатном ядре, что можно объяснить ингибирующим влиянием НА на компенсаторный синтез ДА;

проведена оценка компенсаторных изменений на гипоталамическом и гипофизарном уровнях контроля секреции пролактина при дефиците или сохранности НА-ергического влияния;

проведена оценка количественных и качественных изменений дофамин-гидроксилаза-содержащих терминалей и ТГ-содержащих нейронов аркуатного ядра на моделях компенсируемой и некомпенсируемой гиперпролактинемии, и было показано, что при сохранении НА-ергических аксонов ингибируется экспрессия ТГ в нейронах аркуатного ядра.

Полученные данные:

расширяют представления о роли гипоталамо-гипофизарного звена в нейроэндокринной регуляции репродуктивной функции;

позволяют по новому оценить патогенез той формы синдрома гиперпролактинемии, в основе которой лежит дегенерация ДА-ергических нейронов аркуатного ядра;

могут быть использованы при разработке доклинической диагностики и превентивного лечения гиперпролактинемии, направленного на остановку и замедление дегенерации ДА-ергических и НА-ергических нейронов, а также на повышение эффективности эндогенных компенсаторных процессов.

Личное участие автора. Все эксперименты, описанные в работе, были спланированы и выполнены непосредственно соискателем, за исключением экспериментов по оценке содержания мРНК Д2-рецепторов в передней доле гипофиза, которые были проведены совместно с Институтом биологии гена РАН. Поставленные задачи были решены с применением современных методов физиологии, клеточной и молекулярной биологии. Выводы сформулированы на основе собственных оригинальных данных.

Апробация работы. Материалы диссертации были представлены на:

II Съезде физиологов СНГ, посвященном памяти академика О.Г. Газенко (Кишинев, 2008); Всероссийской медико-биологической научной конференции молодых ученых «Фундаментальная наука и клиническая медицина» (СанктПетербург, 2008); Всероссийской конференции «Нейрохимические механизмы формирования адаптивных и патологических состояний мозга» (СанктПетербург, 2008); Конференции молодых ученых «Экспериментальная прикладная физиология» (Москва, 2009); VIII Всероссийской конференции «Нейроэндокринология – 2010», посвященной 85-летию А.В. Поленова (СанктПетербург, 2010); 5-й Международной конференции «Биологические основы индивидуальной чувствительности к психотропным средствам» (Клязьма, 2010).

Структура и объем диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, результатов исследования, обсуждения, выводов и списка литературы, включающего 2источников. Работа изложена на 117 страницах, содержит 43 рисунка и 2 таблицы.

Публикации. По теме диссертации опубликовано: статей в журналах Перечня ВАК – 2, тезисов докладов и материалов конференций – 9.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Животные, фармакологические воздействия. В работе использовано 242 половозрелых самцов крыс линии Вистар весом 220-250 г.

Для моделирования гиперпролактинемии животным вводили (рис. 1):

в 1-й группе (модель 1) – внутрибрюшинно 0.9% NaCl, через 40 мин стереотаксически в боковой желудочек мозга 250 мкг 6-ГДА (Sigma, США), растворенного в 15 мкл 0.9% NaCl с 0.1% аскорбиновой кислотой (стабилизатор-антиоксидант); во 2-й группе (модель 2) – внутрибрюшинно ДМИ (25 мг/кг веса) (Sigma, США) в 0.9% NaCl, через 40 мин в боковой желудочек мозга 250 мкг 6-ГДА в 15 мкл 0.9% NaCl с 0.1% аскорбиновой кислотой; в соответствующих контрольных группах вместо 6-ГДА вводили 15 мкл 0.9% NaCl с 0.1% аскорбиновой кислотой.

Рис. 1. Моделирование гиперпролактинемии. 6-ГДА – 6-гидроксидофамин, ДА – дофамин, ДМИ – десметилимипрамин, НА – норадреналин.

Взятие материала. Взятие материала проводили на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА. Все полученные образцы замораживали в жидком азоте и хранили при температуре -70С.

Кровь у крыс на 14-й день собирали двумя способами: 1) из хвостовой вены (в дальнейшем кровь у этих животных собирали для определения пролактина в плазме на 45-й день); 2) из левого желудочка сердца автоматической пипеткой (непосредственно перед декапитацией животных).

