WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Аммур Юлия Игоревна

РАЗРАБОТКА МЕТОДОВ КОЛИЧЕСТВЕННОГО ОПРЕДЕЛЕНИЯ ВАКЦИННЫХ ШТАММОВ ВИРУСОВ КОРИ, ЭПИДЕМИЧЕСКОГО ПАРОТИТА И КРАСНУХИ НА ОСНОВЕ ПЦР С ДЕТЕКЦИЕЙ В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ

03.02.02 – вирусология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва - 2012

Работа выполнена в Федеральном государственном бюджетном учреждении “Научно-исследовательский институт вакцин и сывороток им. И.И.Мечникова” Российской академии медицинских наук Научные руководители:

доктор биологических наук Борисова Татьяна Константиновна кандидат биологических наук Файзулоев Евгений Бахтиерович

Официальные оппоненты:

Маркушин Станислав Георгиевич, доктор медицинских наук, ФГБУ «НИИВС им.

И.И. Мечникова» РАМН, заведующий лабораторией генетики РНК-содержащих вирусов Носик Дмитрий Николаевич, доктор медицинских наук, профессор, ФГБУ «НИИ вирусологии им. Д.И. Ивановского» Минздравсоцразвития России, заместитель директора, руководитель лаборатории вирусов иммунодефицита

Ведущая организация:

Федеральная служба по надзору в сфере защиты прав потребителей и благополучию человека Научно-исследовательский институт эпидемиологии и микробиологии имени Пастера.

Защита состоится «20» декабря 2012 г. в 11 часов на заседании диссертационного совета Д 001.035.01 при ФГБУ “НИИВС им. И.И. Мечникова” РАМН по адресу:

105064, г. Москва, Малый Казенный пер., д. 5а.

С диссертацией можно ознакомиться в библиотеке ФГБУ “НИИВС им. И.И.

Мечникова” РАМН.

Автореферат разослан «___» ноября 2012 г.

Ученый секретарь диссертационного совета кандидат биологических наук И.В. Яковлева

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы.

Вакцинопрофилактика – это наиболее эффективный и экономически доступный путь борьбы с вирусными заболеваниями. Благодаря массовой вакцинации населения заболеваемость корью, эпидемическим паротитом и краснухой (КПК) была снижена в сотни раз. Но, несмотря на очевидные успехи вакцинопрофилактики, региональные цели элиминации кори и краснухи не могут быть достигнуты, о чем свидетельствуют факты эпидемического неблагополучия в ряде европейских стран и стран СНГ [Онищенко Г.Г., 2011].

При разработке и производстве вакцин необходимо решать множество проблем. Одной из важнейших является отсутствие экспресс-методов для оценки титра вируса в процессе культивирования для определения времени сбора вирусного материала. Специфическая активность вирусов КПК в вируссодержащих жидкостях традиционно оценивается в реакции бляшкообразования (БО) или методом предельных разведений по цитопатическому действию (ЦПД). Недостатками этих методов являются их длительность и трудоемкость, сложность в стандартизации и зависимость от внешних факторов. Так, для вирусов эпидемического паротита (ЭП) и краснухи время проведения реакции БО и титрования по ЦПД составляет 812 дней. Кроме того, применение этих методов для мультивалентных препаратов вакцин требует дополнительного использования высокоспецифичных антител для каждого компонента вакцины. Таким образом, в настоящее время остается актуальной проблема создания современных методов оценки инфекционного титра вирусов КПК, обеспечивающих высокую специфичность, чувствительность и стандартность проведения реакции.

Одним из показателей интенсивности вирусной репродукции является накопление в культуре клеток вирусных нуклеиновых кислот (НК).

Современные модификации метода полимеразной цепной реакции (ПЦР) позволяют количественно определять НК, в том числе вирусные.

Достоинствами метода ПЦР являются высокая специфичность, чувствительность, универсальность анализа, стандартность проведения реакции, малая длительность процедуры, возможность выявления сразу нескольких вирусов, (мультиплексная ПЦР). Метод ПЦР с детекцией в режиме реального времени (ПЦР-РВ) широко используется для количественной оценки вирусных НК в биологических образцах, в том числе зараженных органах и тканях. В то же время, вопрос о том, в каком соотношении в зараженной культуре клеток присутствуют вирусные НК и инфекционный вирус, а также в какой степени накопление НК коррелирует с интенсивностью вирусной репродукции остается малоизученным. Выяснение этого вопроса позволило бы разработать методические подходы для количественной оценки вируса с помощью метода ПЦР-РВ.

Цель исследования: разработка методов количественного определения вакцинных штаммов вирусов КПК с помощью ПЦР-РВ.

Задачи исследования:

получение вирусного материала при культивировании вакцинных штаммов вирусов кори (L-16), ЭП (L-3) и краснухи (Wistar RA 27/3) на различных культурах клеток (Vero, BHK-21, ДКЧ);

подбор праймеров и зондов для выявления вирусов КПК и анализ их специфичности;

отработка методических приемов количественного определения вирусов КПК с помощью ПЦР-РВ;

определение титра вирусов КПК в вируссодержащих культуральных жидкостях с помощью классических методов и разработанного метода на основе ПЦР-РВ и проведение корреляционного анализа результатов;

оптимизация условий мультиплексной ПЦР для одновременного выявления вирусов КПК.

Научная новизна.

В настоящем исследовании на основе ПЦР-РВ разработаны новые методические подходы для оценки титра вирусов КПК в вакцинных препаратах.

Показана высокая корреляция между значениями титров вирусов КПК, определенными культуральным методом и методом на основе ПЦР-РВ.

Установлены факторы, влияющие на точность определения титра вирусов КПК методом на основе ПЦР-РВ.

Впервые показано, что отечественная диплоидная клеточная линия М-является пермиссивной для вируса краснухи, что позволяет рассматривать ее в качестве клеточного субстрата для получения вирусного материала.

Практическая значимость.

