WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

ЧЕРНОЛОВСКАЯ ЕЛЕНА ЛЕОНИДОВНА

ПРИНЦИПЫ КОНСТРУИРОВАНИЯ МАЛЫХ ИНТЕРФЕРИРУЮЩИХ РНК ДЛЯ ПОДАВЛЕНИЯ ЭКСПРЕССИИ ТЕРАПЕВТИЧЕСКИ ЗНАЧИМЫХ ГЕНОВ

03.01.04 – биохимия

Автореферат диссертации на соискание учёной степени доктора биологических наук

Новосибирск – 2012

Работа выполнена в Институте химической биологии и фундаментальной медицины СО РАН

Научный консультант:

д.б.н., профессор Зенкова Марина Аркадьевна

Официальные оппоненты:

Меркулова Татьяна Ивановна, д.б.н., профессор Институт цитологии и генетики СО РАН, зав. отделом Габибов Александр Габибович, д.х.н., профессор, чл.-корр. РАН Институт биоорганической химии имени академиков М. М. Шемякина и Ю. А. Овчинникова РАН, зав. лабораторией Загребельный Станислав Николаевич, д.б.н., профессор Новосибирский национальный исследовательский государственный университет, зав. лабораторией

Ведущая организация:

Институт молекулярной биологии им. В. А. Энгельгардта РАН

Защита состоится « » 2012 г. в часов на заседании диссертационного совета Д 003.045.01 на базе Федерального государственного бюджетного учреждения науки Института химической биологии и фундаментальной медицины СО РАН по адресу: 6300Новосибирск, проспект академика Лаврентьева,

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждении науки Институт химической биологии и фундаментальной медицины СО РАН Автореферат разослан « » 2012 г.

Учёный секретарь диссертационного совета к.х.н., доцент Коваль В. В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Вся необходимая информация для правильного развития и функционирования организма человека, защиты его от повреждающих факторов внешней среды и патогенных микроорганизмов закодирована в его геноме. В идеале геном не только содержит информацию обо всех белках, необходимых организму, но и информацию о том, когда и в каком количестве должен быть синтезирован каждый белок.

Система регуляции генетической экспрессии очень сложна и, несмотря на наличие дублирующих сигнальных систем и механизмов исправления повреждений генетической информации, в ней нередко происходят необратимые повреждения, которые приводят к развитию заболеваний или патологических состояний организма. Повреждения генетической информации могут вызывать разные последствия: отсутствие необходимого организму белка, избыток белка, либо синтез «неправильного» белка, который наносит вред организму. В первом случае для коррекции патологии необходимо ввести в клетку «правильный» ген, кодирующий недостающий белок, и тут на помощь может прийти гено-терапия, в двух других - требуется применение терапевтических средств, которые ограничат или блокируют синтез данного белка, не затрагивая при этом остальные системы клетки.

Прямым подходом к получению селективных ингибиторов экспрессии генов является использование терапевтических нуклеиновых кислот, способных избирательно связываться с мРНК гена-мишени и инактивировать её. Наиболее перспективными агентами для такого воздействия, действующими в наномолярных концентрациях, являются siРНК (малые интерферирующие РНК) [Fire et al., 1998]. siРНК представляют собой дуплексы длиной 21-25 п.н., которые в составе белкового комплекса связываются с комплементарной им РНК-мишенью и вызывают ее направленную деградацию.

siРНК широко применяются в функциональной геномике для идентификации генов, вовлеченных в такие основополагающие клеточные процессы как дифференцировка, апоптоз, физиологические процессы, а также генов, определяющих клеточную морфологию. Возможность направленно регулировать экспрессию любого гена позволяет не только исследовать их функции, но и вести поиск потенциальных мишеней для лекарственных препаратов на генном уровне. Любой ген может выступать в роли потенциальной мишени, поэтому перспектива использования siРНК в качестве терапевтических препаратов для лечения раковых, нейродегенеративных и вирусных заболеваний является многообещающей. В настоящее время проводятся клинические испытания ряда препаратов на основе siРНК, однако широкое применение siРНК в терапии пока не представляется возможным из-за их чувствительность к рибонуклеазам, сложности выбора высокоэффективных последовательностей, возможности возникновения ряда побочных эффектов и проблемы доставки siРНК в клетки и ткани.

Создание регуляторов экспрессии генов на основе siРНК, действующих по механизму РНК-интерференции, открывает новые возможности для получения широкого спектра высокоэффективных терапевтических препаратов, поэтому разработка принципов дизайна нового поколения siРНК, лишенных указанных недостатков, является исключительно актуальной.

Целью настоящей работы являлась разработка принципов конструирования ингибиторов экспрессии терапевтически значимых генов на основе химически модифицированных малых интерферирующих РНК, оказывающих пролонгированное действие и способных проникать в клетки без помощи носителя.

В ходе выполнения исследования необходимо было решить следующие задачи:

• изучить влияние выбора специфической мРНК-мишени и последовательностимишени в составе выбранной мРНК на способность siРНК тормозить пролиферацию опухолевых клеток человека и разработать комплексный подход для поиска перспективных молекулярных мишеней для лечения опухолевых заболеваний.

• исследовать влияние количества и распределения химических модификаций в составе siРНК на ее стабильность в присутствии сыворотки, биологическую активность и длительность интерферирующего действия и разработать универсальный экспериментальный алгоритм получения нуклеазоустойчивых аналогов siРНК, содержащих минимальное количество модифицированных звеньев и оказывающих длительное ингибирующее действие на экспрессию гена-мишени.

• определить влияние нуклеотидных замен в составе химически модифицированных siРНК на ее биологическую активность и предложить подход, позволяющий конструировать высокоэффективые siРНК, направленные к любым последовательностям, в том числе к последовательностям с неблагоприятной термодинамической ассиметрией.

• изучить влияние природы липофильных заместителей на способность siРНК проникать в разные типы клеток в отсутствие трансфецирующего агента и проявлять интерферирующую активность и создать аналог siРНК, способный проникать в клетки, ингибировать экспрессию гена-мишени и вызывать терапевтически значимое изменение фенотипа клетки.

• определить влияние длины и последовательности коротких и длинных двуцепочечных РНК на спектр их биологических активностей и оценить потенциал их антипролиферативного, иммуностимулирующего, противоопухолевого и антиметастатического действия.

Научная новизна и практическая значимость работы. Данная работа представляет собой первое комплексное исследование, в результате которого сформулированы принципы конструирования ингибиторов экспрессии терапевтически значимых генов на основе химически модифицированных малых интерферирующих РНК.

Разработан универсальный экспериментальный алгоритм получения нуклеазоустойчивых химически модифицированных аналогов siРНК, содержащих минимальное количество модифицированных звеньев, который может быть использован для конструирования селективных ингибиторов экспрессии генов, оказывающих длительное ингибирующее действие на экспрессию гена-мишени.

Впервые проведено систематическое исследование влияния количества и расположения нуклеотидных замен в составе селективно модифицированных siРНК на их интерферирующую активность, нуклеазоустойчивость и длительность ингибирующего действия и предложен универсальный подход, позволяющий конструировать высокоэффективные siРНК, направленные к произвольным последовательностям, в том числе к последовательностям с неблагоприятной термодинамической асимметрией.

Разработанный подход может быть использован для получения селективных ингибиторов экспрессии химерных и мутантных генов с сохранением экспрессии аллеля дикого типа.

Изучено влияние структуры липофильных аналогов siРНК на их способность проникать в разные типы клеток без помощи трансфецирующего агента и их интерферирующую активность и впервые показано определяющее влияние на эти параметры длины алифатического линкера между siРНК и липофильным остатком.

Использование разработанных принципов дизайна позволило идентифицировать ряд перспективных молекулярных мишеней для лекарственных препаратов и сконструировать высокоэффективные ингибиторы экспрессии терапевтически значимых генов, которые могут быть использованы как прототипы лекарственных средств нового поколения.

Публикации и апробация работы. Основные результаты работы отражены в 34 статьях (из них 3 обзора) и 1 патенте. Результаты работы были представлены на международных и российских конференциях: всероссийская конференция "Фундаментальные науки – медицине" (Новосибирск, 2005, 2006, 2007, 2010), "Cell Signaling World" (Люксембург, 2006), Биотехнология и медицина (Москва, 2006), “Nucleic Acids as Targets and Tools” (Новосибирск, 2006), "Физико-химическая биология" (Новосибирск, 2006, 2011), 2nd Russian-German Conference of the Koch-Metchnikov-Forum (Томск, 2007), XVIII Менделеевский съезд (Москва, 2007), "Apoptosis 2008" (Люксембург, 2008), IV съезд Российского общества биохимиков и молекулярных биологов (Новосибирск, 2008), International Summer School “Supramolecular Systems in Chemistry and Biology” (Туапсе, 2008), ARCUS Symposium “Development of new tools for fundamental research in health and disease” (Страсбург, 2008), WCG-2008, (Фошан, 2008), "RNAi Europe" (Берлин, 2009), International symposium "Control of Gene Expression and Cancer" (Москва, 2010), First Symposium "Supramolecular Chemistry for Materials and Life Science" (Новосибирск, 2010), International roundtable on nucleosides, nucleotides and nucleic acids (Лион, 2010), «Cell Signal-omics 2011: Integrated cellular pathology Systems biology of human disease» (Люксембург, 2011), Российско – немецкая конференция в рамках российско – немецкого года образования, науки и инноваций «Молекулярные основы инфекционных заболеваний» (Новосибирск, 2011), 6th Cambridge Symposium on Nucleic Acids Chemistry and Biology (Кэмбридж, 2011), Международная конференция «Молекулярная биология – медицине» (Киев, 2011), Фармацевтические и медицинские биотехнологии (Москва, 2012).

Структура и объем работы. Диссертация состоит из введения, обзора литературы, экспериментальной части, результатов и их обсуждения, выводов и списка литературы.

Работа изложена на 330 страницах, содержит 84 рисунка и 18 таблиц. Библиография охватывает 644 публикации.

СОДЕРЖАНИЕ РАБОТЫ

1. Выбор мишеней для siРНК в составе мРНК Для того, что бы определить влияние вторичной структуры мРНК-мишени на эффективность действия siРНК мы сравнили эффективность действия антисмысловых олигонуклеотидов и siРНК, направленных к одним и тем же мишеням в составе мРНК гена MDR1 человека. Для исследования эффективности подавления экспрессии гена MDRс помощью siРНК и влияния на эффективность их действия структуры мишени были выбраны 5 siРНК (Табл. 1), адресованные к различным областям мРНК гена MDR1. Все использованные в данной работе siРНК и их производные были синтезированы в Лаборатории химии РНК ИХБФМ СО РАН.

siE, siD и siB были гомологичны участкам MDR1 мРНК, включающим в себя мишени для антисмысловых олигонуклеотидов Е, В и D, использованных в работах [Kostenko et al., 2001; 2002]. В качестве контроля специфичности действия мы использовали siI, гомологичную области первого интрона гена MDR1. Мишенью для siU была 3-нетранслируемая область мРНК гена MDR1, поскольку для некоторых генов показано, что именно эта область наиболее чувствительна к действию siРНК. siМ, направленная на кодирующую область мРНК, была выбрана с помощью программы BioPredSi.

Ингибирование экспрессии гена MDR1 с помощью siРНК происходит за счет расщепления РНК-мишени, поэтому эффективность действия используемых siРНК может быть определена по снижению уровня целевой мРНК в клетках, однако, учитывая данные об изменении стабильности Р-гликоротеина в различных условиях, для оценки терапевтической значимости полученных эффектов необходимо определять уровень снижения белка - продукта экспрессии гена, устойчивость клеток к ранее переносимым концентрациям цитостатика и тестировать функциональную активность Р-гликопротеина по изменению накопления в клетках субстратов Р-гликопротеина. Физиологическая важность таких модельных систем несомненна, поскольку именно функциональные тесты позволяют судить о приобретении или о преодолении P-гликопротеин опосредованной множественной лекарственной устойчивости (МЛУ).

Таблица 1. siРНК, использованные для подавления экспрессии гена MDR1 (GenBank № M14758).

мРНК Функциональный siРНК Последовательность1) мишень участок мРНК 5’-UUCCAAGGAGCGCGAGGUCGG-3’ 403-4B AUG-кодон 3’-GCAAGGUUCCUCGCGCUCCAG-5’ 5’-AUCAUCCAUGGGGCUGGACUU-3’ E 598-618 кодирующая область 3’–GGUAGUAGGUACCCCGACCUG-5’ 5’-GGCUUGACAAGUUGUAUAUGG-3’ D 557-577 кодирующая область 3’–AACCGAACUGUUCAACAUAUA-5’ 5’-CUUCCGAACCGUUGUUUCUUU-3’ M 3133-3143 кодирующая область 3’–UUGAAGGCUUGGCAACAAAGA-5’ 5’-UGCAGACUUAAUAGUGGUGUU-3’ U 4141-4161 3’ UTR район 3’–UUACGUCUGAAUUAUCACCAC-5’ 5’-GUGUCAGGCUUUCAGAUUUCC–3’ область интрона I нет 3’–UUCACAGUCCGAAAGUCUAAA-5’ (контроль) 1) Жирным шрифтом выделена последовательность, соответствующая последовательности антисмыслового олигонуклеотида.

Изменение уровня экспрессии MDR1 мРНК в клетках лекарственно-устойчивой карциномы человека KB-8-5, обработанных siРНК, измеряли с помощью метода ОТ-ПЦР с использованием в качестве внутреннего стандарта гена -актина. Исследование кинетики процесса показало, что снижение уровня mdr1 мРНК происходит через 16 - 18 часов после добавления siРНК, а минимальный уровень мРНК MDR1 детектируется через 24 часа. siI, гомологичная последовательности интрона и не имеющая мишени в составе мРНК, в концентрациях 1 - 100 нМ не влияла на уровень MDR1 мРНК в клетках (Рис. 1), что свидетельствует о специфичности действия выбранных siРНК.

Данные, приведенные на рисунке 1, показывают, что после 24-часовой инкубации клеток в присутствии siE в концентрации 5 нМ в них наблюдается снижение количества MDR1 мРНК до 30% от контроля. При увеличении концентрации siРНК до 20 нМ в клетках наблюдается минимальный уровень мРНК-мишени (10%). Дальнейшее повышение концентрации siРНК до 100 нМ не оказывает значительного влияния на эффективность ее действия.

Восстановление чувствительности клеток к винбластину под действием siРНК определяли с помощью МТТ теста. Инкубация клеток в присутствии винбластина в течение 24 - 72 ч после обработки siРНК приводила к снижению количества живых клеток лишь на 20% (Рис. 2), что, по-видимому, связано с довольно большим временем жизни Ргликопротеина. Инкубация клеток в течение 96 ч после трансфекции siРНК приводила к снижению количества живых клеток до 30% относительно контроля. Как видно из данных, приведенных на рис. 2, при инкубации клеток в среде, содержащей винбластин в концентрации 300 нМ, наблюдалась постепенная гибель клеток, обработанных siЕ в комплексе с Олигофектамином. Инкубация клеток в присутствии siЕ без Олигофектамина не вызывала изменения жизнеспособности клеток. Аналогичные результаты были получены и при инкубации клеток только в присутствии Олигофектамина: трансфектант вызывал лишь небольшое снижение жизнеспособности клеток, находящееся в пределах ошибки эксперимента, что свидетельствует о его незначительном токсическом действии.

Рис. 1. Влияние siРНК на уровень мРНК гена Рис. 2. Кинетика изменения чувствительности MDR1 в клетках КВ-8-5 через 24 ч после клеток КВ-8-5 к винбластину под действием 1трансфекции siРНК. siРНК Е (белые столбики); нМ siЕ. Клетки КВ-8-5 обрабатывали siЕ в siРНК I (серые столбики). Соотношение мРНК комплексе с Олигофектамином и инкубировали MDR1/актин в контроле (черные столбики) в присутствии 300 нМ винбластина. За 100% принимали за 1, стандартное отклонение принимали количество клеток в момент определяли по результатам трёх независимых добавления siРНК.