На 45-й день кровь собирали из левого желудочка сердца непосредственно перед декапитацией животных. Плазму отделяли от сгустка крови центрифугированием (Centrifuge 5417R, Eppendorf, США) при 3000 об/мин в течение 15 мин при 4С. Супернатант замораживали и хранили до определения пролактина (иммуноферментный анализ).

Животных из экспериментальных и контрольных групп декапитировали, извлекали мозг и под бинокулярной лупой на холоду выделяли стриатум, черную субстанцию, аркуатное ядро и срединное возвышение по схеме, описанной ранее (Дильмухаметова и др., 2009). Выделенные фрагменты взвешивали, замораживали и хранили до измерения катехоламинов и их метаболитов (высокоэффективная жидкостная хроматография).

Гипофиз на холоду быстро отделяли от клиновидной кости, вычленяли переднюю долю, разрезали ее на две половинки, замораживали и хранили до определения пролактина (иммуноферментный анализ) и уровня мРНК Д2-рецепторов (полимеразная цепная реакция).

С целью получения материала для иммуноцитохимических исследований животных под наркозом перфузировали через сердце фосфатно-солевым буфером (0.02 М, pH=7.4) при 37С, затем 4% параформальдегидом на 0.1 М фосфатном буфере при 4С. Далее у животных выделяли головной мозг, дофиксировали его в параформальдегиде 12 часов, после промывки в фосфатно-солевом буфере инкубировали в 20% растворе сахарозы в течение суток и замораживали в изопентане при -40С, хранили при -70С.

Проточная инкубация срезов аркуатного ядра. При помощи вибратома Vibratome 1000 Plus (Vibratome, Германия) делали слайсы свежевыделенного мозга толщиной 300 мкм в растворе Кребса-Рингера следующего состава (мМ):

NaCl 120, KCl 4.8, CaCl2 2.0, MgSO4 1.2, NaHCO3 25.0, D-глюкоза 10.1, HEPES 20.0) (pH=7.4) при 4С. Под контролем бинокулярной лупы начиная с уровня 2.3 мм от брегмы (Paxinos and Watson, 2001) брали по 4 слайса и вырезали из них аркуатное ядро. Срезы аркуатного ядра помещали в термостатируемые (37С) камеры и инкубировали в растворе Кребса-Рингера. Постоянную скорость (100 мкл/мин) протока раствора через камеры обеспечивали с помощью перистальтического насоса Ismatec IPC (Micropump Ltd, США).

После 40-минутной стабилизации системы, собирали шесть 10-тиминутных фракций оттекающего раствора. Далее продолжали инкубировать срезы в растворе Кребса-Рингера с повышенным содержанием калия (KCl 56 мМ; NaCl 68.8 мМ) и собирали еще шесть фракций оттекающего раствора. Фракции инкубационной среды и ткань аркуатного ядра после инкубации замораживали, хранили до измерения катехоламинов и их метаболитов (высокоэффективная жидкостная хроматография).

Высокоэффективная жидкостная хроматография. Разделение катехоламинов и их метаболитов проводили на обращённо-фазовой колонке (4100 мм) с наполнителем ReproSil-Pur C18 с диаметром пор 3 мкм (Dr. Maisch GMBH, Германия) в 0.1 M цитратно-фосфатном буфере (pH=3.0), содержащем 1.1 мМ октансульфоновой кислоты, 0.1 мМ этилендиаминтетрауксусной кислоты и 9% ацетонитрила с последующей электрохимической детекцией на стеклоугольном электроде (+0.85V). Регистрацию и обработку данных проводили с помощью программы Мультихром v.1.5 (Ampersand Ltd., США).

Иммуноферментный анализ. Уровень пролактина в плазме и в передней доле гипофиза определяли конкурентным методом иммуноферментного анализа. После размораживания плазму центрифугировали 30 мин при 5000 об/мин при 4°C. Передние доли гипофизов гомогенизировали в 0.05 М бикарбонатном буфере (pH=10), инкубировали 1 час при 4С, центрифугировали 30 мин на холоду при 5000 об/мин и собирали супернатант. Определение пролактина проводили с использованием набора реагентов «Rat prolactin A05101» (SpiBio, США) с чувствительностью определения 0.2 нг/мл. Оптическую плотность проб определяли с помощью люминометра-фотометра LM 01A (Immunotech, Чехия) при длине волны 405 нм. Регистрацию и обработку данных проводили с помощью программы Liana (Immunotech, Чехия).