На основе ПЦР-РВ разработаны методы определения титров вирусов КПК в культуральных образцах. Разработанные методы обеспечивают высокую специфичность, чувствительность, стандартность проведения реакции и, что немаловажно, меньшую длительность проведения процедуры (5-6 часов работы) в сравнении с классическими методами. Разработанные методы способны повысить эффективность контроля качества вирусного материала, а также могут быть использованы при производстве вакцинных препаратов для определения времени сбора вирусного материала в процессе приготовления вакцин.

Отработаны условия для выявления РНК вирусов КПК в мультиплексном формате ПЦР-РВ. Разработанные методические подходы могут быть использованы для определения этиологии поствакцинальных осложнений.

Основные положения, выносимые на защиту:

1. Разработаны методы определения титров вирусов КПК на основе ПЦР с детекцией в режиме реального времени в культуральных образцах.

2. Установлена высокая корреляция значений титров вирусов КПК, получаемых методом на основе ПЦР-РВ, с результатами титрования по ЦПД соответствующих вирусов.

3. При апробации метода на культурах клеток Vero, BHK-21, MRC-5, M29 установлено, что точность определения титра вирусов КПК методом на основе ПЦР-РВ зависит от типа клеточной линии, используемой для получения исследуемого и калибровочного материала.

4. При апробации метода в экспериментах с различной множественностью заражения клеточного монослоя показана обратная зависимость между множественностью инфекции и точностью определения титра вирусов КПК методом на основе ПЦР-РВ.

5. Показана возможность выявления вирусов КПК в мультиплексном формате ПЦР-РВ.

Апробация работы состоялась 07 июня 2012 года на научной конференции отдела вирусологии ФГБУ «НИИВС им. И.И. Мечникова» РАМН.

Результаты исследований представлены и обсуждены на XVII международной научной конференции студентов, аспирантов и молодых ученых «Ломоносов-2010» (г. Москва, 2010 г.), международной конференции «Развитие научных исследований и надзор за инфекционными заболеваниями» (г. Санкт-Петербург, 2010 г.), Всероссийском ежегодном конгрессе «Инфекционные болезни у детей: диагностика, лечение и профилактика» (г. Санкт-Петербург, 2010 г.), конференции молодых ученых НИИВС им. И.И. Мечникова (г. Москва, 2011 г.), III Ежегодном международном конгрессе «BIT’s 3rd Annual World Vaccine Congress – 2011, The Future of Global Vaccines» (г. Пекин, Китай, 2011 г.), V Международном Симпозиуме «“qPCR 2011 Event Proceedings” 5th International qPCR Symposium, Industrial Exhibition & Application Workshop, Molecular Diagnostics: from single-cells to Next Generation Sequencing» (г. Фрайзинг, Германия, 2011 г.).

Публикации.

По материалам диссертации опубликовано 12 печатных работ, в том числе 5 статей в изданиях, рекомендованных ВАК РФ.

Объем и структура диссертации.

Диссертационная работа состоит из введения, обзора литературы, описания материалов и методов, собственных результатов и их обсуждения, заключения, выводов и списка литературы, включающего 199 источников.

Работа изложена на 148 страницах машинописного текста и включает таблиц и 31 рисунок.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования.

В работе были использованы вакцинные штаммы вируса кори L-(титр 5,5-5,7 lg ТЦД50/мл), вируса эпидемического паротита L-3 (титр 5,55,7 lg ТЦД50/мл), любезно предоставленные сотрудником ФГБУ «НИИВС им.

И.И.Мечникова» РАМН в.н.с. Ведуновой С.Л., и вируса краснухи Wistar RA 27/3 (титр 3,8-4,0 lg ТЦД50/мл, полуфабрикат вакцинного препарата), предоставленный МПБП ФГУП «НПО Микроген» (Россия).

В качестве лабораторных контрольных препаратов были использованы образцы культуральной жидкости, содержащие вирус кори (штамм L-16, титр 6,4 lg ТЦД50/мл), ЭП (штамм L-3, титр 7,1 lg ТЦД50/мл) или краснухи (штамм Wistar RA 27/3, титр 6,3 lg ТЦД50/мл), полученные в культуре клеток Vero.

В качестве контрольных препаратов были использованы: препарат международного стандарта вируса краснухи (1st International Reference Reagent for Rubella (Live), NIBSC Code 91/688, Version 03, Англия) – вакцинный штамм Wistar RA 27/3, полученный в диплоидных клетках человека MRC-5 с титром 103,9инф. ед./мл; коммерческий препарат (вакцина против краснухи живая аттенуированная) – Rubella Vaccine Live B.P. (RVACTM, лиофилизированный препарат вакцинного штамма вируса краснухи Wistar RA 27/3, Serum Institute of India; титр не менее чем 1000 ТЦД50/мл).





Перевиваемые культуры клеток Vero (WHO), BHK-21, RK-13 и полуперевиваемая диплоидная клеточная линия MRC-5 были получены из Российской коллекции клеточных культур (Институт цитологии РАН, СанктПетербург, Россия). Диплоидная клеточная линия М-29 была любезно предоставлена профессором Л.Л. Мироновой (Институт полиомиелита и вирусных энцефалитов им. М. П. Чумакова РАМН).

Клеточные линии инкубировали в питательной среде MEM (Gibco, США) или RPMI-1640 (Gibco) в присутствии 10% эмбриональной телячьей сыворотки (ЭТС) (HyClone, США), 1 мM глютамина (Gibco) и 50 мкг/мл гентамицина (Gibco) при температуре 37 °C в атмосфере 5 % CO2. При достижении клетками монослоя проводили пересев культуры.

Для заражения клеточного монослоя с различной множественностью заражения клетки инкубировали с разведенным вирусным материалом при °C и 5 % CO2 в течение 30 – 90 мин. После вирусной адсорбции клеточный монослой промывали и культивировали в питательной среде MEM с 2 % ЭТС в течение 7 – 12 суток при 35 °C (для вируса ЭП) или 32 °C (для вирусов кори и краснухи) в атмосфере 5 % CO2. Культуральную жидкость собирали ежедневно с зараженной клеточной культуры, осветляли центрифугированием в центрифуге LMC-3000 (Biosan, США) при 30об/мин в течение 10 мин и хранили при -70 °C до использования.