экспериментов.

Сравнение данных, полученных с помощью ОТ-ПЦР и МТТ методов, показало, что снижение уровня мРНК наблюдается уже тогда, когда фенотипические проявления подавления экспрессии гена MDR1 еще не детектируются. Поскольку для терапевтических целей важны именно фенотипические и функциональные проявления подавления экспрессии гена MDR1, проявляющееся в снижении уровня белкового продукта этого гена - Р-гликопротеина и в гибели клеток, в дальнейшей работе для оценки эффективности действия используемых анти-MDR1 siРНК использовались такие методы тестирования как МТТ тест, Вестерн-блот анализ и родаминовый эффлюкс, несмотря на то, что метод ОТПЦР позволяет зафиксировать эффект на более ранней стадии.

Для исследования влияния положения мишени в структуре мРНК на эффективность действия siРНК клетки линии КB-8-5 трансфицировали различными siРНК в концентрации 5 - 150 нМ и инкубировали в течение 96 ч. По окончании инкубации количество живых клеток определяли с помощью МТТ теста. За 100% принимали количество живых клеток в контроле, где клетки были инкубированы только с Олигофектамином. Через 96 ч инкубации в присутствии siE, siM, siB, siD и винбластина наблюдалось концентрационно-зависимое увеличение чувствительности клеток к винбластину и, как следствие, их гибель (Рис. 3).

Двукратное снижение количества живых клеток происходило уже при 20 нМ концентрации дуплекса для siE, siM и siD. При повышении концентрации этих siРНК до 100 нМ количество живых клеток снижалось до 30% от контроля, а при увеличении времени инкубации клеток в присутствии винбластина до 120 ч после добавления siE, siB, siМ или siD в концентрации более 100 нМ происходила гибель всех клеток. siI и siU не оказывали никакого влияния на жизнеспособность клеток в присутствии винбластина даже при длительной (120 ч) инкубации, что еще раз подтверждает специфичность действия выбранных siРНК.

Рис. 3. Изменение чувствительности клеток КВ-8-5 к винбластину под действием siРНК. Клетки КВ-8-инкубировали в присутствии siРНК и 300 нМ винбластина в течение 96 ч ( - siE, - siM, - siB, - siD, - siU, - siI ). За 100% принимали количество живых клеток в контроле: клетки инкубировали с Олигофектамином в отсутствие siРНК. Ошибка эксперимента не превышала 10%.

Представлены средние значения, определенные по результатам трех экспериментов.

Таким образом, из исследованных шести siРНК четыре - siE, siD, siB и siM - оказались способны восстанавливать чувствительность лекарственно-устойчивой линии раковых клеток человека к винбластину.

Подавление экспрессии гена MDR1 с помощью siРНК подтверждали путем определения количества продукта этого гена - белка P-гликопротеина (P-gp). Для этого, клетки линии КB-8-5 транфецировали 20 нМ siРНК. Клетки инкубировали в течение 72 ч, лизировали и определяли количество Р-гликопротеина методом Вестерн-блот анализа, используя в качестве внутреннего стандарта, также как и в экспериментах по определению изменения уровня мРНК с помощью ОТ-ПЦР, -актин. Из данных, приведенных на рисунке 4, видно, что действительно, через 72 ч после трансфекции клеток siЕ количество Р-гликопротеина снижается до 17% от количества этого белка в необработанных клетках.

К ол siE siD siM siB siU siI Р-гликопротеин -актин Рис. 4. Снижение количества Р-гликопротеина в клетках линии КВ-8-5 через 72 ч после трансфекции siЕ, siD, siM, siB, siU и siI в концентрации 20 нМ (результаты Вестерн блот-гибридизации). В качестве контроля использовали интактные клетки (К) и клетки, инкубированные в присутствии Олигофектамина без добавления siРНК (ол).

Трансфекция клеток siB, siD и siM вызывает сходное снижение количества Ргликопротеина. В то же время, обработка клеток Олигофектамином, siU или siI в присутствии Олигофектамина, не оказывавшая влияния на жизнеспособность клеток в присутствии винбластина, не влияла и на количество Р-гликопротеина в клетках.

Одним из способов тестирования фенотипа МЛУ и активности Р-gp является функциональный тест, определяющий накопление родамина-123 в клетке, так как этот краситель является субстратом P-gp. Клетки, в мембране которых содержится P-gp, выводят из цитоплазмы родамин 123 в межклеточное пространство, и, наоборот, подавление экспрессии гена MDR1 и снижение уровня P-gp приводит к аккумуляции родамина 123 в цитоплазме.

Фотографии препаратов клеток, полученные с помощью флуоресцентного микроскопа, представлены на рисунке 5. Из приведенных данных видно, что в родительской линии КВ-3-1 (Рис. 5 А) родамин 123 эффективно накапливается в цитоплазме и клетки становятся «красными», тогда как клетки КВ-8-5 с фенотипом МЛУ остаются «синими» (Рис. 5 В). siE и siD, под действием которых наблюдалось значительное снижение уровня Р-gp (Рис. 4), в концентрации 20 нМ вызывают в клетках КВ-8-5 накопление родамина 123 и клетки становятся «красными», то есть приобретают фенотип лекарственно - чувствительных клеток (Рис. 5 Г и Д). Аналогичный эффект оказывали на клетки КВ-8-5 siB и siM (данные не приведены). siU и контрольная siI, не влияющие на уровень мРНК и белка, также не влияют и на транспорт красителя и клетки остаются «синими» (Рис. 5 Е и Ж), то есть клетки сохраняют фенотип лекарственной устойчивости. На фотографиях отчетливо видно появление фенотипа МЛУ - клетки КВ-31, в которых экспрессия гена MDR1 была активирована с помощью небольшой (3 нМ) концентрации винбластина, занимают промежуточное положение между отчетливо «красными» и отчетливо «синими» клетками (Рис. 5 А, Б и В).

Таким образом, подавление экспрессии гена MDR1, выражающееся в снижении уровня белка, восстановлении чувствительности клеток к цитостатику и обращении фенотипа МЛУ под действием siЕ, siВ, siМ и siD происходит со сходной эффективностью для всех четырех siРНК, в то время как эффективность действия антисмысловых олигонуклеотидов, направленных к тем же участкам, что и siРНК, существенно отличается (Табл. 2).

Таблица 2. Сравнение эффективности действия антисмысловых олигонуклеотидов и siРНК, направленным к тем же мишеням в составе MDR1 мРНК.

Эффективность ингибирования Антисмысловой олигонуклеотид** siРНК* [Kostenko et al., 2002] B 75% 40% E 90% 90% 0% D 80% * - за эффективность ингибирования принимали % снижения уровня Р-гликопротеина через 72 ч после трансфекции 20 нМ siРНК относительно контроля.

** - за эффективность ингибирования принимали снижение уровня экспрессии мРНК гена MDRчерез 24 ч после инкубации с 50 мкМ антисмысловым олигонуклеотидом.

Рис. 5. Накопление родамина 123 в клетках линии КВ8-5 после обработки siРНК. Фотографии клеток в поле флуоресцентного микроскопа, увеличение 400х. Синий цвет - ядра, окрашенные Хехст 33258, красный цвет – родамин 123, накапливающийся в цитоплазме. А – клетки линии КВ-3-1, культивируемые в отсутствие винбластина и siРНК; Б – клетки линии КВ-3-1, активированные добавлением 3 нМ винбластина; В - клетки линии КВ-8-5, культивируемые в отсутствие siРНК. Г, Д, Е, Ж - клетки линии КВ-8-5, через 72 ч инкубации в присутствии 20 нМ siРНК E (Г), siРНК D (Д), siРНК U (Е), siРНК I (Ж).

Несмотря на то, что максимальный уровень подавления экспрессии гена MDRдостигал 90% при использовании siРНК и антисмыслового олигонуклеотида, направленных к области Е MDR1 мРНК, используемые концентрации ингибиторов различались на несколько порядков (20 нМ и 50 мкМ для siРНК и антисмыслового олигонуклеотида, соответственно). Эффективность действия siD оказалась сравнима с ние наче Обоз эффективностью действия siЕ, в то время как антисмысловой олигонуклеотид D не оказывал влияния на экспрессию гена MDR1.

Эти результаты свидетельствуют в пользу того, что подавление экспрессии генов с помощью siРНК менее требовательно к выбору последовательности мишени в составе мРНК и гибридизационным свойствам используемых олигорибонуклеотидов по сравнению с «антисмысловым» подходом.

2. Выбор генов в опухолевых клетках человека в качестве мишеней для терапевтических siРНК Нарушение регуляции экспрессии генов, кодирующих регуляторы клеточного цикла, считается ключевым фактором развития различных типов опухолей у человека, однако, при ингибировании одного и того же гена терапевтический эффект может существенно отличаться. Это определяет необходимость сравнения антипролиферативного действия siРНК на разных линиях опухолевых клеток человека.

Гены Her2, CCNB1, PKC и C-MYC кодируют белки, относящиеся к разным группам регуляторов клеточного цикла. Ранее было показано экспериментально и подтверждено клинически, что нарушения экспрессии этих генов могут приводить к возникновению злокачественных опухолей у человека, поэтому мы выбрали мРНК этих генов в качестве мишеней для siРНК.

В качестве моделей различных типов опухолевых заболеваний человека нами были выбраны клетки линий KB-3-1 (карцинома шейки матки), SK-N-MC (нейробластома), MCF-7 (аденокарцинома молочной железы) и HL-60 (промиелоцитарный лейкоз) (Рис. 6).

Во всех исследованных клетках обнаружен высокий уровень мРНК гена CCNB1 и гораздо меньший уровень мРНК гена Her2. Повышенный уровень мРНК гена PKC наблюдался в клетках MCF-7. Гиперэкспрессия гена C-MYC была обнаружена в клетках KB-3-1 и SK-NMC. Последовательности siРНК, гомологичные мРНК генов-мишеней, были выбраны с помощью программы BioPredSi (Табл. 3).

Рис. 6. А. Уровни мРНК генов Her2, CCNB1 (CyclinB1) и PKC в клетках линий KB-3-1, SK-N-MC, MCF-7 и HL-60. Б.

Уровни мРНК гена C-MYC в клетках линий KB-3-1 и SK-N-MC. Продукты реакции ОТ-ПЦР разделяли методом электрофореза в 1.5% агарозном геле и детектировали с помощью окрашивания бромистым этидием.

Таблица 3. siРНК, направленные к мРНК генов Her2, CCBN1, PKC, C-MYC Обозначение Последовательность* Мишень 5`-GCAGUUACCAGUGCCAAUAUU-3` 1299 – 1319 н. мРНК siHer 3`-CCCGUCAAUGGUCACGGUUAU-5` Her 5`-CACCAGGAACUCGAAAAUUUU-3` 190 – 210 н. мРНК siCyc 3`-CAGUGGUCCUUGAGCUUUUAA-5` CCNB 5`-GCGGCCAGAGAAGGAAAAAUU-3` 1080 – 1100 н. мРНК siPKC 3`-GUCGCCGGUCUCUUCCUUUUU-5` PKC 5’-GAGGUGCCACGUCUCCACAUU-3’ 1452 – 1470 н. мРНК siMyc 3’-UUCUCCACGGUGCAGAGGUGU-5’ С-MYC 5`-CAAGUCUCGUAUGUAGUGGUU-3` siScr - 3`-UUGUUCAGAGCAUACAUCACC-5` * C – 2`-O-метил-цитозин, U – 2`-O-метил-уридин В качестве параметров для исследования действия siРНК мы выбрали Микроскопический анализ определение относительного уровня экспрессии геновмишеней, скорости клеточной Выделение РНК пролиферации, доли живых, ОТ-ПЦР в реальном времени мёртвых и находящихся в Анализ уровней экспрессии генов стадии апоптоза клеток, и выборочный анализ морфологии клеток. Обшая схема исследования приведена МТТ тест на Рис. 7.

Анализ скорости пролиферации Рис. 7. Схема исследования.

Проточная цитофлуориметрия Анализ про-апоптотического действия 2.1. Подавление экспрессии генов Her2 (c-erb-B2), CCNB1, PKC и C-MYC в клеточных линиях KB-3-1, SK-N-MC, MCF-7 и HL-60 под действием siРНК Влияние siРНК на уровень целевой мРНК исследовали по следующей схеме: siРНК в концентрациях 50–200 нM трансфецировали в клетки, используя в качестве трансфектанта Олигофектамин для клеток SK-N-MC и Липофектамин 2000 для других клеточных линий, через 48 ч после трансфекции из клеток выделяли суммарную РНК и определяли уровень специфичных мРНК с помощью метода ОТ-ПЦР, используя -актин в качестве внутреннего стандарта. Специфичность действия siРНК проверяли по сохранению уровней мРНК -актина и негомологичных генов-мишеней.

Поскольку из литературных данных известно, что эффект снижения уровня целевой мРНК под действием siРНК наблюдается уже через сутки после доставки siРНК в клетку, и в опубликованных работах по подавлению экспрессии генов Her2, CCNB1, PKC максимальное снижение уровня мРНК фиксировали через 48 ч после трансфекции, то для того, чтобы можно было сопоставить наши данные с литературными, относительный уровень мРНК целевых генов в данной работе определяли с помощью ОТ-ПЦР в реальном времени через 48 ч после трансфекции siРНК. Нами было обнаружено, что siCyc, siHer и siPKC вызывают существенное ингибирование экспрессии генов-мишеней в клетках KB3-1, SK-N-MC, MCF-7 и HL-60 (Рис. 8).

Трансфекция siHer вызывает значительное снижение уровня мРНК гена Her2, причем этот эффект мало зависел от концентрации siHer в диапазоне концентраций от до 200 нМ. Через 48 ч после трансфекции siHer уровень мРНК гена Her2 составлял 28 – 40% в клетках линии KB-3-1, 33 – 53% в SK-N-MC, 44 – 58% в MCF-7 и 48 – 63% в клетках линии HL-60 относительно уровня этой мРНК в клетках контрольной популяции, которая была обработана только трансфецирующим агентом (Рис. 8).

Трансфекция клеток siCyc в концентрации 50 – 200 нM снижает уровень мРНК гена CCNB1 концентрационно-зависимым образом, что особенно сильно проявляется в клетках линий MCF-7 и SK-N-MC. Наименьшие по сравнению с контролем уровни экспрессии (37°C, 5% СО ) Трансфекция клеток siРНК, инкубация мРНК гена CCNB1 составили 23% и 29% для клеток КВ-3-1 и НL-60 при концентрации siCyc 100 нМ (Рис. 8 А, Г) и 23% и 47% для клеток MCF-7 и SK-N-MC при концентрации siCyc 200 нМ (Рис. 8 Б, В). Аналогичные данные были получены для siРНК, направленной к мРНК гена PKC: трансфекция siPKC в концентрации 200 нM вызывает снижение уровня этой мРНК в клетках линии MCF-7 до 42%-го уровня по сравнению с контрольной популяцией (Рис. 8 В).

Эффективное и специфичное ингибирование экспрессии гена C-MYC было достигнуто с помощью siРНК siMyc: под действием этой siРНК в концентрации 75 – 1нМ уровень мРНК гена C-MYC снижался на 65 – 90% в клетках KB-3-1 (Рис. 8 Д) и на 60% в клетках SK-N-MC (Рис. 8 Е).

Д. Е.