Полимеразная цепная реакция в реальном времени. Содержание мРНК Д2-рецепторов оценивали в передней доле гипофиза. РНК из гипофизов выделяли с помощью Trizol (Invitrogen, США) в соответствии с рекомендациями производителя и очищали с помощью набора реагентов RNeasy Plus Mini Kit (Qiagen, Германия). Количество РНК измеряли с помощью флуориметра Qubit (Invitrogen, США). кДНК Д2-рецепторов синтезировали с oligo-dT праймеров GCAGCCAGCAGATGATGAACAC, AGACGATGAGCCGCAGAAAGC с помощью кита SuperScript III (Invitrogen, США). При стандартизации реакции определяли содержание мРНК актина по двум праймерам: GCACGGCATCATCACGAACTG и GTCATCTTCTCCCTGTTGGCTTTAG. Измерение проводили с использованием интеркалирующего красителя SYBRGreen на приборе Chromo4 (Biorad, Великобритания).

Иммуноцитохимия. Для пероксидазного моно-иммуномечения ТГ и дофамин--гидроксилазы на криостате Leica С1850 (Leica, Германия) были приготовлены серийные фронтальные срезы аркуатного ядра (от 2.12 мм до 3.60 мм каудальнее брегмы) толщиной 16 мкм. Для моно-иммуномечения ТГ использовали кроличьи поликлональные антитела к ТГ (1:2000) (предоставлены проф. Тибо, Франция), вторые биотинилированные антитела (1:200) (Vector Laboratories, США) и авидин-биотиновый комплекс, связанный с пероксидазой (Vector Laboratories, США).

Для моно-иммуномечения дофамин--гидроксилазы использовали мышиными моноклональные антитела к дофамин--гидроксилазе (1:200) (Millipoore, США), вторые биотинилированные антитела (1:200) (Vector Laboratories, США) и авидин-биотиновый комплекс, связанный с пероксидазой.

Пероксидазу авидин-биотинового комплекса выявляли инкубацией с диаминобензидином (Sigma, США) и H2O2.

Микроскопия, анализ изображений. Срезы аркуатного ядра после пероксидазной реакции исследовали в световом микроскопе Olympus BX(Olympus, Япония), оснащенном цифровой камерой Olympus DP70 (Olympus, Япония): ТГ-иммунореактивные нейроны при увеличении объектива 20/0.5, дофамин--гидроксилаза-иммунореактивные терминали при увеличении х100/1.30. Изображения срезов анализировали с помощью программы АnalySIS 5.0. (Olympus, Япония) - на каждом срезе аркуатное ядро подразделяли на дорсомедиальную и вентролатеральную области в соответствии с атласом мозга крысы, после чего подсчитывали число ТГ-содержащих нейронов с видимым ядром и число дофамин--гидроксилаза-содержащих терминалей.

Для полуколичественного анализа ТГ в нейронах аркуатного ядра на каждом срезе обводили все ТГ-иммунореактивные нейроны. Оптическую плотность нейронов, коррелирующую с концентрацией ТГ, определяли как «уровень серого» по следующей формуле: оптическая плотность = log (уровень серогофона /уровень серогосигнала).

Статистическая обработка результатов. Полученные данные обрабатывали статистически с использованием теста Стьюдента для определения достоверных различий. Кроме того, определяли доверительный интервал при уровне достоверности 95% (p < 0.05).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ОБСУЖДЕНИЕ Эффективность токсического действия 6-ГДА и протекторного действия ДМИ. Аффинность захвата 6-ГДА ДА-ергическими нейронами гипоталамуса, а, следовательно, и эффективность его токсического действия, значительно ниже, чем у нейронов нигростриатной системы. Поэтому при анализе действия 6-ГДА на нейроны гипоталамуса в одной из серий наших экспериментов в качестве контроля дана оценка действия этого токсина на классические ДА-ергические нейроны нигростриатной системы. 6-ГДА в нигростриатной системе вызвал значительное снижение содержания ДА:

в черной субстанции, содержащей тела нейронов - к 14-му дню на 30%, что сохранилось до 45-го дня, в стриатуме – в области проекций аксонов - на 72% и 85% (рис. 2А, Б). Эти результаты хорошо согласуются с данными литературы о гораздо более высоком содержании молекул мембранного переносчика ДА в аксонах по сравнению с телами нейронов (Freed et al., 1995).