Титрование вирусов КПК методом предельных разведений по ЦПД в чувствительной культуре клеток RK-13 (для вируса краснухи) или Vero (для вирусов кори и ЭП) проводили в 96-луночных планшетах (Greiner BioOne, Австрия) согласно общей методике [Fogel A., 1969]. Планшеты инкубировали при 32 °C (для вирусов кори и краснухи) или 35 °C (для вируса ЭП) при 5 % CO2 в течение 10-12 суток. Начиная с 4 – 7-ых суток после заражения, клетки проверяли на наличие цитопатического эффекта и учитывали положительные лунки. При каждом определении титра вируса по ЦПД параллельно исследовали лабораторный контрольный препарат соответствующего вируса с известным титром для контроля калибраторов и воспроизводимости метода. Титр рассчитывали в lg ТЦД50/мл по методу Рида и Менча [Reed L.J., 1938].

Анализ нуклеотидных последовательностей вирусов КПК, полученных из электронной базы данных GenBank (NCBI), подбор последовательностей праймеров и зондов для ПЦР-РВ проводили с помощью компьютерных программ FastPCR (PrimerDigitalLtd., Финляндия) и Vector NTI Advance 9.0 (InforMax Inc., США).

Для определения титра вирусов КПК по содержанию вирусной РНК вирусную РНК из образцов и калибраторов выделяли при помощи коммерческого набора «QIAamp Viral RNA Mini Kit» (Qiagen, Германия) согласно инструкции.

При постановке реакции ОТ 2 мкл обратного праймера Rubr, Mef или Muf (табл. 1) в концентрации 5 пмоль/мкл смешивали с 10 мкл соответствующей вирусной РНК и прогревали в течение 5 минут при 65 С в термостате «Термит» (ДНК-технология, Россия). Далее в 30 мкл реакционной смеси, содержащей помимо праймер и РНК, 10-кратный буфер (Синтол, Россия), 0,5 мМ дНТФ (Синтол), 2,5 мМ MgCl2 (Синтол), 4 ед. ингибитора рибонуклеаз (Сибэнзим, Россия), 50 ед. ревертазы вируса лейкоза Молони (MuLV; Сибэнзим), в течение 30 минут при 42 °C получали кДНК в амплификаторе «Терцик» (ДНК-Технология). Фермент инактивировали нагреванием при 95 °C в течение 5 минут.

Образцы анализировали методом ПЦР-РВ по типу «выщепления 5'концевой метки» (TaqMan®). Амплификацию проводили в 50 мкл реакционной смеси, содержащей 10-кратный буфер, прямой и обратный праймеры (по 10 пмоль каждого), 5 пмоль зонда, 0,5 мМ дНТФ, 2,5 мМ MgCl2, 2,5 ед. HotStart Taq ДНК-полимеразы (Синтол) и 5 мкл кДНК.

Реакцию проводили в термоциклере АНК-32 (Институт аналитического приборостроения РАН, г. Санкт-Петербург, Россия) или ДТ-96 (ДНКтехнология). Программа ПЦР: 120 сек при 95 °С – 1 цикл, 50 сек при 58 °С и 20 сек при 95 °С – 45 циклов.

При мультиплексной реакции реакцию ОТ проводили как описано выше с 3 мкл эквимолярной смеси праймеров Rubr-Mef-Muf Образцы анализировали методом ПЦР-РВ как описано выше с добавлением 3-х или 4х пар праймеров (по 10 пмоль каждого) и 3-х или 4-х флуоресцентномеченных красителем зондов (по 5 пмоль каждого) в реакционную смесь.

Данные представлены в виде М±m, где М – среднее арифметическое, m – стандартное отклонение. Оценку достоверности разницы двух средних показателей проводили с помощью t-критерия Стьюдента. Корреляционный анализ между титрами одного и того же образца, полученными методом ПЦР-РВ и по ЦПД, проводили с помощью «диаграммы рассеяния» или выборочного линейного парного коэффициента корреляции К. Пирсона.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ Разработка метода количественного определения вирусов кори, эпидемического паротита и краснухи с помощью ПЦР-РВ.

Подбор праймеров и зондов для выявления вирусов кори, эпидемического паротита и краснухи и анализ их специфичности Путем множественного выравнивания всех доступных на момент начала исследования полных геномных последовательностей вакцинных и диких штаммов вирусов КПК были подобраны последовательности праймеров и зонда для каждого вируса, направленных к консервативным участкам геномов для обеспечения их универсальности для различных штаммов вирусов КПК (табл. 1). При компьютерном анализе последовательности сконструированных олигонуклеотидов не образовывали стабильные вторичные структуры в виде шпилек и термодинамически стабильные гомо– и гетеродимеры.

Специфичность праймеров и зондов была показана электрофоретическим анализом ампликонов и подтверждена ростом сигналов соответствующих флуоресцентных красителей в ПЦР-РВ на РНКматрицах вакцинных штаммах вирусов кори L-16, ЭП L-3 и краснухи Wistar RA27/3. В результате амплификации неспецифических ПЦР-продуктов не образовывалось, что подтверждало высокую специфичность праймеров для вирусов КПК.

Таблица 1.

Олигонуклеотидные последовательности праймеров и зондов, использованных в работе.

Позиция в Вирус Название 5’3’ последовательность геноме AAGGTGGATAAAGTACACCCAA 690-7Mef Вирус TGTCACATATCATTTCAGCAAT 856-8Mer кори R6G-CCAACCATTTTCTCTCCAATCTAAATTCACC-BHQ1 727-7MeV CTGTTCTGCTAGATGAGATGCA 5327-53Muf Вирус ЭП AGCCTCTCTGCCTCATTGTA 5548-55Mur FAM-TCACACAATCAAATGCATTGGTGATTGAC-BHQ1 5381-54MuV GTCATCACCCACCGTTGT 6435-64Rubf Вирус CCTTCTGGAGGTCCTCCAT 6536-65Rubr краснухи ROX-AGAGCCCCAGGGTGCCCGAAT-BHQ2 6493-65RubV ПРИМЕЧАНИЕ. Mef, Muf, Rub1 и Rubf– прямые праймеры, Mer, Mur, Rub2 и Rubr – обратные праймеры, MeV, MuV, RubZ и RubV – зонды.