1,1,1,0,0,0,0,0,0 25 50 75 1[siРНК], нМ Рис. 8. Подавление экспрессии генов-мишеней под действем siРНК. Относительные уровни мРНК генов Her2, CCNB1 и PKC в клетках KB-3-1 (А), SK-N-MC (Б), MCF-7 (В) и HL-60 (Г) и уровни мРНК гена C-MYC в клетках KB-3-1 (Д) и SK-N-MC (Е) через 48 ч после трансфекции siРНК в концентрации от 50 до 200 нМ. Представлено среднее значение ± стандартное отклонение, рассчитанное по результатам трех независимых экспериментов. Относительную экспрессию геновмишеней определяли как отношение уровня их мРНК к уровню мРНК -актина или к уровню мРНК 2-микроглобулина (для гена C-MYC), использованных в качестве внутренних стандартов.

myc/b m Наблюдаемое подавление экспрессии генов-мишеней под действием siРНК является ген-специфичным, поскольку после добавления, например, комплекса siCyc с трансфекционным реагентом происходило снижение экспрессии только гена CCNB1, а экспрессия генов Her2, PKC и гена домашнего хозяйства -актина оставалась на прежнем уровне. Специфичность других siРНК, использованных в работе, была проверена аналогичным образом (данные не приведены). Как и ожидалось, siРНК со случайной последовательностью siScr практически не влияет на экспрессию генов-мишеней (Рис. 8).

2.2. Пролиферация клеток линий KB-3-1, SK-N-MC, MCF-7 и HL-60 после подавления экспрессии генов Her2, CCNB1, PKC и C-MYC Ввиду того, что гены Her2, CCNB1, PKC и C-MYC играют важную роль в регуляции клеточного деления, а их гиперэкспрессия ведет к неконтролируемой пролиферации, мы предположили, что снижение уровня экспрессии этих генов будет приводить к подавлению деления клеток и, следовательно, замедлять скорость пролиферации.

Зависимость скорости пролиферации клеток в линиях KB-3-1, SK-N-MC, MCF-7 и HL-от уровня экспрессии генов-мишеней определяли с помощью МТТ-теста (Табл. 4).

Полученные данные показывают, что обработка клеток siHer в концентрациях 50 и 200 нM (во всех экспериментах использовали комплексы siРНК с трансфицирующим агентом) приводит к снижению скорости пролиферации клеток KB-3-1 до 84 и 75%, SK-NMC – до 93 и 79%, MCF-7 – до 82 и 65% от скорости роста клеток в контроле, соответственно. Несмотря на значительное подавление экспрессии гена Her2 под действием siHer во всех клеточных линиях, скорость пролиферции заметно снижалась лишь в клетках MCF-7 (до 65%), в то время как в остальных клеточных линиях антипролиферативный эффект был выражен слабо.

Подавление экспрессии гена CCNB1 с помощью siCyc снижает скорость деления клеток KB-3-1 до 75 и 61% от контроля, SK-N-MC – до 82 и 4%, MCF-7 – до 77 и 53%, при концент-рации 50 и 200 нM, соответственно. Несмотря на значительное снижение экспрессии гена CCNB1 под действием siCyc в клетках HL-60, это снижение не сопровождается достоверным снижением скорости их роста. Подавление экспрессии гена C-MYC практически полностью блокирует деление клеток КВ-3-1 и вдвое снижает скорость деления клеток SK-N-MC.

Таблица 4. Влияние siHer, siCyc, siPKC, siMyc на пролиферацию клеток KB-3-1, SKN-MC, MCF-7 и HL-60.

Скорость пролиферации, %* siРНК, концентрация KB-3-1 SK-N-MC MCF-7 HL-Контроль** 100 ±5 100 ±1 100 ±3 100 ±siScr, 50 нM 89 ±2 105 ±5 94 ±4 99 ±siScr, 200 нM 101 ±90 ±2 68 ±2 92 ±siHer, 50 нM 97 ±84 ±8 93 ±4 82 ±siHer, 200 нM 75 ±9 79 ±1 65 ±1 100 ±siCyc, 50 нM 99 ±75 ±2 82 ±4 77 ±siCyc, 200 нM 61 ±4 4 ±2 53 ±4 98 ±siPKC, 50 нM - - 57 ±3 - siPKC, 200 нM - - 11 ±2 - siMyc, 50 нM 90 ±3 95 ±2 68 ±2 80 ±siMyc, 200 нM 2 ±1 46 ±3 20 ±5 37 ±*Cредние значения по результатам трех независимых экспериментов ± стандартное отклонение.

** Клетки, обработанные только трансфецирующим агентом.

Очень важной информацией для разработки препаратов на основе siРНК является длительность их ингибирующего действия. Однако, большинство экспериментов ограничивается временами инкубации до 96 часов, в то время как сниженный под действием siРНК уровень мРНК гена-мишени сохраняется до 4 – 5 суток.

Данные по длительности влияния siРНК на экспрессию генов Her2, CCNB1 и PKC в литературе отсутствуют, поэтому нами была впервые исследована кинетика изменения относительного уровня экспрессии этих генов под действием siРНК (200 нМ) на протяжении первых 12 суток после трансфекции клеток KB-3-1, SK-N-MC и MCF-7.

Как видно из Рис. 9, снижение уровня экспрессии генов-мишеней наблюдается уже через 24 ч после трансфекции клеток, а эффективность снижения уровня специфической мРНК различается в зависимости от клеточной линии и гена-мишени. Все siРНК эффективно и специфично подавляют экспрессию своих генов-мишеней в использованных клеточных линиях, причём максимальное подавление (до 1 – 3% от контроля) наблюдается через 72 ч после трансфекции. Через 72 ч после трансфекции уровень мРНК гена Her2 составил 15% в клетках KB-3-1, 4% в клетках SK-N-MC и 7% - в клетках линии MCF-7 относительно контроля. Уровень мРНК гена CCNB1 через 72 ч после трансфекции siCyc понижался до 22% по сравнению с контролем в клетках КВ-3-1, до 16% - в SK-NMC и до 18% - в клетках MCF-7. Трансфекция siPKC снижает уровень мРНК гена PKC в клетках MCF-7 до 14% (Рис. 9). Полученные данные свидетельствуют о том, что siHer, как ингибитор экспрессии гена Her2 наиболее эффективен в клетках линий SK-N-MC и MCF7, а siCyc наиболее эффективно снижает уровень мРНК гена CCNB1 в клетках SK-N-MC и MCF-7 (Рис. 9). Начиная с 4-го дня после трансфекции, уровень мРНК всех генов постепенно увеличивался и возвращался к исходному значению к 7 –12 суткам после трансфекции (Рис. 9).

Г Рис. 9. Относительный уровень мРНК генов Her2, CCNB1 и PKC в клетках KB-3-1 (А), SK-N-MC (Б) и MCF-7 (В) и мРНК гена C-MYC в клетках КВ-3-1 (Г) через 1 – 12 суток после трансфекции siРНК (200 нМ). Уровни мРНК -актина или 2-микроглобулина использовали в качестве внутренних стандартов. Приведены данные по результатам трех независимых экспериментов. Стандартное отклонение не превышает 10%. Контроль/ген – относительный уровень мРНК соответствующего гена в контрольных клетках. siРНК/ген – относительный уровень мРНК соответствующего гена в клетках после трансфекции указанной siРНК.

Как видно из Рис. 9, кинетика изменения относительного уровня мРНК генов Her2, CCNB1 и PKC после трансфекции специфическими siРНК носят U-образный характер.

Визуально в каждой кривой можно выделить участок снижения уровня специфической мРНК (1 – 3 день), участок возрастания ее количества (3 – 7 день) и участок, на котором количество мРНК мишени стабилизируктся на уровне, соответствующем уровню специфической мРНК в контрольных клетках (7 – 12 день). Постепенное восстановление исходного уровня мРНК в клетках может быть связано с клеточным делением, которое приводит к снижению концентрации siРНК в цитоплазме, и, как следствие, к ослаблению эффекта РНК-интерференции. Другой причиной снижения биологической эффективности может быть расщепление siРНК под действием рибонуклеаз в цитоплазме.

Снижение числа живых клеток в популяции может происходить как в результате задержки клеточного деления, так и в связи с гибелью части клеток по механизму апоптоза. Для выяснения механизма антипролиферативного действия исследованных siРНК мы проанализировали их влияние на индукцию апоптоза через 72 ч после трансфекции siРНК, используя для этого метод селективного окрашивания живых, мертвых и находящихся в стадии апоптоза клеток.

Все образцы, включая контрольные клетки, подвергнутые действию только трансфектанта, содержали определенный процент мертвых клеток (от 11 до 58%), в то время как исходная популяция клеток содержала менее 10% мёртвых клеток. Это связано с определенной токсичностью самого трансфецирующего агента. После трансфекции siScr, siHer и siCyc доля мёртвых клеток была различна для разных клеточных линий:

минимальное их содержание обнаружено в популяции клеток HL-60 (10.4 – 15.2%), несколько больше в клетках KB-3-1 (17.1 – 20.2%) и SK-N-MC (23.7 – 28%), а наименее жизнеспособными оказались клетки линии MCF-7 (36.3 – 50.5% погибших клеток).

Клетки, находя-щиеся в стадии апоптоза, обнаружены только в популяциях клеток линий KB-3-1 (1.6 – 3.9%) и HL-60 (1.7 – 2.6%).

Полученные результаты свидетельствуют о том, что в клетках, обработанных контрольной siРНК или siРНК, направленной на мРНК генов CCNB1, Her2 или PKC, не происходит увеличения количества мертвых и находящихся в стадии апоптоза клеток по сравнению с препаратами клеток, обработанных только трансфектантом. Можно предположить, что в используемых клеточных линиях не клеточная гибель, а подавление клеточного деления лежит в основе антипролиферативной активности исследованных siРНК.

Поскольку данные по селективному окрашиванию живых, мёртвых и находящихся в стадии апоптоза клеток свидетельствуют о том, что причиной наблюдаемого антипролиферативного действия исследуемых siРНК является не гибель клеток, а замедление их деления, то необходимо было определить, как изменяется скорость клеточного деления после восстановления исходного уровня экспрессии генов-мишеней.

Скорость пролиферации клеток линий KB-3-1, SK-N-MC и MCF-7 оценивали с помощью МТТ-теста в период с 7 по 12 день после трансфекции соответствующей siРНК (200 нМ) (Табл. 5).

Как видно из Табл. 5, использованные клеточные линии можно условно разделить на три группы: клетки, скорость пролиферации которых полностью восстанавливается (КВ-31); скорость пролиферации которых остается значительно сниженной (SK-N-MC); и клетки, скорость пролиферации которых остается незначительно сниженной после восстановления исходного уровня мРНК генов-мишеней. Вероятно, временное подавление экспрессии генов Her2, CCNB1, PKC не приводит к необратимым изменениям в регуляторных системах клеток КВ-3-1, поэтому при восстановлении уровней мРНК этих генов восстанавливается и скорость пролиферации клеток.

Несмотря на обнаруженный нами выраженный антипролиферативный эффект препаратов siРНК, для ограничения роста клеточных линий MCF-7 и SK-N-MC необходимо поддерживать сниженный уровень экспрессии генов-мишеней. Этого можно добиться, повторно вводя в клетки соответствующие siРНК или используя шпилечные интерферирующие РНК (shРНК), которые экспрессируются непосредстванно в клеткахмишенях.

В культуре клеток SK-N-MC временное выключение экспрессии генов Her2, CCNBи PKC приводит к значительному замедлению деления клеток даже после восстановления исходного уровня мРНК генов-мишеней (Табл. 5). Выраженный антипролиферативный эффект (5–10 раз) кратковременного выключения экспрессии этих генов сохраняется до суток инкубации. Этот феномен можно объяснить, принимая во внимание специфический паттерн экспрессии генов в клетках нейронального происхождения, изменением паттерна экспрессии генов в результате временного выключения генов-мишеней и его последующей реактивации. В силу этого, вероятно, даже кратковременное ингибирование экспрессии гена CCNB1 или PKC может привести к очень медленному восстановлению скорости пролиферации клеток (или полному блокированию) даже после восстановления исходного уровня продуктов каждого из генов-мишеней. Таким образом, гены CCNB1 и PKC могут рассматриваться как перспективные терапевтические мишени для препаратов, предназначенных для лечения нейробластом и рака молочной железы.

Таблица 5. Скорость деления клеток KB-3-1, SK-N-MC, MCF-7 после восстановления исходного уровня экспрессии генов-мишеней siРНК, 200 нМ Скорость пролиферации*, % KB-3-1 SK-N-MC MCF-Контроль** 100±7 100±6 100±siScr 113±10 90±7 93±siHer 123±8 36±9 78±siCyc 112±9 14±4 73±siPKC 117±14 9±3 79±* Средние значения по результатам трех независимых экспериментов ± стандартное отклонение.

** Клетки, обработанные только трансфектантом.

Проведенное исследование показало, что наиболее эффективное ингибирование экспрессии генов CCNB1 и PKC наблюдается в клетках нейробластомы человека SK-NMC, поэтому мы провели микроскопическое изучение изменений морфологии и деления клеток этой линии под действием siCyc и siPKC (анализ проведен совместно с д.б.н. Е. И.

Рябчиковой).

Установлено, что культура SK-N-MC, обработанная олигофектамином (контроль), через 24 ч инкубации представлена разными типами клеток: “островные”, распластанные нейроноподобные, веретеновидные клетки. При одинаковой посевной дозе за 3 дня инкубации контрольные клетки культуры и клетки трансфицированные siScr, практически полностью заполняли площадь стекла, тогда как трансфекция siCyc и siPKC резко замедляла размножение клеток, их число на стекле в это же время было несравнимо меньше (Рис. 10). Также наблюдалось резкое уменьшение числа митозов в клетках (Табл.

6). Даже через 12 дней после трансфекции siCyc количество клеток на стеклах было существенно меньше, чем в контроле через 3 дня после трансфекции. Количество клеток на стекле через 12 дней после трансфекции siPKC превышало их количество после трансфекции siCyc. Таким образом, результаты микроскопического изучения клеток SKN-MC после трансфекции этими siРНК согласуются с данными по их влиянию на скорость пролиферации этих клеток.

Изучение морфологии клеток SK-N-MC через 3 – 12 дней после трансфекции показало, что временное ингибирование экспрессии генов CCNB1 и PKC не приводит к их гибели или дифференцировке, на что указывает сохранение разных типов клеток в популяции, а приводит к задержке деления. Постепенное увеличение в препаратах, трансфицированных специфическими siРНК, к 10 – 12 суток инкубации суммарного количества клеток и клеток в стадии митоза (Табл. 6), указывает на то, что длительность антипролиферативного действия этих siРНК в клетках SK-N-MC, по-видимому, ограничена 12 – 15 сутками.

Таким образом, нами была предложена и опробирована схема исследования влияния интерферирующих РНК на пролиферацию опухолевых клеток на примере siРНК, гомологичных мРНК генов Her2, CCNB1, PKC и C-MYC. Обнаружено, что данные интерферирующие РНК с разной эффективностью замедляют деление опухолевых клеток различного происхождения, что указывает на необходимость идентификации индивидуальных молекулярных мишеней для терапии каждого типа опухолевого заболевания.

Рис. 10. Клетки нейробластомы SK-N-MC на стекле (тотальные препараты). Контрольные клетки (обработка только трансфектантом): А - 1 сутки инкубации, Б - 3 суток инкубации. Трансфекция 2нМ siScr: В - 1 сутки инкубации, Г - 3 сутки инкубации. Трансфекция siCyc: Д - 3 суток инкубации, Е - 12 суток инкубации. Трансфекция siPKC: Ж - 3 суток инкубации, З - 12 суток инкубации. Окраска гематоксилином. Длина масштабной линии 200 мкм.

Таблица 6. Количество клеток SK-N-MC в фазе митоза через 1 – 12 суток после трансфекции siCyc и siPKC (200 нМ) Количество митозов на 1000 клеток Дни Контроль* siScr siCyc siPKC Контроль без трансфектанта 1 14 ± 5 16 ± 8 - - - 2 40 ± 16 25 ± 7 - - 22 ± 3 21 ± 10 33 ± 12 15 ± 11 16 ± 7 - 5 - - 30 ± 12 20 ± 11 - 7 - - 28 ± 6 35 ± 5 - 12 - - 30 ± 6 49 ± 14 - * Клетки, обработанные только трансфектантом. (-) – не определяли.