На 14-й день после введения 6-ГДА в сочетании с ДМИ содержание НА в черной субстанции не отличалось от контроля, а на 45-й день было ниже всего на 16%. Более того, в стриатуме содержание НА как на 14-й, так и на 45-й день значительно выше, чем в контроле (рис. 2А, Б). Все это является показателем отсутствия дегенерации НА-ергических нейронов, следовательно, ДМИ может быть использован для предотвращения токсического действия 6-ГДА.

Рис. 2. НА, ДА - (А) содержание в черной субстанции (ЧС) и (Б) концентрация в стриатуме (СТ) на 14-й и 45-й дни после введения ДМИ и 6-ГДА. Контроль принят за 100%.

*P < 0.05 по сравнению с контролем.

В аркуатном ядре наблюдается более слабое воздействие токсина на НА-ергические аксоны на фоне протекторного эффекта ДМИ, так как уровень НА снизился на 14-й день всего на 20%, а на 45-й день - в опыте не отличалось от контроля (рис. 3). Вопреки общим представлениям о более низком содержании молекул переносчика ДА в нейронах тубероинфундибулярной системы по сравнению с нейронами нигростриатной системы, в наших экспериментах обнаружено значительное снижение уровня ДА в аркуатном ядре. На 14-й день после введения ДМИ и 6-ГДА содержание ДА снизилось на 75%,и к 45-му дню было ниже на 90% при почти неизменном уровне НА (рис. 3).

Рис. 3. НА, ДА, L-ДОФА – содержание в аркуатном ядре (АЯ) на 14-й и 45-й дни после введения ДМИ и 6-ГДА. Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

Повышенный уровень L-ДОФА в аркуатном ядре на 14-й день (рис. 3) говорит о том, что он, возможно, синтезируется в моноферментных неДАергических нейронах как конечный продукт синтеза. Таким образом, токсическое действие 6-ГДА и протекторное действие ДМИ более выражены в нигростриатной системе, чем в тубероинфундибулярной.

Модели гиперпролактинемии. Ранее на модели гиперпролактинемии, разработанной в нашей лаборатории с помощью 6-ГДА, было показано, что при дефиците НА уровень ДА в аркуатном ядре со временем восстанавливается (Зиязетдинова и др., 2008). Предварительные результаты, полученные после модифицирования данной модели дополнительным введением ДМИ – протектора НА-ергических нейронов, показали, что при сохранении нормального уровня НА восстановления ДА не происходит (рис. 3). Исходя из этого мы предположили, что существует ингибиторное влияние НА на синтез ДА в аркуатном ядре. Это предположение косвенно подтверждается тем, что ДА-ергические нейроны аркуатного ядра иннервируются НА-ергическими аксонами (Leshin et al., 1996), причем НА оказывает ингибирующее влияние на функциональную активность ДА-ергических нейронов (Guiard et al., 2008). Для проверки данного предположения использовали обе модели гиперпролактинемии.

На первой модели (рис. 4А) 6-ГДА вызывает дегенерацию не только ДА-ергических нейронов, но и НА-ергических аксонов аркуатного ядра.

Действительно, по нашим иммуноцитохимическим данным на этой модели в аркуатном ядре остается всего 40% терминалей НА-ергических аксонов, так как нет протекторного эффекта ДМИ (рис. 4А). Это коррелирует со значительным снижением уровня НА в аркуатном ядре как на 14-й, так и на 45-й день (рис. 4А). Таким образом, была получена модель гиперпролактинемии, развивающейся при дефиците НА и ДА.

На второй модели (рис. 4Б) при введении 6-ГДА в сочетании с ДМИ в аркуатном ядре сохраняется 75% терминалей НА-ергических аксонов, что коррелирует уровнем НА в аркуатном ядре, который мало отличается от контрольного и в четыре раза выше, чем после введения только 6-ГДА (рис. 4Б). Таким образом, была получена модель гиперпролактинемии, развивающейся при дефиците только ДА.

Рис. 4. Содержание НА и количество дофамин--гидроксилаза-иммунореактивных терминалей в аркуатном ядре (АЯ) на 14-й и 45-й дни после введения (А) 6-ГДА или (Б) ДМИ и 6-ГДА. Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

Секреция НА, ДА и L-ДОФА в аркуатном ядре после дегенерации НА-ергических и ДА-ергических или только ДА-ергических нейронов.