Оптимизация условий количественного определения вирусов кори, эпидемического паротита и краснухи методом ПЦР-РВ С целью достижения максимальной чувствительности теста, условия проведения ПЦР-РВ были оптимизированы эмпирически по концентрации MgCl2, праймеров и зонда в реакционной смеси и температуре отжига. Были установлены оптимальная температура отжига – 58 °C и концентрация MgClв реакционной смеси – 2,5 мM, использованные в дальнейшей работе.

Влияние концентрации праймеров и зондов оценивали как на этапе ОТ, так и ПЦР, используя 10-кратные и 1000-кратные разведения РНК вирусов КПК. Полученные значения пороговых циклов (Ct) практически не отличались при концентрации праймеров, варьирующей в интервале от 15 до 1,5 пмоль на реакционную смесь на этапах ОТ и ПЦР, снижение концентрации праймеров в пределах данных интервалов практически не влияло на значения Ct. В качестве рабочей концентрации праймеров была выбрана концентрация 10 пмоль каждого праймера на 50 мкл реакционной смеси для этапа ПЦР и 10 пмоль на реакционную смесь на этапе ОТ.

Построение калибровочных кривых Калибровочные образцы были приготовлены путём последовательных разведений лабораторных контрольных препаратов вирусов КПК (титры 6,lg ТЦД50/мл, 7,1 lg ТЦД50/мл и 6,3 lg ТЦД50/мл, соответственно). Титр калибровочных образцов определяли титрованием по ЦПД в 3-х или более повторах для каждого вируса, а также подтверждали при каждом титровании по ЦПД.

По амплификационной кривой, для построения которой одновременно с исследуемыми образцами анализировали калибровочные образцы вирусов КПК в двух или трех повторах, значение Ct для каждого образца измерялось автоматически с помощью программного обеспечения к прибору АНК-или ДТ-96. На основании амплификационных кривых строили калибровочную кривую (рис. 1), позволяющую с учетом значений Ct, отложенных по оси абсцисс, определить титр вируса по содержанию РНК по оси ординат. Результат количественной ПЦР-РВ высчитывали по отношению к калибровочному образцу с титром, выраженным в lgТЦД50/мл, и, вследствие этого, также выражали в lgТЦД50/мл.

Чувствительность, линейность и эффективность метода ПЦР-РВ для оценки титра вирусов кори, эпидемического паротита и краснухи Чувствительность метода была определена в трех повторах при исследовании 10-кратных серийных разведений РНК, выделенной из образцов вирусов КПК, с титрами вирусов, варьирующими от 1,5x105 до 1,5x100 (для вируса кори) от 1,2x107 до 1,2x100 (для вируса ЭП) и от 2,0x1до 2,0x100 (для вируса краснухи) ТЦД50/мл (табл. 2).

Аналитическая чувствительность составила менее чем 15, 120 и ТЦД50/мл для вирусов кори, ЭП и краснухи, соответственно.

По полученным данным были построены кривые нанесением значений Ct, относительно известного значения титра контрольных образцов вирусов КПК (рис. 1 А, В, С).

Таблица 2.

Оценка чувствительности метода путем ПЦР-РВ-анализа серийных разведений контрольных образцов вирусов КПК.

Разведе- Вирус кори Вирус ЭП Вирус краснухи ние Титр, Значение Титр, Значение Титр, Значение ТЦД50/мл Ct ТЦД50/мл Ct ТЦД50/мл Ct 100 1,5 x 105 25,2 + 0,6 1,2 x 107 20,0 + 0,1 2,0 x 106 18,1 + 0,10-1 1,5 x 104 30,5 + 0,3 1,2 x 106 23,9 + 0,2 2,0 x 105 21,8 + 0,10-2 1,5 x 103 34 + 0,8 1,2 x 105 27,1 + 0,1 2,0 x 104 26,6 + 0,10-3 1,5 x 102 36,8 + 0,3 1,2 x 104 30,5 + 0 2,0 x 103 29,7 + 0,10-4 1,5 x 101 40,8* 1,2 x 103 33,8 + 0,1 2,0 x 102 33,1 + 0,10-5 1,5 x 100 - 1,2 x 102 37,7 + 0,4 2,0 x 101 35,6 + 0,10-6 1,2 x 101 - 2,0 x 100 - 10-7 1,2 x 100 - *При наименьшем детектируемом разведении вируса кори определился только 1 из протестированных методом ПЦР-РВ повторов (33,3 %).

45 y = -3,4429x + 44,5y = -3,7678x + 45,4y = -3,395x + 40,5R2 = 0,99R2 = 0,9824 40 R2 = 0,9835 30 30 25 25 20 0 1 2 3 4 5 0 1 2 3 4 5 6 0 1 2 3 4 5 6 А В С lgCCID50/ml lgCCID50/ml lgCCID50/ml Рис. 1 (A, B, C). Калибровочная кривая для вируса кори (А), ЭП (В), краснухи (С). Результаты регрессионного анализа (коэффициент детерминации R2 и тангенс угла наклона а) показаны в верхнем правом углу графика.

Коэффициент детерминации (R2) калибровочных кривых для вирусов КПК был близок к 1 (рис. 1), указывая на точное log-линейное отношение между концентрацией РНК для каждого вируса и значением Ct, что, в свою Ct C t C t очередь, указывает на постоянное значение эффективности для реакций ОТ в пределах изучаемых интервалов для вирусов КПК [Freeman W.M., 1999].

Кривые описываются общим линейным уравнением, где коэффициент а выражает тангенс угла наклона калибровочных кривых (Рис. 1) и позволяет оценить эффективность ПЦР в 1,84, 1,94 и 1,97 для вирусов КПК, соответственно.