Сконструированные нами ингибиторы экспрессии генов Her2, CCNB1 и PKC могут рассматриваться как прототипы лекарственных средств для сдерживания роста опухолевых клеток, переживших химиотерапию, и, таким образом, могут стать одним из компонентов комплексной терапии при опухолевых заболеваниях. Идентифицированные молекулярные мишени могут быть использованы для поиска низкомолекулярных ингибиторов функций этих белков с целью получения лекарственных средств нового поколения. Опробированная нами технологическая платформа может использоваться для скрининга молекулярных мишеней для противоопухолевых препаратов и может быть использована для расширенных исследований различной целевой направленности.

3. Получение нуклеазоустойчивых химически-модифицированных siРНК Одним из важных факторов, влияющих на эффективность подавления экспрессии гена-мишени под действием siРНК и обеспечивающих длительность достигнутого эффекта, является сохранность siРНК в клетке и культуральной среде. Замена большого числа нуклеотидов или всех нуклеотидов в составе siРНК на их химически модифицированные аналоги обычно существенно снижает или даже полностью блокирует их интерферирующую активность. Поэтому создание паттернов или алгоритмов модификации, позволяющих минимизировать число модифицированных звеньев в составе siРНК, необходимое для повышения ее нуклеазоустойчивости, представляет собой актуальную задачу. Для того, чтобы выявить нуклеазочувствительные сайты в составе siРНК и ввести минимально-необходимое количество 2’-OMe модификаций мы решили исследовать распределение нуклеазочувствительных сайтов в составе siРНК отличающихся по последовательности.

Для исследования специфичности расщепления siРНК в присутствии сыворотки мы использовали две 21-звенные siРНК siD и siE, которые были выбраны ранее (Табл. 7).

Исследование расщепления siD (Рис. 11, A-Г) и siE (данные не приведены) показало, что в присутствии сыворотки происходит специфическое эндорибонуклеазное расщепление и дефосфорилирование siРНК.

Анализ продуктов деградации siD показал, что расщепление происходит, в основном, по CрA, UрG и UрA сайтам. Набор типичных продуктов деградации появляется уже через 3 минуты инкубации и некоторые из них сохраняются интактными в реакционной смеси до конца инкубации (24 ч). Скорость деградации не позволила нам различить сайты первичного и вторичного расщепления. Следует отметить, что расщепления по сайтам U13-G14 в составе смысловой цепи и U11-G12 в составе антисмысловой цепи не наблюдалось. Укорочение продуктов расщепления сопровождалось усилением степени их дефосфорилирования. В случае siE паттерн расщепления оказался более сложным. Прежде всего, следует отметить, что эта siРНК оказалась более устойчивой к деградации и интактный дуплекс полностью не диссоциировал в процессе электроферетического разделения в присутствии 7 М мочевины. Сравнение температур плавления дуплексов E и D показывает, что siE существенно термостабильнее (Tm 81.5oC) чем siD (Tm 71.8 oC), что может быть причиной ее повышенной нуклеазоустойчивости. Во вторых, при расщеплении этой siРНК обнаружены новые мотивы, по которым происходит основное расщепление (CрC, UрU) и сайты минорного расщепления (GрG, UрC, AрU). Расщепление по этим мотивам зависело от их расположения в структуре дуплекса и окружающего контекста, тогда расщепление по найденным нами ранее в составе siD мотивам (CpA, UpA и UpG) происходило во всех местах, где они встречались.

Таблица 7. Последовательности и температуры плавления siРНК Обозначение ПоследовательностьTm, oCsiE 5’-AUCAUCCAUGGGGCUGGACUU-3’ 81.3’-GGUAGUAGGUACCCCGACCUG-5’ 5’-AUCAUCCAUGGGGCUGGACUU-3’ siEm 83.3’-GGUAGUAGGUACCCCGACCUG-5’ 5’-AUCAUCCAUGGGGCUGGACUU-3’ siE2 84.3’-GGUAGUAGGUACCCCGACCUG-5’ 5’-AUCAUCCAUGGGGCUGGACUU-3’ siErm 83.3’-GGUAGUAGGUACCCCGACCUG-5’ siD 5`-GGCUUGACAAGUUGUAUAUGG-3` 71.3`-AACCGAACUGUUCAACAUAUA-5` 5`-GGCUUGACAAGUUGUAUAUGG-3` siD1 74.3`-AACCGAACUGUUCAACAUAUA-5` 5`-GGCUUGACAAGUUGUAUAUGG-3` siD2 74.3`-AACCGAACUGUUCAACAUAUA-5` 5`-GGCUUGACAAGUUGUAUAUGG-3` siDm 77.3`-AACCGAACUGUUCAACAUAUA-5` 5`-GGCUUGACAAGUUGUAUAUGG-3` siD4 76.3`-AACCGAACUGUUCAACAUAUA-5` 5`-GGCUUGACAAGUUGUAUAUGG-3` siD5 75.3`-AACCGAACUGUUCAACAUAUA-5` N -2’-OMe аналоги С, U и А ; 2 Tm измерена к.т.н. Ломзовым А. А. (ИХБФМ СО РАН).

А Б мин ч мин ч Рис. 11. Картирование нуклеазоL K 3 15 30 1 2 4 8 24 L K 3 15 30 1 2 4 8 чувствительных сайтов в siD, Uсодержащей 5’-[32P]-меченые (А, Б) и U3’-меченные (В, Г) смысловые (А, В) CU5 или антисмысловые (Б, Г) цепи.

GАвторадиограф 10%-ного Uденатурирующего ПААГ. Дорожка L имидазольный леддер; дорожка К, siРНК, после инкубации в IMDM без сыворотки. siРНК (3 нM) инкубировали в IMDM с 10% FBS при 37°C. Время фосфат фосфат инкубации указано сверху. Д – Схема В Г расщепления siD. Маленькие и мин ч мин ч большие стрелки указывают на L K 3 15 30 1 2 4 8 24 L K 3 15 30 1 2 4 8 интенсивность расщепления.

CUCUCUфосфат фосфат Д 5`-G-G-C-U-U-G-A-C-A-A-G-U-U-G-U-A-U-A-U-G-G-3` 3`-A-A-C-C-G-A-A-C-U-G-U-U-C-A-A-C-A-U-A-U-A-5` Мы сконструировали серию siРНК (Табл. 7), содержащих разное количество модифицированных нуклеотидов: siD1 и siEm содержали 2’-OМе остатки во всех экспериментально обнаруженных нуклеазочувствительных сайтах, siD2 и siE2 содержали модификации в нуклеазочувствительных сайтах, расположенных только во фланкирующих участках дуплекса, siDm содержала те же модификации, что и siD1 плюс дополнительные модификации, определенные по контексту (UpG и UpA). В составе siDбыл модифицирован каждый второй нуклеотид (всего 19 модификаций, только 3 из них совпадают с нуклеазочувствительными сайтами, подвергнутыми модификации в составе siD3) и siD5, в которой каждый второй нуклеотид во фланкирующих районах был модифицирован (всего 12 модификаций, только 1 модифицированный сайт совпадает с siD3) и siErm с таким же количеством модификаций, что содержится в составе siEm, но расположенных в других сайтах. С учетом механизма действия РНКазы А 2’-OМе-аналоги нуклеотидов были включены с 5’-стороны нуклеазочувствительной связи для того, чтобы обеспечить ее стабильность. Расщепление химически модифицированных siРНК в присутствии сыворотки исследовали по такой же экспериментальной схеме, которая была использована для картирования расположения нуклеазочувствительных сайтов. Результат электрофоретического анализа продуктов расщепления siD1, D2, Dm и D4, содержащих 5’-меченые антисмысловые цепи, показал, что модификация нуклеазочувствительных сайтов существенно повысила стабильность siРНК в присутствии сыворотки.

Данные показали (Рис. 12), что все нуклеазочувствительные связи, защищенные введением с 3’-стороны 2’-ОМе аналогов, кроме Сm19-A20 в составе siDm, стабильны в течении всего времени инкубации. Этот сайт расположен вблизи конца дуплекса, поэтому можно предположить, что расщепление этой связи происходит под действием экзонуклеаз, которые не используют 2’-положение рибозы для отщепления концевого нуклеотида. Наблюдаемая медленная кинетика постепенного укорочения олигорибонуклеотидной цепи на 1 н., которая наблюдается при анализе продуктов деградации (Рис. 12), подтверждает правомерность этого предположения. В составе нуклеазоустойчивых siРНК были обнаружены следующие сайты расщепления: U4-A5, A20-A21 в составе siD1, U4-A5 в siD2 и минорные сайты C9-U10, U13-C14 и A20-A21 в siD3. Очевидно, что во всех исследованных siРНК расщепление связи A20-Aпроисходит под действием экзонуклеаз. Следует отметить, что немодифицированный нуклеазочувствительный сайт C6-A7, расположенный в центральной части дуплекса siDявляется сайтом первичного расщепления и модификация сайтов, расположенных во фланкирующих районах не защищает его от разрезания. Из полученные данных следует, что связь U4-A5 так же принадлежит к нуклеазочувствительным сайтам, однако из-за быстрого расщепления связи U2-A3 в составе немодифицированной siD (при исследовании 5’-меченой цепи) и связи C6-A7 в составе 3’-меченой цепи этой же siРНК, этот сайт не был обнаружен в составе siD экспериментально. Модификация этого сайта в составе siDm защищает дуплекс от деградации и позволяет ему оставаться интактным в присутствии сыворотки в течении длительного времени. При инкубации этого дуплекса наблюдается только незначительное расщепление по минорным сайтам и медленное укорочение на 1 нуклеотид выступающих 3’-концов. Учитывая эти данные, следует заключить, что дополнительная защита 3’-концов дуплекса с помощью химических модификаций позволила бы еще больше увеличить устойчивость siРНК в присутствии сыворотки к действию экзонуклеаз. Расщепление контрольной siD4 (Рис. 12 Г) показывает, что случайное распределение модифицированных аналогов в структуре дуплекса не увеличивает стабильность siРНК в присутствии сыворотки, тогда как защита всех нуклеазочувствительных сайтов (как в случае siDm) необходима для получения нуклеазоустойчивой siРНК.

А. Б.

5`-G-G-C-U-U-G-A-C-A-A-G-U-U-G-U-A-U-A-U-G-G-3` 5`-G-G-C-U-U-G-A-C-A-A-G-U-U-G-U-A-U-A-U-G-G-3` 3`-A-A-C-C-G-A-A-C-U-G-U-U-C-A-A-C-A-U-A-U-A-5` 3`-A-A-C-C-G-A-A-C-U-G-U-U-C-A-A-C-A-U-A-U-A-5` В. Г.

5`-G-G-C-U-U-G-A-C-A-A-G-U-U-G-U-A-U-A-U-G-G-3` 5`-G-G-C-U-U-G-A-C-A-A-G-U-U-G-U-A-U-A-U-G-G-3` 3`-A-A-C-C-G-A-A-C-U-G-U-U-C-A-A-C-A-U-A-U-A-5` 3`-A-A-C-C-G-A-A-C-U-G-U-U-C-A-A-C-A-U-A-U-A-5` Рис. 12. Схема расположения нуклеазочувствительных сайтов в составе 5’-меченной антисмысловой цепи siD1 (A), siD2 (Б), siDm (В) и siD4 (Г). siРНК (3 нM) инкубировали в IMDM с 5% FBS при 37°C.

Анализ продуктов деградации siEm не выявил расщепления по сайтам, защищенным введением 2’-OМе аналогов (данные не приведены).

Был выявлен ряд сайтов минорного расщепления: A1-U2, U5-C6, C6-C7 в составе смысловой цепи siEm и U2-C3, C7-C8 в составе антисмысловой цепи siEm, однако расщепление этих сайтов происходило с намного меньшей эффективностью, чем расщепление основных сайтов в составе siE и интактные модифицированные дуплексы наблюдались в реакционной смеси в течении длительного времени. Исследование деградации siE2 происходило аналогичным образом: были выявлены те же самые минорные сайты, что и в случае siЕm. Расщепление незащищенных нуклеазочувствительных сайтов в центральной части дуплекса siE2 происходило с существенно более низкой эффективностью (C7-A8 в смысловой цепи, U12-G13 в антисмысловой цепи) или не происходило вовсе (U9-G10 смысловой цепи и C10-A11 в антисмысловой цепи). Этот результат показывает, что эти сайты являлись сайтами вторичного расщепления и модификация фланкирующих районов, которая предотвращает появление более коротких продуктов деградации дуплекса и их диссоциацию, защищает эти сайты от расщепления.

Для того, что бы сравнить кинетики деградации полученных siРНК в присутствии 5% и 50 % сыворотки мы останавливали реакцию расщепления добавляя равный объем уравновешенного водой фенола с последующим выделением продуктов реакции и их анализом в ПААГ в неденатурирующих условиях. Стабильность немодифицированных siРНК существенно отличалась: деградация siE происходила довольно медленно и после ч инкубации в присутствии 5% сыворотки в реакционной смеси оставалось около 50% исходной siE (Рис. 13 A). Немодифицированная siD полностью расщеплялась менее чем за 15 мин. Этот результат может объясняться различием в термостабильности дуплексов:

измеренные температуры плавления для этих siРНК составили 81.5oC для siE и 71.8oC для siD (Табл. 13). Контрольные эксперименты показали (данные не приведены), что антисмысловая цепь siE в одноцепочечном состоянии расщеплялась по тем же сайтам, но значительно быстрее, чем та же цепь в составе дуплекса. Найдена прямая корреляция между количеством защищенных нуклеазо-чувствительных сайтов и стабильностью siРНК в присутствии сыворотки. siEm и siDm в которых все нуклеазочувствительные сайты (как найденные экспериментально, так и предположенные на основе анализа последовательности) были подвергнуты модификации оказались наиболее стабильными и сохранялись в реакционной смеси до конца инкубации (8 ч).

Рис. 13. Определение нуклеазоустойчивости 2’O-метильных аналогов siРНК в ростовой среде IMDM c 5 %-ной (A) и 50 %-ной (Б) FBS.

Электрофоретический анализ образцов проводили в 15 %-ном ПААГ. K - не инкубированная siРНК.

Наличие только двух незащищенных нуклеазочувствительных сайтов (U-G и CA) в составе siD1 существенно снижает ее устойчивость по отношению к рибонуклеазам сыворотки по сравнению с siDm: время полужизни для siD1 и siDсоставило 1 и 2 ч, соответственно. В то же время, 50% исходной siE2 с модификациями нуклеазочувствительных сайтов во фланкирующих районах оставалось в реакционной смеси после инкубации, то есть она тоже была менее стабильна чем siEm.

Повышение концентрации сыворотки в реакционной смеси до 50% выявило еще более существенные отличия в стабильности случайно модифицированных, селективно модифицированных и немодифицированных siРНК (Рис. 13 Б).

siD, как и ожидалось, полностью расщеплялась менее, чем за 15 мин, однако времена полужизни немодифицированной siE и частично модифицированных siD1 и siDсократились до 30 мин – 1 ч. Напротив, селективно модифицированные siРНК, в которых все нуклеазочувствительные сайты были защищены (siEm и siDm), были стабильны по крайней мере до 4 ч инкубации в присутствии 50% сыворотки. Полученные данные показали, что введенные случайным образом модификации в составе siD4, siD5 и siE3 не увеличили существенно их стабильность в присутствии сыворотки. Таким образом, можно сделать вывод, что более термостабильный дуплекс среди дуплексов с однотипным распределением модификаций (селективным или случайным) может быть более устойчив к действию рибонуклеаз, однако именно распределение модификаций определяет устойчивость к рибонуклеазам, при этом простого повышения термостабильности недостаточно для повышения стабильности в присутствии сыворотки.