В экспериментах in vivo невозможно в полной мере оценить за счет чего изменяется секреция НА и ДА в аркуатном ядре после введения токсина - вследствие изменения их синтеза или выделения, поэтому в дополнение к исследованиям in vivo (рис. 3) были проведены эксперименты in vitro (рис. 5А, Б; 6А, Б) для оценки скорости синтеза НА и ДА в срезах аркуатного ядра. Мы оценивали выделение в среду (рис. 5А, Б), накопление в ткани (рис. 6А) и определяли общее содержание НА, ДА, L-ДОФА в ткани после инкубации и в инкубационной среде, что рассматривалось как показатель уровня их синтеза (рис. 6Б).

При введении 6-ГДА или ДМИ и 6-ГДА выделение НА в аркуатном ядре снижается (рис. 5А, Б), однако только при дегенерации НА-ергических аксонов значительно снижается его накопление (рис. 6А) и синтез (рис. 6Б), что свидетельствует о функциональной недостаточности НА-ергической системы.

На 14-й день спонтанное выделение ДА в аркуатном ядре на обеих моделях усиливается (рис. 5А), но при этом ДА-ергическая система утрачивает способность выделять ДА в ответ на стимуляцию (рис. 5Б), что, вероятно, свидетельствует об истощении внутриклеточного содержания ДА (рис. 6А), и в целом снижается его синтез (рис. 6Б). На 45-й день при дефиците НА спонтанное выделение ДА резко снижается (рис. 5А), при этом происходит накопление ДА в ткани аркуатного ядра (рис. 6А), что в совокупности характеризует усиление его синтеза (рис. 6Б). При сохранении НА-ергического влияния спонтанное выделение ДА также снижается (рис. 5А), но накопление в ткани остается таким же, как и на 14-й день (рис. 6А), и, следовательно, синтез ДА снижается даже по сравнению с 14-м днем (рис. 6Б). На основании этого можно сделать вывод, что НА ингибирует синтез ДА в нейронах аркуатного ядра.

Рис. 5. НА, ДА, L-ДОФА – среднее по шести фракциям среды с нормальным (А - спонтанное выделение) и повышенным (Б - стимулированное выделение) содержанием калия, собранных во время инкубации срезов аркуатного ядра на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА. Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

На обеих моделях L-ДОФА на 14-й день усиленно выделяется в среду (рис. 5А, Б) и его накопление в ткани не снижается (рис. 6А), в целом синтез L-ДОФА в аркуатном ядре увеличивается (рис. 6Б), что говорит о его синтезе в моноферментных нейронах как конечный продукт. На 45-й день выделение (рис. 5А), накопление (рис. 6А) и синтез (рис. 6Б) L-ДОФА в аркуатном ядре снижается на обеих моделях, причем в присутствии НА-ергического влияния снижение более выражено, что свидетельствует об ингибирующем влиянии НА на синтез L-ДОФА в моноферментных нейронах аркуатного ядра.

Рис. 6. НА, ДА, L-ДОФА – содержание в ткани аркуатного ядра после инкубации (А - накопление) и общее содержание в инкубационной среде и в ткани после инкубации (Б - синтез) на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА.

Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

Более того, на основании приведенных выше данных о метаболизме НА, ДА и L-ДОФА можно предположить, что НА ингибирует не только синтез ДА в ДА-ергических нейронах, но также экспрессию ферментов синтеза ДА в неДА-ергических нейронах и, следовательно, кооперативный синтез ДА, что было экспериментально проверено в дальнейших исследованиях.

Влияние НА на экспрессию ТГ в нейронах аркуатного ядра. При введении 6-ГДА или 6-ГДА в сочетании с ДМИ происходит дегенерация 70-80% ТГ-содержащих нейронов в дорсомедиальной области аркуатного ядра (рис. 7, 8), где локализованы в основном биферментные ДА-ергические нейроны, что объясняет значительное снижение уровня синтеза ДА на 14-й день на обеих моделях (рис. 6Б). На 45-й день при дефиците НА-ергического влияния наблюдается увеличение числа ТГ-содержащих нейронов в вентролатеральной области аркуатного ядра (рис. 7А, Б; 8), где содержатся преимущественно неДА-ергические нейроны, экспрессирующие только ТГ (Okamura et al., 1988) и участвующие в кооперативном синтезе ДА. Кроме того, отмечено увеличение содержания самой ТГ в этих нейронах (рис. 9), тогда как при сохранении НА-ергического влияния оба вышеупомянутых показателя были меньше, чем при дефиците НА-ергического влияния (рис. 7А, В; 8, 9).