Чувствительность выявления кДНК вируса краснухи в реакции ПЦР была определена при исследовании 10-кратных серийных разведений плазмиды со встроенным фрагментом генома вируса краснухи (модель кДНК) и составила 1500 копий/мл с воспроизводимостью 100 % или 1копий/мл с воспроизводимостью 25 %. Для разведения плазмиды со встроенным фрагментом генома вируса краснухи по полученным данным реакции ПЦР также была построена кривая (Y = 48,082 - 3,456*X), R2 которой был близок к 1 (R2 = 0,99). Тангенс угла наклона кривой (-3,456) позволяет оценить эффективность ПЦР в 1,94, что соответствует эффективности ПЦР, определенной на разведениях образца вирусной РНК, выделенного из лабораторного контрольного препарата вируса краснухи.

Таким образом, в реакции ОТ и ПЦР-РВ путем анализа серийных разведений лабораторных контрольных штаммов вирусов КПК была показана высокая чувствительность, линейность и эффективность ПЦР-РВ в выбранных условиях и с подобранными праймерами.

Воспроизводимость метода количественного определения вирусов кори, эпидемического паротита и краснухи на основе ПЦР-РВ Каждая постановка реакции ПЦР-РВ проводилась c калибровочными образцами c известным титром для построения калибровочной кривой.

Калибровочные кривые были воспроизводимы, сохраняя схожие значения Rи тангенсы углов наклона для всех трех вирусов. Межэкспериментальный коэффициент вариации значений Ct был получен из результатов калибровочных кривых 20 и более индивидуальных реакций на каждый вирус и составил 4,2 %, 3,5 % и 6,6 % для вирусов КПК, соответственно.

Внутриэкспериментальный коэффициент вариации значений Ct (или дисперсии метода), выражающий изменчивость значений Ct от пробирки к пробирке, составил 1,6 %, 3,1 % и 0,9 % для вирусов КПК, соответственно.

Для определения коэффициента вариации метода количественного определения вирусов КПК на основе ПЦР-РВ были проанализированы образцов вирусов КПК в 3-х независимых экспериментах. Коэффициент межэкспериментальной вариации метода составил для вирусов кори 6,3%, ЭП 4,7% и краснухи 7,8%, что указывает на удовлетворительную воспроизводимость метода.

Апробация разработанного метода на основе ПЦР-РВ на контрольных вакцинных препаратах Для апробации разработанного метода количественной оценки вируса на основе ПЦР-РВ провели оценку титра вируса краснухи штамма Wistar RA 27/3 в эталонных препаратах – международном вакцинном стандарте и коммерческом препарате – вакцине против краснухи, методом ПЦР-РВ в четырех повторах и по ЦПД в трех повторах (табл. 3).

Таблица 3.

Сравнение титров вируса краснухи в контрольных вирусных препаратах.

Титр по реакции ЦПД, Титр по ПЦР-РВ, lg Эталонные препараты lg ТЦД50/мл ТЦД50/мл Препарат международного 4,0 + 0,2 4,05 + 0,стандарта вируса краснухи (3,9 lg ТЦД50/мл) Вакцина против краснухи 4,75 + 0,09 4,81 + 0,(Serum Institute of India) (4,5-4,8 lg ТЦД50/мл) ВОЗ принята рекомендация о возможности применения метода оценки титра вируса, если разница между величинами определенного титра не превышает 0,5 lg ТЦД50/мл [WHO/VSQ/97.04]. Таким образом, было показано, что разница между величиной титра вируса краснухи в международном стандарте и вакцинном препарате, определенная методом ПЦР-РВ и по ЦПД, находится в пределах 0,2 lg ТЦД50/мл, что укладывается в допустимые ВОЗ пределы.

Оценка корреляции результатов определения титра вирусов кори, эпидемического паротита и краснухи методом на основе ПЦР-РВ и по ЦПД.

При разработке и апробации нового метода важно сравнить результаты, полученные этим методом и классическими методами, принятыми в качестве «золотых стандартов» для данного вируса с целью проведения корреляционного анализа [Klein D., 2002]. Для этого клетки Vero заражали вирусом краснухи (штамм Wistar RA 27/3, титр 3,8-4,0 lg ТЦД50/мл) с множественностью 0,1 инфекционная единица на клетку, динамику накопления вируса отслеживали ежедневно по накоплению вирусной РНК методом ПЦР-РВ и титрованием по ЦПД. На основании полученных двумя методами данных были построены кривые роста вируса краснухи в культуре клеток Vero (рис. 2).

Со 2-ых по 7-ые сутки после заражения культуры клеток Vero вирусом краснухи значения титров вируса, определенные методом ПЦР-РВ и по ЦПД, близки и разница в величинах не превышает 0,5 lgТЦД50/мл, что свидетельствует о хорошем совпадении результатов для данного временного интервала (рис. 2). При расчете коэффициента корреляции между значениями титра вируса краснухи по ЦПД и ПЦР-РВ также было выявлено хорошее совпадение результатов: коэффициент корреляции Пирсона для временного интервала со 2-ых по 7-ые сутки был близок к 1 (r2=0,98). На ранних и более поздних сроках культивирования (до 2-ого дня и после 7-ого дня) отмечена достоверная разница значений титров.

ПЦР-РВ ЦПД Рис. 2. Кривые накопления вируса краснухи (штамм Wistar RA 27/3) в культуральной жидкости, собранной с зараженной культуры клеток Vero, построенные по результатам методов ПЦР-РВ () и ЦПД () (множественность заражения 0,1 инф. ед./кл.). Здесь и на последующих рисунках каждая точка представляет среднее 3-х (по ЦПД) или 6-ти (методом ПЦР-РВ) значений, полученных в 3-х независимых экспериментах на каждый метод, отрезки прямой погрешности представляют значения стандартного отклонения от среднего для каждой точки.