Для оценки интерферирующей активности siРНК использовали модельную систему, в которой плазмиду pEGFP-MDR1, содержащую 293-751 н. фрагмент кДНК гена MDRслитый с последовательность EGFP ко-трансфецировали с siРНК в клетки HEK 293. siD, siE и их химически модифицированные аналоги специфически подавляли экспрессию химерного гена EGFP-MDR1, тогда как siI не влияла на его экспрессию (Рис. 14 A).

Селективная модификация нуклеазочувствительных сайтов оказывает лишь незначительное (siD1 – 8 модификаций, siDm – 12 модификаций, siEm и siE3 - модификаций) или вообще не влияет (siD2 – 6 модификаций) на интерферирующую активность исследуемых siРНК.

Снижение интерферирующей активности четко коррелирует с количеством модифицированных оснований в составе siРНК: наиболее низкой активностью обладала siD4, содержащая 19 модифицированных оснований. Следует отметить, что siE3 была существенно менее активна, чем содержащая такое же количество модификаций и имеющая сходную температуру плавления siEm при концентрации 100 нМ. Это может свидетельствовать о неблагоприятном расположении модифицированных оснований в структуре дуплекса, изменяющем его термоасимметрию и, таким образом, негативно влияющем на его интерферирующую активность.

Для того, что бы определить длительность интерферирующего действия siРНК, мы исследовали изменение уровня экспрессии гена EGFP-MDR1 в клетках HEK 293 в течении 6 дней после ко-трансфекции плазмиды pEGFP-MDR1 вместе с 1 нM siD или ее аналогами, или 50 нM siE, или siEm. Трансфекция 2’-OМе-аналогов siD эффективно ингибирует экспрессию гена-мишени (на 90-95% через 24 ч) по сравнению с пробами, трансфецированными siI или обработанными только трансфекционным агентом (Рис. В).

Наиболее длительный ингибирующий эффект наблюдается после трансфекции siDm:

72% снижение экспрессии гена-мишени было зафиксировано через 144 ч после трансфекции. Наименее длительное подавление экспрессии наблюдалось под действием siD5: уровень экспрессии гена-мишени начинал увеличиваться уже через 48 ч после начала эксперимента. Немодифицированная siD и частично модифицированная siDпродемонстрировали сходную длительность ингибирующего действия: сниженный уровень экспрессии гена EGFP-MDR1 наблюдался до 96 ч после трансфекции, однако через 144 ч он был на 40% ниже, чем в контроле. Таким образом, полученные данные показывают, что довольно существенное повышение нуклеазоустойчивости siD2 в присутствии сыворотки не сопровождается увеличением длительности интерферирующего действия в клетках. Только модификация всех нуклеазочувствительных сайтов (как выявленных экспериментально, так и предсказанных на основе анализа последовательности) предотвращает деградацию siDm и существенно увеличивает длительность ее ингибирующего действия. Длительность ингибирующего действия siDm была сравнима с длительностью ингибирующего действия плазмиды, кодирующей shРНК, направленную в той же последовательности в составе MDR1 мРНК (данные не приведены), поэтому можно предположить, что снижение эффективности интерферирующего действия в обоих случаях происходит за счет снижения внутриклеточной концентрации siРНК или плазмиды в результате клеточного деления или/или деградации клеточными нуклеазами. Интерферирующие активности siE, siEm и siE3 были существенно ниже, чем активности siD и ее модифицированных аналогов, однако длительное подавление экспрессии гена мишени (примерно на 45% после 144 ч инкубации) наблюдалось только под действием siEm, которая содержала модификации в нуклеазочувствительных сайтах, тогда как активность siE и siE3 через 144 ч после трансфекции снижалась до 25 %.

Таким образом, полученные нами данные указывают на то, что тщательное картирование расположения нуклеазочувствительных сайтов является необходимым для конструирования siРНК, оказывающих продолжительное ингибирующее действие. В результате проведенного исследования нами разработан экспериментальный алгоритм получения нуклеазоустойчивых аналогов siРНК, обладающих высокой стабильностью в присутствии сыворотки и получены химически- модифицированные аналоги анти-MDRsiРНК, способные эффективно и длительно подавлять экспрессию этого терапевтическизначимого гена.

Рис. 14. Интерферирующая активность 2’-OMe- аналогов siD (A) и siE (Б) через 24 ч после трансфекции. (В) Длительность ингибирующего действия 2’-OMe- аналогов – siD (1 нМ) и siE (50 нМ).

Клетки HEK 293 котрансфицировали siРНК и плазмидами pEGFP/MDR1 и pEBFP-N1. Через 24 ч с момента трансфекции проводили оценку соотношения интенсивности сигналов зеленого (EGFP) к синему (EBFP).

4. Исследование влияния структуры химически модифицированных siРНК на эффективность РНК-интерференции В литературе описан ряд расчетных алгоритмов, которые предназначены для выбора последовательностей высокоактивных siРНК с учётом термодинамических свойств дуплексов, тем не менее, нуклеотидная последовательность мРНК мишени может не содержать 19 н. последовательностей с благоприятной термодинамической асимметрией (далее термоасимметрией), отвечающих требованиям алгоритмов. Для решения проблемы неблагоприятной термоасимметрии мишени Hohjoh c соавторами было предложено использовать нуклеотидные замены в составе 3’-конца смысловой цепи для дестабилизации этой части дуплекса [Hohjoh, 2004]. Введение таких замен в состав siРНК с низкой или средней активностью позволяет получить более активные так называемые «вилкоподобные» siРНК («fork-like» siRNA, далее по тексту – fsiРНК). К сожалению, присутствие мисматчей и длинных одноцепочечных концов в составе fsiРНК резко повышают их чувствительность к рибонуклеазам, что ограничивает их применение.

Поэтому мы предложили объединить подход, использующий введение нуклеотидных замен в состав siРНК, с разработанным нами экспериментальным алгоритмом получения нуклеазоустойчивых siРНК.

Введение нуклеотидных замен в состав siРНК для увеличения термоасимметрии дуплекса позволяет повысить эффективность действия siРНК, обладающих средней и низкой интерферирующей активностью, поэтому в наших экспериментах для конструирования «вилкоподобных» аналогов была выбрана siEm. Данная siРНК характеризуется относительно высокой температурой плавления (Табл. 8), неблагоприятной термоасимметрией и термостабильным центром, а эффективность ее ингибирующего действия не превышает 70% при концентрации 100 нМ.

Таблица 8. Последовательности и температуры плавления siРНК и fsiРНК мРНКTm, мишень siРНК 1) Последовательность 2) ° С (M14758) 5'- AUCAUCCAUGGGGCUGGAGUU -3' fsiE-1m 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUGGGGCUGGСGUU -3' fsiE-2m 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUGGGGCUUACGUU -3' fsiE-3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUGGGGCUUACGUU -3' fsiE-4m 3'- GGUAGUAGGUACCCCGACCUG -5' 76. 5'- AUCAUCCAUGGGGCUUACGUU -3' fsiE-4m+ 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUGGGGCUUACGUU -3' fsiE-4m* 3'- GGUAGUAGGUACCCCGACCUG -5' 79. 5'- AUCAUCCAUGGGGCUUACGUU -3' fsiE-4m** 3'- GGUAGUAGGUACCCCGACCUG - 5' 5'- AUCAUCCAUGGGGАСUACGUU -3' fsiE-6m 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- CGACUCCAUGGGGCUGGACUU -3' fsiE+4m 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUGGGGCUGGACUU -3' siE/3GUm 3'- GGUAGUAGGUACUUUGACCUG -5' 64. 5'- AUCAUCCAUGGGGCUGGACUU -3' siE/4GUm 3'- GGUAGUAGGUAUUUUGACCUG -5' 5'- AUCAUCCAUGGGGCUGGACUU -3' siE/3GAm 3'- GGUAGUAGGUACAAAGACCUG -5' 5'- AUCAUCCAUGAAACUGGACUU -3' siE/3ACm 3'- GGUAGUAGGUACCCCGACCUG -5' 5'- AUCAUCCAUAAAACUGGACUU -3' 598-618 н. siE/4ACm 3'- GGUAGUAGGUACCCCGACCUG -5' 52. 5'- AUGGAUCUUGAAGGGGACCGC -3' siFm 3'- CUUACCUAGAACUUCCCCUGG -5' 424-444 н.

5'- AUGGAUCUUGAAGGGUCGGGC -3' fsiF-4m 3'- CUUACCUAGAACUUCCCCUGG -5' 68. 5'- ACUUUGGCUGCCAUCAUCCAU -3' siHm 3'- CUUGAAACCGACGGUAGUAGG -5' 80.586-606 н.

5'- ACUUUGGCUGCCAUCCCGGAU -3' fsiH-4m 3'- CUUGAAACCGACGGUAGUAGG -5' 72. 5'- GAUAUCUUUGCAAAUGCAGGA -3' siJm 3'- GUCUAUAGAAACGUUUACGUC -5' 68.652-672 н.

5'- GAUAUCUUUGCAAAUUGCUGA -3' fsiJ-4m 3'- GUCUAUAGAAACGUUUACGUC -5' 1) Буква «f» указывает на «вилкоподобную» («fork»-like) структуру siРНК, буквой «m» обозначены siРНК, содержащие 2’-О-метильные аналоги нуклеотидов в нуклеазочувствительных сайтах, «m+» – siРНК, содержащие модификации в нуклеазочувствительных сайтах, включая дополнительные сайты, картированные для fsiE-4m, «m*» – siРНК, содержащие полностью модифицированную смысловую цепь, «m**» – siРНК, обе цепи которой полностью модифицированы. -1,-2,-3,-4 и -6 соответствуют количеству нуклеотидных замен с 3'-конца смысловой цепи fsiРНК, +4 соответствует четырем заменам с 5'-конца смысловой цепи. Курсивом обозначены нуклеотидные замены в смысловой или антисмысловой цепях.

2) C и U – 2’-О-метильные аналоги С и U соответственно.

Для исследования влияния структуры siРНК на ее активность были получены дуплексы fsiE-1m, fsiE-2m, fsiE-4m и fsiE-6m, содержащие 1, 2, 4 и 6 неспаренных оснований с 3’-конца смысловой («пассажирской») цепи, соответственно (Таблица 8). В качестве отрицательного контроля использовали дуплекс, содержащий 4 замены с 5'-конца смысловой цепи – fsiЕ+4m, что усугубляет неблагоприятную термоасимметрию этой siРНК. При этом данные «вилкоподобные» siРНК содержали 2’-O-метильные аналоги нуклеотидов в нуклеазочувствительных сайтах, выявленных нами в составе siE.

При исследовании с помощью проточной цитофлуорометрии биологической активности «вилкоподобных» siРНК было показано, что fsiE+4m, содержащая нуклеотидных замены с 5’-конца смысловой цепи, не проявляла интерферирующую активность (Рис. 15). Формирование одного или двух «мисматчей» с 3’-конца смысловой цепи не приводило к увеличению активности siРНК, тогда как «вилкоподобные» siРНК с четырьмя и шестью нуклеотидными заменами подавляли экспрессию гена-мишени более эффективно по сравнению с исходной siEm при концентрациях 20 – 100 нМ и 50 - 100 нМ, соответственно (Рис. 15).

Рис. 15. Влияние изменения термоасимметрии дуплекса 2’-Oметильных аналогов siРНК на их интерферирующую активность. siРНК и рекомбинантную плазмиду pEGFP/MDR1 ко-трансфицировали в клетки HEK 293, используя Липофектамин 2000 (далее по тексту, Липофектамин). Через 24 ч измеряли уровень сигнала EGFP с помощью проточной цитофлуорометрии. В качестве контроля использовали siSCRm.

Сравнение Tm исследуемых дуплексов показало, что термостабильность fsiE-1m и o fsiE-2m практически не отличалась от термостабильности исходной siEm (Tm 84.5 C), тогда как введение четырех и шести «мисматчей» в состав siEm снижает температуру плавления дуплекса (Tm 7.7 oC для fsiE-4m и 13.5 oC для fsiE-6m) и приводит к усилению его термоасимметрии (Таблица 8). Несмотря на меньшую разницу в термостабильности, более высокой активностью обладала fsiE-4m: 75%-ное подавление флуоресцентного сигнала EGFP наблюдалось при концентрации 20 нМ, тогда как сходный уровень подавления гена-мишени под действием fsiE-6m наблюдался только при концентрации siРНК 50 нМ (Рис. 15). Концентрация fsiE-6m, при которой наблюдалось 50 %-ное ингибирование экспрессии гена-мишени (IC50), составила 27.5 нМ, тогда как IC50 siEm – 18.5 нМ. Снижению интерферирующей активности fsiE-6m могли способствовать конформационные изменения, вызванные заменами и приводящие к нарушению узнавания siРНК компонентами комплекса RISC. Значительная дестабилизация siРНК также могла способствовать диссоциации дуплекса.

При сравнении биологической активности серии селективно модифицированных siРНК, направленных к участкам F, H и J мРНК гена MDR1 (Таблица 8), с активностью их «вилкоподобных» вариантов с 4 «мисматчами» было показано, что «вилкоподобные» siРНК более активны (рис. 15).

Эти данные коррелируют с данными по подавлению синтеза Р-гликопротеина в клетках KB-8-5 (данные не приведены), согласно которым, эффективность действия «вилкоподобных» siРНК в 1.2 – 1.8 раза превышала активность «классических» siРНК.

Исследование нуклеазоустойчивости siРНК показало, что в большинстве случаев стабильность «вилкоподобных» siРНК ниже, чем стабильность «классических» siРНК.

Тем не менее, при сравнении стабильности немодифицированной fsiE-4 (полностью деградировала в течение 15 мин) и ее селективно модифицированного аналога fsiE-4m (превращался в стабильный более короткий продукт через 15 мин инкубации) (Рис. 16), показано, что 2’-O-метильные аналоги нуклеотидов защищают «вилкоподобные» siРНК от действия рибонуклеаз. Мы сравнили характер расщепления смысловых цепей siEm и fsiE4m в присутствии сыворотки (данные не приведены). При картировании нуклеазочувствительных сайтов были выявлены три дополнительных сайта расщепления в составе fsiE-4m. Один из них располагался, как и ожидалось, в одноцепочечном районе с 3’-конца смысловой цепи дуплекса, тогда как два других (C6-C7 и U5-C6) соответствовали минорным сайтам расщепления, картированным в siEm. Введение трех 2’-О-метильных аналогов нуклеотидов в данные сайты позволило получить «вилкоподобную» siРНК, fsiE4m+, стабильную при инкубации в присутствии сыворотки до 8 ч (Рис. 16). Данная siРНК была несколько менее активна по сравнению с fsiE-4m: величина IC50 fsiE-4m+ составила 47 нМ.

Для определения влияния дополнительной модификации в fsiE-4m+ на продолжительность ее ингибирующего действия было проведено исследование кинетики подавления экспрессии EGFP/MDR1 (Рис. 17 А). Показано, что через 2 суток с момента трансфекции эффективность действия «вилкоподобных» siРНК была сопоставима и составляла порядка 70 % (Рис. 17 Б). Активность немодифицированной fsiЕ-4 значительно снижалась через 6 суток инкубации, тогда как ингибирующая активность селективно модифицированных аналогов проявлялась до 15 суток. В то же время, активность селективно модифицированной siЕm заметно снижалась уже через 8 суток инкубации.

Таким образом, комбинация модификации структуры дуплекса и химических модификаций позволила получить нуклеазоустойчивые siРНК, способные индуцировать РНК-интерференцию в течение 15 дней после однократной трансфекции, что превышает длительность действия всех синтетических siРНК, описанных в литературе ранее.