А Б В ДМ ДМ ДМ III ВЛ ВЛ III III ВЛ СВ ME СВ СВ Рис. 7. ТГ-иммунореактивные нейроны в дорсомедиальной (ДМ) и вентролатеральной (ВЛ) областях аркуатного ядра (А) в контроле, на 14-й день после введения (Б) 6-ГДА или (В) ДМИ и 6-ГДА. Объектив х20. III – третий желудочек, СВ – срединное возвышение.

Рис. 8. Количество ТГ-иммунореактивных нейронов в дорсомедиальной (ДМ) и вентролатеральной (ВЛ) областях аркуатного ядра (АЯ) на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА. Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

Рис. 9. Оптическая плотность ТГ в нейронах дорсомедиальной (ДМ) и вентролатеральной (ВЛ) областей аркуатного ядра на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА.

Отн. ед. – относительные единицы. *P < 0.05 по сравнению с контролем.

Полученные морфологические данные свидетельствуют об ингибиторном влиянии НА на экспрессию ТГ в нейронах аркуатного ядра, что хорошо согласуется с данными Daikoku с соавторами (Daikoku et al., 1986), показавшими, что хирургическая деафферентация медиобазального гипоталамуса приводит к увеличению числа ТГ-иммунореактивных нейронов в вентролатеральной области аркуатного ядра. Прямое доказательство НА-ергического ингибиторного контроля экспрессии ТГ в неДА-ергических нейронах было получено по отношению к вазопрессинергическим нейронам супраоптического ядра (Abramova et al., 2011).

Рис. 10. Уровень НА и ДА в аркуатном ядре на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА.

Дополнительным доказательством НА-ергического ингибиторного контроля экспрессии ТГ в неДА-ергических нейронах может служить более выраженное снижение синтеза L-ДОФА в аркуатном ядре при возвращении уровня НА к норме на 45-й день после введения ДМИ и 6-ГДА (рис. 6Б).

Действительно, только в нейронах, содержащих единственный фермент синтеза ДА - ТГ - возможно накопление L-ДОФА, который является в этих нейронах конечным синтетическим продуктом (Ugrumov, 2008; Угрюмов, 2009).

В ДА-ергических нейронах L-ДОФА является промежуточным продуктом синтеза и содержится в следовых количествах, поскольку активность декарбоксилазы ароматических аминокислот, фермента катализирующего превращение L-ДОФА в ДА, на два порядка выше активности ТГ.

Влияние ДА и НА на уровень мРНК Д2-рецепторов в гипофизе.

Содержание мРНК Д2-рецепторов в передней доле гипофиза на 14-й день после введения 6-ГДА снизилось на 35%, а на 45-й день восстановилось до контрольного уровня (рис. 11). Учитывая то, что ранее на этой же модели было показано снижение и последующее восстановление уровня ДА в аркуатном ядре (Зиязетдинова et al., 2008) (рис. 10), можно говорить о стимулирующем влиянии ДА на синтез мРНК Д2-рецепторов. На 14-й день после введения 6-ГДА в сочетании с ДМИ уровень мРНК Д2-рецепторов в гипофизе не изменился (рис. 11), что можно объяснить тем, что дефицит влияния ДА на Д2-рецепторы гипофиза в этом опыте компенсируется синергичным влиянием на них НА. Действительно, известно, что НА, так же как и ДА, может влиять на Д2-рецепторы клеток-мишеней (Odagaki et al., 1995), но обладает при этом гораздо меньшей аффинностью к этим рецепторам (Newman-Tancredi et al., 1997). При сохранении НА-ергического влияния на 45-й день уровень мРНК Д2-рецепторов снизился на 25% при еще большем снижении ДА в аркуатном ядре (рис. 10, 11), то есть ингибирование синтеза мРНК Д2-рецепторов при недостатке ДА все-таки проявилось. Из приведенных выше результатов следует, что ингибирование синтеза мРНК Д2-рецепторов начинается при определенном пороговом уровне дефицита ДА, который зависит и от уровня НА.

Рис. 11. Содержание мРНК Д2-рецепторов в передней доле гипофиза на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА. Контроль принят за 100%.

*P < 0.05 по сравнению с контролем.