Вирус кори Вирус паротита ПЦР-РВ ПЦР-РВ ЦПД ЦПД lg ТЦД50/мл < 0, lg ТЦД50/мл < 0,r2 = 0,r2 = 0,(A) (B) Рис. 3 (А, В). Кривые накопления вирусов кори (А) и ЭП (В) в культуральной жидкости, собранной с зараженной культуры клеток Vero, построенные по результатам методов ПЦР-РВ () и ЦПД () (множественность заражения 0,1 инф. ед./кл.) Аналогичным образом были собраны и исследованы по ЦПД и методом ПЦР-РВ образцы супернатантов с культуры клеток Vero, зараженных вирусом кори (штамм L-16, титр 5,5-5,7 lg ТЦД50/мл) и ЭП (штамм L-3, титр 5,5-5,7 lg ТЦД50/мл) с множественностью 0,1 инфекционная единица на клетку (рис. 3).

Для временного интервала с 3-их по 6-ые сутки после заражения была установлена значимая корреляция результатов значений титров, определенных по ЦПД и методом ПЦР-РВ, с коэффициентом корреляции Пирсона близким к 1 (r2=0,99 для вируса кори и r2=0,96 для вируса ЭП) (рис.

3). Расхождения между результатами на 2-ые и после 6-ых суток репликации вирусов кори и ЭП были значимы.

Расхождение значений титров вирусов КПК после 6-7-ых суток культивирования вследствие снижения инфекционного титра и повышения концентрации вирусной РНК в исследуемом материале может быть связано с постепенным разрушением вирионов и зараженных клеток, сопровождающимся выходом в культуральную жидкость репликативных форм вирусного генома или РНП не полностью собранных вирионов, а также аккумуляции дефектных интерферирующих геномов [Calain P., 1988].

Расхождение в титрах вируса, определенных методом ПЦР-РВ и по ЦПД до 2-3-его дня культивирования, объясняются, по всей видимости, определением в ПЦР-РВ РНК дефектных вирионов, не вошедших в клетки при заражении.

В целом значения титров вирусов КПК, определенные методом ПЦР-РВ, были выше сравнительно со значениями, полученными по ЦПД, что согласуется с более ранними результатами количественных исследований для вируса желтой лихорадки [Bae H.-G., 2003], вируса гриппа [Youil, 2004] и вируса лихорадки долины Рифт [Garcia S., 2001], полученными также в ПЦРРВ и классическими методами. Однако анализ Пирсона выявил значимую корреляцию между результатами титров, определенных двумя методами.

Более того, для определенного временного интервала после инокуляции разница в титрах, определенных двумя методами для вирусов КПК, не превышали значение, допустимое ВОЗ (0,5 lgТЦД50/мл).

Зависимость корреляции значений титров, полученных методом на основе ПЦР-РВ и по ЦПД, от клеточного субстрата Культуры клеток Vero, ВНК-21, MRC-5 или М-29 в состоянии полного монослоя заражали вирусом краснухи (штамм Wistar RA 27/3, титр 3,8-4,0 lg ТЦД50/мл) с множественностью заражения 0,1 инф.ед./клетку и в разные сроки культивирования отбирали образцы культуральной жидкости для определения титра вируса. Оценку титра вируса краснухи проводили по ЦПД и методом ПЦР-РВ, по полученным данным были построены кривые накопления вируса краснухи (рис. 2, 4).

Рис. 4. Динамика накопления вируса краснухи по результатам, полученным методом ПЦР-РВ и по ЦПД, при его культивировании в культурах клеток ВНК-21, MRC-5 и M-29 (множественность заражения 0,1 инф. ед./кл.).

Динамика накопления вируса краснухи в культуральной жидкости во всех культурах клеток несколько отличалась по абсолютным величинам, но общая схема была однотипной (рис. 2, 4). Максимальных значений титр вируса при данной дозе заражения достигал на 6-7-е сутки культивирования.

Наибольшие значения титра вируса по ЦПД были получены в культуре клеток ВНК на 6-е сутки культивирования: 6,3 – 6,5 lg ТЦД50/мл.

Для культур клеток Vero, MRC-5 и М-29 показано, что со 2-ого (для Vero, рис. 2) и 4-ого (для MRC-5, М-29, рис. 4) по 7 день после заражения клеток вирусом краснухи значения титров вируса, определенные методом ПЦР-РВ и по ЦПД, близки и разница в величинах не превышает 0,lgТЦД50/мл, а рассчитанный коэффициент корреляции Пирсона для данного временного интервала близок к 1. Это свидетельствует о хорошем совпадении результатов для выбранного временного отрезка.

Корреляция результатов титров, полученных двумя методами в культуре клеток ВНК-21, гораздо менее значима. Однако до 7-ого дня после заражения отмечается схожий характер поведения кривых роста вируса, построенных по результатам ЦПД и ПЦР-РВ – кривые идут параллельно и разница в значениях составляет 0,5-0,75 lgТЦД50/мл (рис. 4). Как известно, для определенного вируса соотношение неинфекционных и инфекционных вирусных частиц может варьировать в зависимости от клеточной линии.

Таким образом, разница, наблюдаемая на рисунке 4 для культуры клеток ВНК-21, вероятно, является следствием того, что вирус краснухи образует больше дефектных вирионов на этой клеточной культуре, чем на культуре клеток Vero, используемой для получения калибровочного материала.

Таким образом, установлено, что метод оценки титра вируса краснухи в вируссодержащей жидкости с помощью ПЦР-РВ обеспечивает высокую корреляцию результатов с культуральным методом для культур клеток Vero, MRC-5 и М-29 при исследовании образцов, полученных в определенном временном интервале после заражения.

Аналогично, для вируса кори и ЭП была сравнена кинетика накопления вируса в культурах клеток Vero и М-29 методом ЦПД и ПЦР-РВ. С 3-их по 6ые сутки для обеих культур наблюдалась хорошая корреляция результатов титров вирусов, полученных по ЦПД и методом ПЦР-РВ, а разница в величинах не превышала 0,5 lgТЦД50/мл. Для культуры клеток Vero коэффициент корреляции Пирсона (R2) составил 0,92, для культуры клеток М-29 – 0,99.