Комбинированный подход, включающий введение нуклеотидных замен и селективную модификацию был успешно применен для конструирования селективных ингибиторов экспрессии химерного гена AML-ETO с сохранением экспрессии аллеля дикого типа и для коррекции неблагоприятной термоасимметрии дуплекса после селективной модификации, направленного на подавление экстрессии гена LMP2 (данные не приведены). Считается, что низкая термостабильность центральной части дуплекса обеспечивает формирование предпочтительной конформации при расщеплении мРНКмишени, а также облегчает диссоциацию «направляющей» цепи после расщепления мишени, позволяя тем самым RISC* приступить к поиску нового субстрата. Несмотря на то, что центральная часть siРНК является чувствительной к модификациям, мы предположили, что дестабилизация данного района путем введения нуклеотидных замен, приводящих к образованию неканонических пар или «мисматчей», может способствовать увеличению интерферирующей активности siРНК. Мы исследовали влияние нуклеотидных замен в составе дуплекса селективно модифицированной siEm на ее интерферирующую активность. Данная siРНК содержит 4 GC-пары в позициях 7 – 10 н. с 5’-конца антисмысловой цепи. В работе использовали ее структурные варианты, содержащие в данном районе 3 или 4 «мисматча» или неканонических GU-пары (Табл. 8), полученные в результате нуклеотидных замен в смысловой или антисмысловой цепи дуплекса. Показано, что введение нуклеотидных замен привело к значительному снижению температуры плавления siРНК. При исследовании биологической активности обнаружено, что дестабилизация центральной части дуплекса не блокирует интерферирующую активность siРНК (Рис. 18).

Более того, активность siРНК с 3 GU-парами превышает активность siРНК «классической» структуры: 90 % подавление экспрессии гена-мишени наблюдалось при использовании ее в концентрации 100 нМ (Рис. 18). Аналогичные данные были получены при снижении уровня Р-гликопротеина (данные не приведены): активность siЕ/3GUm в раза превышала активность siEm.

Введение замен в центральной части дуплекса, приводящих к образования GU пар, было успешно использовано нами для конструирования siРНК, направленной на два генамишени С-MYC и N-MYC, имеющих участок высокой гомологии. Таким образом, полученные нами данные показали, что введение неканонических GU-пар в центральную часть селективно модифицированных дуплексов является перспективным подходом для оптимизации структуры siРНК.

К 15’ 30’ 1ч 2ч 4ч 8ч Рис. 17. Длительность подавления экспрессии гена EGFP/MDR1 селективно модифицированными 2’-Oметильными аналогами «вилкоподобных» siРНК. А.

Схема эксперимента. Клетки HEK 293 трансфицировали siРНК (100 нM) и инкубировали (N-1) день (где N: 2 – 17 дней), после чего трансфицировали рекомбинантной плазмидой pEGFP/MDR1. Через N дней инкубации оценивали уровень экспрессии EGFP методом проточной цитофлуорометрии (Б).

Рис. 16. Определение нуклеазоустойчивости 2’-O-метильных аналогов siРНК в ростовой среде DMEM c 10%-ной FBS. Электрофоретический анализ образцов проводили в 15 %-ном ПААГ. K - не инкубированная siРНК.

Рис. 18. Интерферирующая активность селективно модифицированных 2’-O-метильных аналогов анти-MDR1 siРНК с дестабилизированной центральной частью дуплекса. siРНК и рекомбинантную плазмиду pEGFP/MDR1 ко-трансфицировали в клетки HEK 293, через 24 ч измеряли уровень сигнала EGFP с помощью проточной цитофлуорометрии.

5. Липофильные производные siРНК Основным фактором, который ограничивает биомедицинское примененние siРНК, является неэффективная доставка в клетки и ткани. Конъюгирование siРНК с липофильными молекулами, такими как холестерин, желчные и жирные кислоты, является перспективным подходом к решению проблемы доставки siРНК in vivo. В настоящем исследовании мы сравнили способность проникать в клетки без использования носителя и биологическую активность различных липофильных конъюгатов нуклеазоустойчивой анти-MDR1 siDm. Для присоединения к 5’-концу смысловой цепи были использованы следующие липофильные молекулы: холестенин (Chol-), олеиловый спирт (Oleyl-), литохолевая кислота (Lit-) и ее олеиламид (Oleyl-Lit-). Липофильные молекулы были присоединены напрямую или через алифатический амино-пропильный, -гексильный, октильный, -децильный или -додецильный линкеры.

Накопление липофильных siРНК, содержащих остаток флуоресцеина на 5’-конце антисмысловой цепи, в клетках KB-8-5, HepG2 и HEK 293 определяли с помощью цитофлуорометрии через 4 ч после добавления соответствующих siРНК. Полученные данные показали, что эффективность накопления в клетках siРНК зависит от типа клеточной линии, однако во всех случаях конъюгаты, содержащие остатки холестерина или олеиламида литохолевой кислоты накапливались в клетках значительно эффективнее, чем остальные конъюгаты аналогичного строения (Рис. 19). Немодифицированная siРНК и конъюгаты siРНК и литохолевой кислоты практически не накапливались в клетках KB-8-и HepG2 (Рис. 19 A, В), в отличие от клеток HEK293, где эффективность трансфекции для этих siРНК достигала 90% при концентрации 5 M (Рис. 19 Д). Накопление конъюгатов siРНК с олеиловым спиртом было незначительно. Сравнение средних уровней флуоресценции клеток выявило существенное преимущество холестерин-содержащих siРНК по сравнению со всеми остальными конъюгатами (Рис. 19 Б, Г, Е).

Было обнаружено, что длина линкера между siРНК и липофильным остатком существенно влияает на накопление конъюгатов в клетках. Конъюгаты, содержащие 6 и более углеродных атомов накапливались в клетках более эффективно, чем конъюгаты без линкера или содержащие более короткий линкер (Рис. 19). Оценка эффективности трансфекции при более низких концентрациях конъюгатов (0.2 - 1 M) показала, что процент трансферированных клеток так же увеличивается с удлинением линкера (Рис. A, В, Д). Эффективность трансфекции клеток HEK293 составила 0%, 20%, 50% и 70% для клнъюгатов siРНК с холестерином, присоединенным напрямую (без линкера) и соединенным через аминопропильный, аминогексильный и аминододецильный линкер, соответственно (Рис. 19 Д). Такая же зависимость наблюдается и при сравнении уровней средней флуоресценции клеток (Рис. 19 Б, Г, Е).

Рис. 19. Эффективность накопления FITC-меченых липофильных производных R-siDm-Flu в клетках HEK293 (А, Б), KB-8-5 (В, Г) и HepG2 (Д, Е) в среде без сыворотки.

Эффективность трансфекции (%) (А, В, Д); соотношение среднего уровня флуоресценции (RFU) популяции клеток в образце, обработанном производным siРНК, к среднему уровню автофлуоресценции клеток в необработанном контроле (Б, Г, Е).

Исследование кинетики накопления в клетках конъюгатов Chol-6-siDm, Chol-12siDm и Oleyl-Lit-6-siDm показало, что максимальный средний уровень флуоресценции наблюдается в клетках через 8 ч после добавления конъюгатов, при этом накопление конъюгатов холестерина происходит в 2.5 – 3 раза более эффективно, чем Oleyl-Lit6-siDm.

Через 24 ч инкубации липофильных siРНК с клетками средняя флуоресценция последних существенно снижается по сравнению с 8-часовым уровнем.

Локализацию холестерин-содержащих siРНК в клетках КВ-8-5 исследовали с помощью конфокальной флуоресцентной микроскопии. Показано, что через 8 ч с момента начала инкубации холестерин-содержащие siРНК действительно накапливаются в клетках (Рис. 20 Б, В). При этом наблюдается дисперсное распределение соединений в цитоплазме, которое достигает наибольшей плотности с наружной стороны ядра. В отличие от холестерин-содержащих siРНК, исходная siDm-Flu не проникала в клетки (Рис. 20 А).

Таким образом, нами получены липофильные производные siРНК, способные проникать в клетки без использования трансфекционных агентов.

Исследование кинетики ингибирующего действия холестерин-содержащих siРНК проводили на лекарственно-устойчивой линии клеток KB-8-5 по определению уровня продукта гена MDR1 P-гликопротеина (P-gp) с помощью Вестерн блот анализа через 3 – дней инкубации клеток с конъюгатами (5 M). Эффективность подавления экспрессии гена-мишени MDR1 увеличивается с увеличением длины линкера от 0 до 6 -10 атомов углерода и коррелирует с эффективностью накопления конъюгатов в клетках (Рис. 21).

Рис. 20. Локализация siРНК (2 мкМ) A. Б. В.

в клетках KB-8-5 через 8 ч инкубации с siDm-Flu (A), Chol-6siDm-Flu (Б) и Chol-12-siDm-Flu (B).

Зеленый фильтр (FITC-меченые siРНК); синий фильтр (окрашивание ядер с помощью DAPI); красный фильтр (окрашивание актиновых филаментов с помощью РодаминаФаллоидина).

Рис. 21. Уровень Pгликопротеина в клетках KB-8-5, обработанных холестеринсодержащими анти-MDRsiРНК. A. Кинетика подавления синтеза P-гликопротеина производными анти-MDRsiРНК и холестерина (5 мкМ) и siDm (0.1 мкМ) в комплексе с Липофектамином. Б. Уровень Pгликопротеина через 5 дней с момента начала инкубации клеток KB-8-5, трансфицированных производными siРНК и siDm / Липофектамин.

Дальнейшее увеличение длины линкера до додецильного приводит к снижению эффективности ингибирующего действия и задержке снижения уровня P-gp. 40% снижение уровня P-gp было зафиксировано на 4-й день после добавления Chol-6-siDm к клеткам, действие Chol-8-, Chol-10- и Chol-12-siDm в той же временной точке было менее выраженным (30, 25 и 18% снижение уровня P-gp, соответственно), уровни P-gp в клетках, инкубированных с Chol-0- и Chol-3-siDm не отличались от уровней в контроле.

Максимальное снижение уровня P-gp наблюдалось в клетках, инкубированных с холестерин-содержащими siРНК с линекрами длиной 3 - 10 атомов углерода на 5-й день эксперимента (60% для Chol-6-, Chol-8- и Chol-10-siDm и 50% для Chol-3-siDm).

Следует отметить, что статистически достоверного отличия между ингибирующим действием этих конъюгатов обнаружено не было, хотя действие Chol-3-siDm было несколько менее эффектиным.

Активность Chol-12-siDm была достоверно ниже, чем активность Chol-6-, Chol-8- и Chol-10-siMDRs: этот конъюгат снижал уровень P-gp только на 30% через 4 дня инкубации (<0.02, Chol-12-siDm vs. Chol-6-, Chol-8- или Chol-10-siDm). Через 6 дней инкубации уровень Р-гликопротеина был практически одинаков в образцах клеток, обработанных Chol-6-, Chol-8- и Chol-10-siDm (Рис. 21 A). Ингибирующее действие Chol12-siDm, напротив, усилилось и уровень Р-gp снизился до 57% что практически не отличается от уровня этого белка в клетках, инкубированных с Chol-3-, Chol-6- и Chol-10siDm в течении такого же времени, активность Chol-8-siDm была несколько выше (<0.05, Chol-8-siDm vs. Chol-12-siDm). Ингибирующее действие всех конъюгатов снижалось к 7 - 8 дням инкубации и не превышало в этот период 15 - 20% (Рис. 21 A). Chol-0-siDm не обладал биологической активностью. Таким образом, длина линкера между siРНК и холестерином критически важна для биологической активности таких конъюгатов.

Сравнение уровней P-gp после инкубации с липофильными конъюгатами без носителя и после трансфекци siРНК с помощью Липофектамина 2000 выявило существенные отличия в кинетике ингибирования: в первом случае уровень P-gp через дня инкубации клеток с конъюгатами практически не отличался от уровня этого белка в контроле (Рис. 21 A), тогда как во втором случае (трансфекция с Липофектамином 2000) в это время уже наблюдалось 65% снижение уровня P-gp. На 5 – 6 сутки эксперимента ингибирующее действие siDm (200 нM) трансфецированной в клетки с помощью Липофектамина 2000 было сравнимо с действием Chol-3-, Chol-6-, Chol-8-, Chol-10-siDm (5 M) использованным без трансфекционного агента.

Способность холестерин-содержащих siРНК (1-5 M) обращать фенотип МЛУ клеток исследовали, определяя количество живых клеток в популяции в присутствии 3нМ винбластина с помощью МТТ теста. Полученные результаты показали, что контрольная siScr и ее конъюгаты с холестерином (Chol-0-, Chol-3-, Chol-6-, Chol-8-, Chol10- и Chol-12-siScr) не влияют на устойчивость клеток к цитостатику и на жизнеспособность клеток (по сравнением с контролем), что указывает на нетоксичность таких производных и специфичность действия. Инкубация клеток с винбластином и siDm или с Chol-0-siDm так же не влияла на их жизнеспособность. И наоборот, количество клеток инкубированных с Chol-6-siDm (5 M) снижалось до 45% по сравнению с контролем, действие Chol-3-siDm и Chol-12-siDm (5 M) было менее выражено: примерно 65 - 70% живых клеток по сравнению с контролем оставалось после инкубации с этими конъюгатами. Данные по количеству живых клеток в популяции на 6 день инкубации хорошо коррелируют с данными по снижению уровня P-gp через 5 дней инкубации.

Таким образом, оптимизация структуры липофильных siРНК путем варьирования типа липофильного остатка и длины линкера между липофильным остатком и siРНК позволила нам получить серию анти-MDR1 siРНК (Chol-6-, Chol-8- и Chol-10-siDm), которые эффективно проникают в клетки без помощи трансфекционного агента, подавляют экспрессию P-gp и восстанавливают чувствительность опухолевых клеток к винбластину. Полученные липофильные siРНК можно рассматривать как прототипы лекарственных средств для повышения эффективности химиотерапии лекарственноустойчивых опухолей.

6. Иммуностимулирующее действие длинных дцРНК Одним из перспективных подходов к созданию средств подавления опухолевого роста является создание иммуномодулирующих препаратов на основе интерферонов.

Однако применение существующих препаратов интерферонов ограничено такими факторами как их пирогенность, аллергенность, опасность возникновения аутоиммунных процессов. Этих недостатков в значительной степени лишены препараты, содержащие иммуностимулирующие РНК (isРНК) – молекулы РНК определенного строения, которые индуцируют синтез эндогенных интерферонов.

Использование дцРНК, действующих одновременно по двум различным механизмам подавления экспрессии онкогенов: РНК-интерференции и активации синтеза интерферонов, в дальнейшем может найти применение в противоопухолевой терапии.

Мы исследовали антипролиферативную активность и влияние на экспрессию гена CMYC протяженных дцРНК, отличающихся по последовательности. Для ингибирования клеточной пролиферации была выбрана длинная дцРНК dsMyc, соответствующая 1159 – 1631 н. участку второго и третьего экзонов мРНК гена C-MYC. В качестве контрольных индукторов интерферона использовали дцРНК аналогичной длины dsEGFP, соответствующую району 1 – 448 н. мРНК гена EGFP и препарат поли-инозиновой-полицитидиловой кислоты поли(I:C). Длинные дцРНК получали с помощью Т7 РНК полимеразы.

Исследование изменения уровня экспрессии гена с-MYC после трансфекции в клетки КВ-3-1 препаратов дцРНК (dsMyc, dsEGFP и поли(I:C)) показало (Рис. 22), что все исследуемые препараты вызывают концентрационно-зависимое снижение уровня мРНК гена С-MYC, причем максимальное воздействие оказывает препарат dsMyc, а поли(I:C) наименее эффективен. Аналогичное исследование было проведено на клетках нейробластомы SK-N-MC (данные не приведены).

Антипролиферативное действие препаратов дцРНК на раковые клетки может осуществляться путем реализации трех независимых механизмов: специфического подавления экспрессии генов, ответственных за пролиферацию, по механизму РНКинтерференции; индукции сиситемы врожденного иммунитета т.н. "интерфероновый ответ" и за счет активации PKR и OAS.