Развитие гиперпролактинемии в условиях дефицита НА и ДА или только ДА. На обеих моделях на 14-й день концентрация пролактина в плазме на 130% выше нормы (рис. 12А), а содержание пролактина в гипофизе меньше, чем в контроле (рис. 12Б), что свидетельствует о большей скорости выделения пролактина по сравнению со скоростью его синтеза и коррелирует с пониженным содержанием ДА на обеих моделях (рис. 10). Таким образом, на 14-й день при функциональной недостаточности ДА-ергических нейронов аркуатного ядра, в условиях как дефицита, так и сохранности НА-ергического влияния, развивается гиперпролактинемия. На первой модели при дефиците НА вслед за восстановлением уровня ДА в аркуатном ядре (рис. 10) пролактин в плазме к 45-му дню возвращается к норме (рис. 12А), но синтез пролактина в гипофизе не меняется (рис. 12Б). Это свидетельствует о замедлении секреции пролактина при восстановлении ингибиторного ДА-ергического контроля, в результате чего гиперпролактинемия компенсируется. При сохранении НА-ергического влияния на 45-й день концентрация пролактина в плазме не нормализуется (рис. 12А), содержание пролактина в гипофизе повышается по сравнению с 14-м днем (рис. 12Б). Это связано с усилением синтеза (рис. 12Б) и выделения (рис. 12А) пролактина при понижении ингибиторного влияния ДА (рис. 10). Следует вывод, что ДА ингибирует сначала выделение, а затем и синтез пролактина, но при сохранении НА-ергического влияния ингибируется синтез самого ДА, и гиперпролактинемия не компенсируется.

Рис. 12. Пролактин (ПРЛ) - (А) концентрация в плазме и (Б) содержание в передней доле гипофиза на 14-й и 45-й дни после введения 6-ГДА или ДМИ и 6-ГДА.

Контроль принят за 100%. *P < 0.05 по сравнению с контролем.

Итак, на обеих моделях на 14-й день наблюдалась гиперпролактинемия, которая при дефиците НА, но при восстановлении уровня ДА в аркуатном ядре со временем компенсируется, в то время как при сохранении НА-ергического влияния и продолжающемся снижении уровня ДА - не компенсируется. Таким образом, НА подавляет компенсаторный синтез ДА, ингибируя экспрессию ТГ, вероятно, в моноферментных неДА-ергических нейронах аркуатного ядра. Это является одним из механизмов регуляции секреции пролактина норадреналином.

ВЫВОДЫ 1. Экспериментально смоделирована функциональная недостаточность ДА-ергических нейронов аркуатного ядра в условиях (а) дефицита или (б) сохранности НА-ергического влияния.

2. В исследованных моделях токсическое действие 6-ГДА и протекторное действие ДМИ более выражены в нигростриатной системе, чем в тубероинфундибулярной.

3. НА подавляет компенсаторный синтез ДА, ингибируя экспрессию ТГ, вероятно, в моноферментных неДА-ергических нейронах аркуатного ядра.

4. Ингибирование синтеза мРНК Д2-рецепторов начинается при определенном пороговом уровне дефицита ДА, который зависит и от уровня НА.

5. Гиперпролактинемия, развивающаяся в условиях дефицита НА и ДА, со временем компенсируется, а в условиях дефицита только ДА – не компенсируется.

Статьи в журналах, соответствующих Перечню ВАК 1. Дильмухаметова Л.К., Пронина Т.С., Зиязетдинова Г.З., Кудрин В.С., Угрюмов М.В. Роль норадреналина в развитии дофамин-зависимой гиперпролактинемии // Нейрохимия. 2009. Т. 26. №4. C. 318-327.

2. Дильмухаметова Л.К., Пронина Т.С., Зиязетдинова Г.З., Воробьева Н.Е., Николенко Ю.В., Краснов А.Н., Георгиева С.Г., Угрюмов М.В.

Функциональная активность лактотрофов при недостаточности дофаминергической системы гипоталамуса // Доклады Академии Наук. 2010.

Т. 430. №2. C. 273-276.

Глава в коллективной монографии Пронина Т.С., Дильмухаметова Л.К., Угрюмов М.В. Модель гиперпролактинемии. В кн: «Нейродегенеративные заболевания:

фундаментальные и прикладные аспекты» - М.: Наука. 2010. С. 229-234.

Список сокращений L-ДОФА, L-диоксифенилаланин 6-ГДА, 6-гидроксидофамин ДА, дофамин ДА-ергический, дофаминергический ДМИ, десметилимипрамин НА, норадреналин НА-ергический, норадренергический неДА-ергический, недофаминергический ТГ, тирозингидроксилаза




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.