Влияние множественности заражения культуры клеток вирусами кори, эпидемического паротита и краснухи на корреляцию значений титров, полученных методом ПЦР-РВ и по ЦПД Разработанный на основе ПЦР-РВ метод количественной оценки вируса был апробирован в экспериментах с различной множественностью заражения вирусами КПК культуры клеток Vero: 1,0, 0,1 и 0,инфекционные единицы на клетку (Рис. 3, 5, 6, 7).

Наилучшее совпадение результатов определения титров вирусов КПК методами ПЦР-РВ и ЦПД наблюдалось при дозах заражения 0,1 и 0,01 инф.

ед./клетку (Рис. 3 А, В; 5 В; 6 А; 7 В, С). Коэффициенты корреляции были близки к 1. Для вируса кори достоверная корреляция между значениями титров вируса, полученных двумя методами, наблюдалась при множественности заражения в пределах от 1,0 до 0,001 инф.ед./клетку (Рис. А, 5).

Для вируса краснухи при использовании более высокой множественности заражения (1 инф. ед./клетку) величины титров, определенные двумя методами, отличались в пределах 0,5 – 0,75 lg ТЦД50/мл (Рис. 7 А). Как видно из рисунка 7 А кривые титров при данной множественности заражения идут параллельно. В этом случае при расчете титра вируса краснухи в вируссодержащей жидкости, определенного с помощью метода ПЦР-РВ, следует вводить поправочный коэффициент.

Для вируса ЭП при множественности заражения более чем 0,инф.ед/клетку наблюдалась значимая разница между значениями титров, полученных двумя методами, так как уже к 3-ему дню после инфекции клеточный монослой был полностью разрушен.

Рис. 5 (A,B,С). Кривые накопления вируса кори в культуральной жидкости, собранной с зараженной культуры клеток Vero при множественности заражения 1,0 (A), 0,01 (B) и 0,001 (С) инф. ед./клетку, построенные по результатам методов ПЦР-РВ () и ЦПД ().

Рис. 6 (А,В). Кривые накопления вируса ЭП в культуральной жидкости, собранной с зараженной культуры клеток Vero при множественности заражения 0,01 (А) и 0,001 (В) инф. ед./клетку, построенные по результатам методов ПЦР-РВ () и ЦПД ().

Рис. 7 (A,B,C). Кривые накопления вируса краснухи в культуральной жидкости, собранной с зараженной культуры клеток Vero при множественности заражения 1,0 (A), 0,1 (В) и 0,01 (C) инф. ед./клетку, построенные по результатам методов ПЦР-РВ () и ЦПД ().

При анализе вирусного материала методом, основанном на количественной ПЦР-РВ, РНК как инфекционных, так и неинфекционных вирионов одинаково количественно учитывается. Следовательно, ПЦР-РВ может использоваться для оценки вирусного титра только при соблюдении определенных условий, позволяющих снизить долю неинфекционных вирионов и свободного РНП в препарате, таких как: заражение клеток дозой, не превышающей 0,1 инф. ед./клетку; получение вирусного материала для оценки титра вируса во временном диапазоне со 2-ого по 7 день после заражения для вируса краснухи или с 3-его по 6 день после заражения для вирусов кори и ЭП; использование калибровочных образцов, полученных в тех же условиях и с той же культуры клеток, что и вирусный материал;

осветление образца низкоскоростным центрифугированием на стадии пробоподготовки; хранение вирусных образцов при определенных условиях, препятствующих потере их инфекционности; при необходимости введение поправочного коэффициента при расчете титра вируса; использование системы выделения РНК, рекомендованной для количественных тестов для достижения максимальной точности и чувствительности метода. Несмотря на то, что, метод ПЦР-РВ не может полностью заменить традиционные методы контроля специфической активности, он может быть использован в процессе производства вакцин для определения времени сбора вирусного материала.

Оптимизация условий мультиплексной ПЦР для одновременного выявления вирусов кори, эпидемического паротита и краснухи Одним из важных достоинств метода ПЦР является возможность выявления сразу нескольких вирусов в одной пробирке, при условии наличия в реакционной смеси нескольких пар соответствующих праймеров (мультиплексная ПЦР). При постановке мультиплексной ПЦР в реакционной смеси одновременно присутствуют все 3 пары праймеров и дополнительно пара праймеров для внутреннего положительного контроля (ВПК), и все зонды. Все подобранные праймеры для вирусов КПК имели примерно одинаковую температуру плавления и размер ПЦР-продуктов, что позволило создать одинаковые условия для синтеза специфических продуктов (табл. 1).

Для контроля этапа выделения РНК вместе с образцами анализировали образец риновируса 16 типа – ВПК, который включали в каждое исследование. При условии отсутствия ингибирования он должен был определяться на 30-33, но не позднее 34 цикла, что позволяет исключить ложноотрицательные результаты.

Таблица 4.

Сравнительный анализ эффективности моноспецифической и мультиплексной ПЦР-РВ.

Разведение Значение Ct вирусного Моноспецифическая ПЦР-РВ Мультиплексная ПЦР-РВ материала РНК вируса краснухи 10-2 25,51 + 0,06 26,28 + 0,10-3 28,87 + 0,22 29,77 + 0,10-4 33,49 + 0,28 32,56 + 0,РНК вируса ЭП 10-2 28,77 + 0,02 28,98 + 0,10-3 32,28 + 0,40 31,72 + 0,10-4 36,31 + 0,41 34,63 + 0,РНК вируса кори 10-2 29,33 + 0,03 29,33 + 0,10-3 33,12 + 0,39 33,30 + 0,10-4 37,02 + 0,18 35,88 + 0,Было проведено сравнение эффективности ПЦР-РВ как в мультиплексном, так и в моноспецифическом формате на одном и том же вирусном материале путем сравнения значений пороговых циклов (табл. 4).