Ингибирование пролиферации двуцепочечными РНК исследовали с помощью МТТтеста на клетках карциномы КВ-3-1 и нейробластом SK-N-MC и IMR-32 (устойчива к интерферону). Суммарные результаты по ингибированию клеточной пролиферации с помощью длинных дцРНК представлены в таблице 9. Показано, что при трансфекции исследуемых клеток длинными дцРНК наблюдается значительное ингибирование пролиферации клеток, причем максимальный эффект наблюдается под действием дцРНК с нерегулярной структурой (препараты dsMyc и dsEGFP), тогда как гомополимер поли(I:C) наименее эффективен.

Для разделения сиквенс-специфических и неспецифических эффектов siРНК и протяженных дцРНК мы исследовали динамику экспрессии генов-маркеров интерферонового ответа 2’,5’-олигоаденилат синтазы (OAS1) и дцРНК-зависимой протеин киназы R (PKR), а также интерферон-чувствительного гена -актина в клетках КВ-3-1 и SK-N-MC. Обнаружено, что при трансфекции клеток с помощью Олигофектамина препаратами dsMyc и поли(I:C) в концентрации 0.05 мкг/мл уровень мРНК гена OASповышается в 5 – 9 раз через 24 ч после трансфекции, и возвращается к исходному уровню после 72 ч инкубации. Исследование кинетики активации экспрессии PKR под действием протяженных дцРНК показало, что наблюдается колоколообразная зависимость с максимумом в районе 48 ч. Таким образом, длинные дцРНК вызывают эффективную, но кратковременную активацию экспрессии генов OAS1 и PKR.

Рис. 22. Ингибирование экспрессии гена поли(I:C) dsGFP dsMyc C-MYC под действием длинных дцРНК 1,6 dsMyc, dsEGFP или поли(I:C) в клетках КВ-3-1. Уровень мРНК гена C-MYC в 1,клетках определяли с помощью ОТ-ПЦР 1,через 24 ч (белые столбцы), 48 ч (серые 1,столбцы) и 72 ч (черные столбцы) после 0,добавления препаратов дцРНК (0,05 – 0,мкг/мл) в комплексе с 0,4 Олигофектамином. Соотношение CMYC/2m в контроле принимали за 1, 0,стандартное отклонение определяли по 0,результатам трёх независимых 0,05 0,25 0,05 0,25 0,05 0,экспериментов.

[дцРНК], мкг/мл c-myc/ m Таблица 9. Ингибирование пролиферации клеток карциномы КВ-3-1 и нейробластом SK-N-MC, IMR-32 под действием длинных дцРНК Концентрация Препараты дцРНК Степень ингибирования пролиферации препарата дцРНК КВ-3-1 SK-N-MC IMR-0.005 мкг/мл dsMyc 6.5 >10 Не влияет dsEGFP >10 >10 Не влияет поли(I:C) Не влияет Не влияет Не влияет 0.05 мкг/мл dsMyc >10 >10 Не влияет dsEGFP >10 >10 Не влияет поли(I:C) 3.5 >10 Не влияет 0.5 мкг/мл dsMyc >10 >10 2.dsEGFP >10 >10 поли(I:C) >10 >10 Не влияет В клетках SK-N-MC после трансфекции препаратов dsMyc, dsEGFP и поли(I:C) наблюдается незначительное повышение уровня мРНК PKR в 1.5 – 2 раза на первые – третьи сутки после трансфекции. Повышения уровня мРНК OAS1 в клетках SK-N-MC под действием исследуемых дцРНК не было отмечено (данные не приведены).

Таким образом, исследование изменения экспрессии генов OAS1 и PKR под действием дцРНК не дает однозначного ответа о специфичности действия препаратов дцРНК и siРНК. Мы предположили, что уровень экспрессии интерферон-чувствительных генов будет более надежным маркером интерферонового ответа клетки на введение дцРНК, поэтому мы исследовали изменение уровня экспрессии -актина, являющегося интерферон-чувствительным геном, под действием разных препаратов siРНК и длинных дцРНК в клетках КВ-3-1 и SK-N-MC. Показано, что уровень мРНК -актина значительно снижается через 24 – 72 ч после трансфекции длинных дцРНК dsMyc, dsEGFP, поли(I:C), в то время как siMyc, siEx2 и siScr не оказывали значительного влияния на экспрессию этого гена.

Таким образом, -актин может служить дополнительным маркером неспецифического интерферонового ответа, так как уровень его экспрессии значительно снижается под действием индукторов интерферона в клетках разного происхождения, кроме того, наблюдается корреляция между изменением экспрессии генов C-MYC и актина под действием дцРНК и антипролиферативным действием этих дцРНК.

8. Иммуностимулирующее действие 22-звенных двуцепочечных РНК с выступающими нуклеотидами на 3’-концах Нами было обнаружено, что полученная ферментативным путем с помощью T7 РНК полимеразы короткая двуцепочечная РНК (siI), которую мы выбрали в качестве отрицательного контроля, эффективно подавляет пролиферацию клеток карциномы и ингибирует экспрессию ряда интерферон чувствительных генов. В то же время ее химически синтезированный аналог не оказывает такого действия. Электрофоретический анализ полученного препарата isРНК выявил присутствие побочного продукта, электрофоретическая подвижность которого соответствует дуплексу длинной 22 пары нуклеотидов, который образуется в результате безматричного добавления случайного нуклеотида на 3'-конец синтезируемой цепи T7 РНК полимеразой. Мы предположили, что этот продукт активирует систему врожденного иммунитета и оказывает антипролиферативное действие на опухолевые клетки. Для выяснения того, как влияет последовательность выступающих концов на иммуностимулирующие свойства isРНК, мы исследовали антипролиферативное действие химически синтезированных 22 п.н.

дуплексов со случайными нуклеотидами, A, G, C или U, добавленными на 3’-концы обоих цепей (isРНК-N, -A, -G, -C, -U), а так же гетеродуплексов, образованных цепями 21 и п.н. РНК (isРНК-N/0, isРНК-0/N). В качестве параметра сравнения использовали концентрацию дуплекса, при которой количество живых клеток KB-3-1 через 96 ч после трансфекции сокращалось на 50% - IC50. Данные показали (Рис. 23), что добавочные нуклеотиды на обеих цепях важны для проявления антипролиферативного эффекта.

Сравнение антипролиферативной активности 22 п.н. дуплексов, отличающихся нуклеотидами на 3’-концах цепей показало, что только дуплексы isРНК-U и isРНК-A ингибируют пролиферацию опухолевых клеток, тогда как isРНК-G и isРНК-C неактивны.

Сравнение активности одноцепочечных РНК: ssРНК-A (A на 3’-конце цепи 2), -U (U на 3’конце цепи 1) и образованных ими гетеродуплеков показало, что наиболее выраженное антипролиферативное действие оказывают isРНК-U и isРНК-U/A (цепь 1 содержит U на 3’-конце, цепь 2 - A). Для этих дуплексов IC50 составило 36 и 30 нМ, соответственно.

Антипролиферативная активность isРНК-A, isРНК-A/U и одноцепочечных ssРНК-A и -U была менее выражена: IC50 около 100 нМ и даже при максимальной из использованных концентраций (200 нМ) эффективность ингибирования не превышала 55%.

Для того, чтобы определить консенсусную последовательность иммуностимулирующего мотива мы сравнили антипролифративную активность isРНК-U с активностью серии дуплексов, содержащих замены в разных частях (Рис. 23). Замены вводили в обе цепи дуплекса таким образом, что бы не нарушить комплементарные взаимодействия. Данные показали, что замены в средней части дуплекса isРНК-U затрагивающие позиции 10 - 12 (isРНК-U(10-12): UUU-мотив в цепи 1 на AGA) и позиции с 13 по 16 (isРНК-U(13-16): CAGA-мотив цепи 1 заменен на UUUU) не снижают, а даже несколько увеличивают антипролиферативную активность (IC50 15.5 нM и 17.5 нM, соответственно). Разрушение потенциально иммуностимулирующего GUGU мотива в позициях 1 – 4 (isРНК-U(2,4): UGU-мотив в цепи 1 заменен на AGA) лишь незначительно снижает активность: IC50 ~40 нМ по сравнению с 36 нМ для исходной isРНК-U.

Напротив, введение единичной замены, прерывающей олигоU мотив на 3’-конце цепи (isРНК-U(20): U заменен на C), практически блокирует антипролиферативную активность дуплекса. Удлинение выступающих 3’-концов до 4 - 11 н. (isРНК-U2-9) существенно не влияет на антипролиферативную активность, тогда как укорочение 3’-олигоU «хвоста» приводит к увеличению IC50. Таким образом, иммуностимулирующая активность исследуемых дуплексов не чувствительна к заменам в их центральной части, однако последовательность 3’-концов isРНК важна для этой функции. Можно предположить, что олигоU мотив на 3’-конце цепи 1 является иммуностимулирующим мотивом.

Рис. 23. Влияние замен на антипролиферативную активность isРНКU. Замены, которые усиливают активность, показаны зеленым цветом, ингибирующие активность замены – красным. Величина стрелок отражает уровень наблюдаемого эффекта.

Полученные данные позволяют определить консенсусную последовательность иммуностимулирующей РНК следующим образом: цепь 1 - 3’A/UUUUUUN8N9N10N11N12N13N14CGGACUGUG-5’ и цепь 2 - 5’AAAN1N2N3N4N5N6N7GCCUGACACUUU/A-3’, где N1 – N7 комплементарны, соответственно, N8 - N14.

Для выяснения механизма антипролиферативного действия мы исследовали возможное проапоптотическое действие isРНК путем селективного окрашивания живых, мертвых и находящихся в стадии апоптоза клеток. Полученные данные показали, что в отличие от поли(I:C), комплекс isРНК-U/A/Липофектамин лишь незначительно увеличивает количество «апоптотических» (8%) и мертвых клеток (6.5%) по сравнению с популяцией клеток обработанных только трансфекционным агентом. Поскольку антипролиферативное действие isРНК-U/A и поли(I:C) в тех концентрациях, которые были использованы в данном эксперименте, практически одинаково, то можно предположить, что в отличие от поли(I:C) isРНК-U/A не вызывает апоптоз, а ингибирует клеточное деление.

Для подтверждения этого предположения мы проанализировали распределение клеток KB-3-1 по фазам клеточного цикла через 48 ч после трансфекции isРНК-U/A (1нM) или поли(I:C) (50 нг/мл). Показано (Рис. 24), что под действием isРНК-U/A происходит увеличение количества клеток в G0/G1-фазе и сокращение количества клеток в фазе G2/M, в то же время число клеток в S-фазе существенно не меняется. Увеличение количества клеток в субG1-фазе, то есть, клеток в стадии апоптоза и апототических телец, до 22% под действием поли(I:C), указывает на проявление токсического действия этого препарата, напротив, только 6 – 7% клеток в фазе субG1 было обнаружено после трансфекции isРНК-U/A или действия самого трансфекционного агента. Эти результаты хорошо согласуются с данными, полученными с помощью селективного окрашивания.

Несмотря на увеличение клеток в фазах G0/G1 и S, под действием поли(I:C) существенно сокращается количество клеток в фазе G2/M. Этот результат свидетельствует о том, что индукция апоптоза под действием поли(I:C) происходит в основном в делящихся клетках.

Полученные нами результаты подтверждают предположение о том, что антипролиферативное действие isРНК осуществляется путем торможения клеточного деления и его механизм отличается от механизма поли(I:C).

Чтобы определить связаны ли антипролиферативные свойства isРНК с активацией системы врожденного иммунитета мы проанализировали влияние isРНК на продукцию цитокинов IFN-, TNF- и IL-6 адгерентных мононуклеарных клеток, выделенных из периферический крови человека (PBMC). Данные показали, что isРНК-U/A индуцирует секрецию IFN- клетками PBMC концентрационно-зависимым образом. Трансфекция клеток 100 нМ isРНК-U/A вызывает 4-х кратное повышение уровня IFN- в среде клеток PBMC, по сравнению с клетками, подвергнутыми действия только трансфецирующего агента. Под действием isРНК происходит так же активация синтеза TNF- и, в меньшей степени, IL-6. Введение в клетки контрольного активатора системы врожденного иммунитета поли(I:C) вызывает повышение уровней цитокинов TNF- и IL-6 в 15- и в 2раза, соответственно, при этом уровень IFN- в среде обработанным этим индуктором клеток остаётся сопоставимым с контролем. Таким образом, полученные нами isРНК обладают очевидным преимуществом как индукторы интерферона I типа по сравнению с поли(I:C), который повышает уровень секреции цитокинов воспаления и вызывает связанный с ними токсический эффект.

Для определения иммуностимулирующего потенциала isРНК in vivo, мы определили IFN- и IL-6 в крови мышей после внутривенного (i.v.) или интраперитонеального (i.p.) введения препаратов в комплексе с Липофектамином. Полученные данные показали (Рис.

25), что уровни IFN- и IL-6 в сыворотки крови существенно зависят от способа введения препаратов.

Рис. 24. Влияние isРНК и поли(I:C) на прогрессию клеточного цикла в клетках KB-3-1. Анализ клеточного цикла проводили с помощью флуоцитометрии через 48 ч после трансфекции isРНК (100 нM~1,4 мкг/мл) или поли(I:C) (50 нг/мл) с помощью Липофектамина. Стандартное отклонение определяли по результатам трех независимых опытов. Черные столбцы - Mock, серые столбцы - siРНК-U/A, белые столбцы - поли(I:C).

Наиболее выраженная активация секреции IFN была зафиксирована после i.v.

введения комплекса isРНК-U/A/Липофектамин (5-кратное повышение), при этом введение одноцепочечной ssРНК-U оказывало лишь незначительный эффект. isРНК-G, которая не показывала антипролиферативной и цитокин-активирующей активности в экспериментах in vitro, напротив, индуцировала 3-кратное повышение уровня IFN в сыворотки крови мышей после i.v. введения. После интраперитонеального введения исследуемых препаратов существенных изменений уровня IFN не было обнаружено.

Повышенный уровень IL-6 в сыворотке крови мышей был зафиксирован после i.p.

введения каждой из исследованных isРНК и даже после введения Липофектамина без isРНК ("Mock"). Наибольший эффект наблюдался после введения двуцепочечной isРНКU/A и одноцепочечной ssРНК-U, наименее активна была isРНК-G.

Рис. 25. Стимуляция системы врожденного иммунитета препаратами isРНКs in vivo. Комплексы isРНКs/Липофектамин вводили внутривенно (черные столбцы) или интраперитонеально (белые столбцы) мышам СBA/LacSto, из расчета 2 мг isРНК на кг веса. Уровни IFN- (A) и IL-6 (Б) определяли в сыворотки крови мышей с помощью ELISA через 6 ч после введения препаратов. Mock – мыши, получившие инъекцию трансфекционного агента (35 l) в среде OptiMEM без isРНК.

Противоопухолевые и антиметастатические свойства препаратов isРНК исследовали на самцах мышей линии CBA/LacSto с внутримышечно привитой гепатокарциномой G-и на мышах С57BL с подкожно или внутривенно привитой меланомой В16.

Исследование противоопухолевой активности показало, что инъекции препаратов isРНК-U/A и isРНК-0&N приводят лишь к незначительному снижению размера гепатокарциномы G-29 у мышей. Морфометрический анализ препаратов печени, выполненный д.б.н. Рябчиковой Е.И. показал, что лечение препаратами isРНК-U/A и isРНК-0&N приводит к уменьшению размеров и степени развития метастазов в печени, сердце и легких у мышей, по сравнению с контрольными группами животных и группой животных, получавших инъекции препарата поли(I:C). Анализ срезов первичного узла опухоли показал, что препарат isРНК-U/A вдвое сокращает зону недифференцированных клеток, вызывает почти двукратное сокращение количества делящихся клеток в периферической зоне первичного узла, уменьшение толщины самой периферической зоны и значительное увеличение интенсивности некротических процессов в центре первичного узла опухоли. Однако, несмотря на некоторую противоопухолевую и антиметастатическую активность, препараты isРНК-U/A и isРНК-0&N не увеличивали продолжительность жизни мышей с гепатомой G-29.