Как видно из таблицы 4 не было отмечено существенной разницы в значениях Ct, полученных в двух форматах постановки ПЦР-РВ. Вместе с тем, отмечалось снижение соотношения сигнал/фон для образцов с низким содержанием вирусной РНК, что было связано с накоплением неспецифических продуктов ПЦР и было подтверждено электрофоретическим анализом продуктов ПЦР. Такое нарастание доли неспецифических ампликонов с уменьшением концентрации вирусной РНК может снижать аналитическую чувствительность мультиплексной ПЦР-РВ.

Таким образом, мультиплексная ПЦР-РВ не уступает по эффективности моноспецифической в определенных условиях, несмотря на наличие в реакционной смеси сразу нескольких пар праймеров.

ВЫВОДЫ 1. На основе ПЦР с детекцией в режиме реального времени разработаны методы определения титров вирусов КПК в культуральных образцах.

2. Показана высокая степень корреляции между значениями титров вирусов КПК, получаемых методом ПЦР-РВ и титрованием по ЦПД.

3. Установлены факторы, влияющие на точность определения титра вирусов КПК методом ПЦР-РВ: тип клеточной линии, используемой для получения исследуемого и калибровочного материала, множественность инфекции, условия пробоподготовки, сроки взятия образца для исследования после заражения.

4. Показано, что диплоидная культура клеток М-29 является пермиссивной для вируса краснухи, что позволяет рассматривать ее в качестве клеточного субстрата для получения вирусного материала.

5. Отработаны условия выявления РНК вирусов КПК в мультиплексном формате ПЦР-РВ.

Список работ, опубликованных по теме диссертации.

1. Забияка Ю.И., Файзулоев Е.Б., Борисова Т.К., Никонова А.А., Зверев В.В. Экспресс-метод оценки титра вируса краснухи в вируссодержащей жидкости с помощью ПЦР-РВ // Журнал микробиологии, эпидемиологии и иммунобиологии.– 2010.– №5.– С. 57-2. Забияка Ю.И. Метод ПЦР-РВ для оценки титра вируса краснухи в вируссодержащей жидкости // Материалы XVII международной научной конференции студентов, аспирантов и молодых ученых «Ломоносов-2010», секция «биология», Москва.– 2010.– С. 13. Забияка Ю.И., Файзулоев Е.Б., Борисова Т.К., Зверев В.В.

Молекулярный метод контроля титра вируса краснухи в вируссодержащей жидкости // Материалы международной конференции «Развитие научных исследований и надзор за инфекционными заболеваниями», СанктПетербург.– 2010.– С. 4. Забияка Ю.И., Файзулоев Е.Б., Борисова Т.К., Конюшко О.И., Миронова Л.Л., Зверев В.В. Сравнительная характеристика ростовых свойств вируса краснухи на культурах клеток VERO, BHK 21, MRC-5 и М-29 // Журнал инфектологии.– 2010.– Т.2.– №3.– С. 5. Забияка Ю.И., Борисова Т.К., Файзулоев Е.Б., Конюшко О.И., Миронова Л.Л., Зверев В.В. Репродукция вируса краснухи в диплоидных и перевиваемых культурах клеток // Сборник научно-практических статьей «Актуальные вопросы эпидемиологии инфекционных болезней» под редакцией проф. Шапошникова А.А. и проф. Ющенко Г.В. М.: ЗАО МП «ГИГИЕНА». – 2011.– № 10.– С. 227-26. Дмитриев Г.В., Забияка Ю.И., Файзулоев Е.Б., Борисова Т.К., Оксанич А.С., Десятскова Р.Г., Зверев В.В. Характеристика дикого и ослабленного вариантов штамма С-77 вируса краснухи // Сборник научно-практических статьей «Актуальные вопросы эпидемиологии инфекционных болезней» под редакцией проф. Шапошникова А.А. и проф. Ющенко Г.В. М.: ЗАО МП «ГИГИЕНА». – 2011.– № 10.– С. 222-27. Борисова Т.К., Зверев В.В., Миронова Л.Л., Конюшко О.И., Забияка Ю.И., Шухмина Н.Р., Ващенко В.И. Линия диплоидных клеток человека М29 – субстрат для производства противовирусных вакцин // Журнал микробиологии, эпидемиологии и иммунобиологии.– 2011.- №3.– С. 43-8. Zabiyaka Y., Faizuloev E.B., Borisova T.K., Nikonova A.A., and Zverev V.V. Rapid detection and Quantitation of MMR Viruses by Real-time Multiplex RT-PCR Assay // BIT’s 3rd Annual World Vaccine Congress – 2011, Theme: The Future of Global Vaccines, Beijing, China.– 2011.– Р. 39. Zabiyaka Y., Faizuloev E., Lobodanov S., Borisova T.K. Development of a real-time quantitative multiplex TaqMan-based RT-PCR assay for detection and quantification of measles, mumps and rubella viruses // “qPCR 2011 Event Proceedings” 5th International qPCR Symposium «Molecular Diagnostics: from single-cells to Next Generation Sequencing», Freising, Germany.– 2011.– Р. 34-10. Дмитриев Г.В., Забияка Ю.И., Файзулоев Е.Б., Борисова Т.К., Десятскова Р.Г., Зверев В.В. Выявление маркеров аттенуации отечественного холодоадаптированного штамма С-77 вируса краснухи // Эпидемиология и вакцинопрофилактика.– 2012.– №1 (62).– С. 69-11. Дмитриев Г.В., Борисова Т.К., Файзулоев Е.Б., Забияка Ю.И., Десятскова Р.Г., Зверев В.В. Изучение молекулярных механизмов аттенуации вируса краснухи на примере отечественного штамма С-77 // Молекулярная генетика, микробиология и вирусология.– 2012.– №3.– С. 28-12. Ammour Y., Faizuloev E., Borisova T., Nikonova A., Dmitriev G., Lobodanov S., Zverev V. Quantification of measles, mumps and rubella viruses using real-time quantitative TaqMan-based RT-PCR assay // Jornal of Virological Methods. DOI information:10.1016/j.jviromet.2012.09.0Примечание: в 2012 году Забияка Ю.И. сменила фамилию на Аммур Ю.И. (Ammour).






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.