При исследовании мышей с подкожно привитой меланомой В16 при помощи магнитно-резонансной томографии было обнаружено, что у опытных животных размер опухолевого узла был снижен относительно контрольных. Однако, достоверных отличий между группами, получавшими инъекции препаратами isРНК, поли(I:C) и между контрольными группами не было выявлено.

Исследование антиметастатического действия препаратов isРНК на модели внутривенно привитой меланомы В16 у мышей линии C57BL показало, что в легких мышей из контрольных групп много крупных поверхностных метастазов, также как и в легких мышей, получавших лечение препаратом поли(I:C), характер метастазирования сходен. В легких мышей, получавших лечение препаратами isРНК, метастазов существенно меньше и они более мелкие. Количественная оценка уровня метастазирования (Рис. 26) показала, что у мышей, получавших лечение препаратами isРНК, количество метастазов в 5 раз меньше (р<0.005), по сравнению с контрольной группой, не получавшей лечение. Примечательно, что у группы мышей получавшей лечение препаратом поли(I:C) нет достоверных отличий от обеих контрольных групп.

Рис. 26. Количество поверхностных метастазов в легких мышей линии C57BL на 15-й день после внутривенной имплантации опухолевых клеток (1х105 клеток/мышь).

Данные обработаны по критерию МаннаУитни.

Таким образом, нами получена серия 22звенных двуцепочечных isРНКs с выступающими нуклеотидами на 3’концах, которые активируют систему врожденного иммунитета зависимым от последовательности образом.

Эти isРНК обладают высокой антипролиферативной и иммуностимулирующей активностями и могут быть использованы как адъюванты в противоопухолевой терапии.

ВЫВОДЫ Данная работа представляет собой фундаментальное исследование, в результате которого сформулированы принципы конструирования ингибиторов экспрессии терапевтически значимых генов на основе химически модифицированных малых интерферирующих РНК. Использование этих принципов дизайна позволило идентифицировать ряд перспективных молекулярных мишеней для лекарственных препаратов и сконструировать высокоэффективные ингибиторы экспрессии терапевтически значимых генов.

1. Разработан комплексный подход для поиска перспективных молекулярных мишеней для лечения опухолевых заболеваний:

изучены кинетические и концентрационные зависимости эффективности действия ингибиторов на основе siРНК и длинных дцРНК;

исследовано влияние селективного выключения экспрессии генов Her2, CCNB1, PKC и C-MYC на пролиферацию, распределение по фазам клеточного цикла и гибель различных опухолевых клеток человека. Показано, что селективное выключение генов-мишеней не вызывает гибель клеток, а с разной эффективностью ингибирует деление опухолевых клеток разных линий, что позволяет идентифицировать наиболее эффективные молекулярные мишени для каждой клеточной линии;

впервые изучено изменение скорости пролиферации исследованных клеточных линий после восстановления экспрессии генов Her2, CCNB1 и PKC. Показано, что скорость деления большинства клеточных линий восстанавливается после достижения исходного уровня экспрессии генов-мишеней, в то время как скорость деления клеток нейробластомы SK-N-MC остается в значительно сниженной в течение длительного времени после воздействия siHer, siCyc и siPKC, а также длинных дцРНК;

предложена универсальная технологическая платформа, включающая синтез siРНК, определение эффективности и специфичности действия, исследование кинетики изменения скорости пролиферации, количества клеток в стадии апоптоза и распределение клеток по фазам клеточного цикла, которая позволяет проводить скрининг потенциальных ингибиторов экспрессии генов на различных типах опухолевых клеток человека для поиска новых терапевтических препаратов.

2. Разработан универсальный экспериментальный алгоритм получения нуклеазоустойчивых химически модифицированных аналогов siРНК, содержащих минимальное количество модифицированных звеньев и оказывающих длительное и эффективное ингибирующее действие на экспрессию гена-мишени:

• исследована деградация siРНК в присутствии сыворотки крови, идентифицированы мотивы последовательности, которые подвергаются быстрому расщеплению в составе siРНК с разными последовательностями, и мотивы, нуклеазоустойчивость которых зависит от контекста последовательности;

• исследовано влияние количества и расположения 2’-O-аналогов нуклеотидов в составе siРНК на ее стабильность и интерферирующую активность; показано, что 2’-O-метильные аналоги нуклеотидов, расположенные в нуклеазочувствительных сайтах дуплекса siРНК, не изменяют ее интерферирующую активность и защищают от деградации нуклеазами эмбриональной бычьей сыворотки;

• доказано, что только модификация всех нуклеазочувствительных сайтов в составе siРНК позволяет увеличить длительность ее ингибирующего действия.

3. Проведено систематическое исследование влияния количества и расположения нуклеотидных замен в составе селективно модифицированных siРНК на их интерферирующую активность, нуклеазоустойчивость и длительность ингибирующего действия и предложен универсальный подход, позволяющий конструировать высокоэффективные siРНК, направленные к любым последовательностям, в том числе к последовательностям с неблагоприятной термодинамической асимметрией:

• показано, что замена четырех нуклеотидов на 3’-конце смысловой цепи siРНК с неблагоприятной термоасимметрией, приводящая к образованию «мисматчей» и формированию структуры типа «вилка», увеличивает эффективность подавления экспрессии гена-мишени;

• установлено, что введение нуклеотидных замен в центральную часть селективно модифицированного дуплекса, приводящее к образованию GU-пар, может способствовать увеличению эффективности подавления экспрессии гена-мишени;

• селективная модификация нуклеазочувствительных сайтов в составе siРНК, имеющих структуру «вилки», существенно увеличивает длительность их ингибирующего действия, что позволило впервые получить siРНК, способные снижать экспрессию гена-мишени в клетках в течение 15 суток после однократной трансфекции.

4. Изучено влияние природы липофильных заместителей в составе siРНК на их способность проникать в разные типы клеток без помощи трансфецирующего агента и их интерферирующую активность и сконструирован модифицированный аналог анти-MDRsiРНК, способный проникать в цитоплазму клетки, ингибировать экспрессию генамишени и вызывать терапевтически значимое изменение фенотипа клетки:

• показано, что эффективность накопления липофильных производных siРНК в клетках зависит от типа липофильной молекулы и значительно увеличивается при удлинении алифатического линкера между siРНК и липофильным остатком от 0 до 12 атомов углерода;

• обнаружено, что интерферирующая активность холестерин-содержащей siРНК увеличивается при удлинении алифатического линкера между siРНК и липофильным остатком от 0 до 6 - 10 атомов углерода, однако при дальнейшем удлинении линкера до 12 атомов углерода происходит снижение эффективности ингибирующего действия и ухудшение кинетики ингибирования.

5. Исследовано действие коротких и длинных иммуностимулирующих дцРНК как неспецифических ингибиторов экспрессии интерферон-чувствительных генов и пролиферации раковых клеток человека:

• показано, что длинные дцРНК стимулируют синтез интерферона- и цитокинов воспаления, ингибируют пролиферацию опухолевых клеток, вызывая их гибель по механизму апоптоза, тогда как короткая isРНК активирует преимущественно секрецию интерферона- , но не цитокинов воспаления и оказывает антипролиферативное действие, замедляя деление опухолевых клеток.

• идентифицирована серия 22-звенных двуцепочечных иммуностимулирующих РНК с 3 выступающими нуклеотидами на 3’-концах, которые способны ингибировать пролиферацию опухолевых клеток в культуре, стимулировать синтез интерферона- in vitro и in vivo и оказывать умеренное противоопухолевое и выраженное антиметастатическое действие при введении в организм животныхопухоленосителей.

Список публикаций по теме диссертации Обзоры:

1. Chernolovskaya, E.L., Zenkova, M.A. Chemical modification of siRNA // Curr. Opin. Mol.

Ther. - 2010. - V. 12(2). - P. 158-167.

2. Черноловская, Е.Л., РНК-интерференция: клин клином… // Наука из первых рук. - 2008. - №1. - С. 54-60.

3. Кабилова, Т.О., Черноловская, Е.Л. Онкогены семейства myc как терапевтические мишени // Бюллетень сибирской медицины. - 2008. - приложение 3. - С. 11-25.

Патент:

4. Кабилова, Т.О., Черноловская, Е.Л., Зенкова, М.А., Власов, В.В. Фрагменты двуцепочечной РНК, обладающие антипролиферативной и интерферон-индуцирующей активностями // Патент на изобретение №2391405. - рег. 10.06.2010.

Статьи:

5. Kabilova, T. O., Meschaninova, M.I., Venyaminova, A.G., Nikolin, V.P., Zenkova, M.A., Vlassov, V.V., Chernolovskaya, E.L. Short dsRNA with Immunostimulatory Activity:

Sequence Dependence // Nucleic Acid Therapeutics. - 2012. - V. 22. - No. 3. - P. 196-204.

6. Petrova, N., Chernikov, I., Meschaninova, M., Dovydenko, I., Venyaminova, A., Zenkova, M., Vlassov, V., Chernolovskaya, E. Carrier-free cellular uptake and the gene-silencing activity of the lipophilic siRNAs is strongly affected by the length of the linker between siRNA and lipophilic group // Nucl. Acids Res. - 2012. - V. 40. - P. 2330-2344.

7. Акимов, И.А., Черноловская, Е.Л., Спицына, Ю.Е., Рябчикова, Е.И., Зенкова, М.А.

Подавление экспрессии генов Her2, CCNB1 и PKC с помощью siРНК снижает скорость пролиферации клеток нейробластомы человека на длительное время // Acta naturae. - 2011.

- Т. 3. - С. 6-16.

8. Petrova, N.S., Meschaninova, M.I., Venyaminova, A.G., Zenkova, M.A., Vlassov, V.V., Chernolovskaya, E.L. Silencing activity of 2'-O-methyl modified anti-MDR1 siRNAs with mismatches in the central part of the duplexes // FEBS Lett. - 2011. - V. 585. - P. 2352-2356.

9. Кабилова, Т.О., Владимирова, А.В., Мещанинова, М.И., Веньяминова, А.Г., Зенкова, М.А., Черноловская, Е.Л., Власов, В.В. Создание противоопухолевых и иммуномодулирующих препаратов на основе коротких двуцепочечных РНК // Докл. Акад.

Наук. - 2011. - Т. 436. - С. 412-416.

10. Petrova (Kruglova), N.S., Meschaninova, M.I., Venyaminova, A.G., Zenkova, M.A., Vlassov, V.V, Chernolovskaya, E.L. 2'-O-Methyl–Modified Anti-MDR1 Fork-siRNA Duplexes Exhibiting High Nuclease Resistance and Prolonged Silencing Activity // Oligonucleotides. - 2010. - V. 20. - P. 297-308.

11. Спирин, П.В., Баскаран, Д., Орлова, Н.Н., Рулина, А.В., Никитенко, Н.А., Черноловская, Е.Л., Зенкова, М.А., Власов, В.В., Рубцов, П.М., Чумаков, П.М., Стокинг К., Прасолов, В.С. Подавление экспрессии лейкозных онкогенов AML1-ETO и RUNX1(K83N) с помощью РНК-интерференции // Молекулярная биология. - 2010. - Т. 44. - С. 876-888.

12. Круглова, Н.С., Мещанинова, М.И., Веньяминова, А.Г., Зенкова, М.А., Власов, В.В., Черноловская, Е.Л. Холестерин-модифицированные малые интерферирующие РНК, направленные на мРНК гена MDR1: внутриклеточная доставка и биологическая активность // Молекулярная биология. - 2010. - Т. 44. - C. 284-293.

13. Акимов, И.А., Черноловская, Е.Л. Подавление экспрессии генов CCNB1, HER2 и PKC с помощью малых интерферирующих РНК с разной эффективностью замедляет деление раковых клеток человека различного происхождения // Молекулярная биология. - 2010. - Т. 44. - С. 98-106.

14. Спирин, П.В., Баскаран, Д., Рубцов, П.M., Зенкова, M.A., Власов, В.В., Черноловская, E.Л., Прасолов, В.С. Сравнение эффективности подавления экспрессии целевых генов с помощью синтетических модифицированных siРНК и shРНК, экспрессируемых рекомбинантными лентивирусными векторами // Acta Naturae. - 2009. №. 2. - С. 98-103.

15. Дыгало, Н.Н., Калинина, Е.Л., Черноловская Е.Л., Зенкова, М.А., Шишкина, Г.А., Угрюмов, М.В. Модель изучения функции гонадотропин-рилизинг гормона в онтогенезе путем подавления его экспрессии интерферирующей РНК // Докл. Акад. Наук. - 2009. - Т.

426. - С. 828-830.

16. Volkov, A.A., Kruglova, N.S., Meschaninova, M.I., Venyaminova, A.G., Zenkova, M.A., Vlassov, V.V., Chernolovskaya, E.L. Selective protection of nuclease-sensitive sites in siRNA prolongs silencing effect // Oligonucleotides. - 2009. - V. 19. - P. 191-202.

17. Akimov, I.A., Kabilova, T.O., Vlassov, V.V., Chernolovskaya, E.L. Inhibition of Human Cancer Cells Proliferation by Long Double-Stranded RNAs // Oligonucleotides. - 2009. - V.

19(1). - P. 31-40.

18. Круглова, Н.С., Мещанинова, М.И., Веньяминова, А.Г., Власов, В.В., Черноловская, Е.Л. 2’-О-метильные аналоги одноцепочечных и двуцепочечных малых интерферирующих РНК: нуклеазо-устойчивость и биологическая активность // Фундаментальные науки - медицине. - 2008. - С. 129-133.

19. Логашенко, Е.Б., Волков, А.А., Черноловская, Е.Л., Зенкова, М.А., Власов, В.В.

Обращение фенотипа множественной лекарственной устойчивости раковых клеток с помощью siРНК // Вестник ВОГИС. - 2006. - Т. 10. - С. 342-351.

20. Логашенко, Е.Б., Владимирова, А.В., Волков, А.А, Репкова, М.Н., Веньяминова, А.Г., Зенкова, М.А., Черноловская, Е.Л., Власов, В.В. Подавление экспрессии гена MDR1 с помощью химически модифицированных аналогов siРНК // Известия АН, серия химическая. - 2006. - № 7. - С. 1227-1235.

21. Kabilova, Т.О., Vladimirova, A.V., Chernolovskaya, E.L., Vlassov, V.V. Arrest of cancer cells proliferation by dsRNAs // Annals of NY Acad. of Sci. - 2006. - V. 1091. - P. 425-236.

22. Кабилова, Т.О., Черноловская, Е.Л. Ингибирование пролиферации опухолевых клеток человека двуцепочечными рнк, направленными на подавление экспрессии онкогенов семейства MYC // Вестник ВОГИС. - 2006. - Т. 10. - С. 373-382.

23. Кабилова, Т.О., Владимирова, А.В., Репкова, М.Н., Веньяминова, А.Г., Черноловская, Е.Л., Власов, В.В. Подавление экспресси гена с-MYC с помощью ферментативно и химически синтезированных siРНК // Молекулярная Биология. - 2006. - Т. 40. - С. 10371046.

24. Kabilova, T.O., Chernolovskaya, E.L., Vladimirova, A.V., Vlassov, V.V. Inhibition of Human Carcinoma and Neuroblastoma Cell Proliferation by anti c-Myc siRNA // Oligonucleotides. - 2006. - V. 16. - P. 15-25.

25. Власов, В.В., Зенкова, М.А., Черноловская, Е.Л. Лекарства, адресованные генам // Наука в России. - 2005. - №2. - С. 41-44.

26. Логашенко, Е.Б., Владимирова, А.В., Зенков, А.Н., Репкова, М.Н., Веньяминова, А.Г., Черноловская, Е.Л., Власов, В.В. Обращение фенотипа множественной лекарственной устойчивости с помощью малых интерферирующих РНК // Известия АН, серия химическая. - 2005. - № 2. - С. 41-44.

27. Зенков, А.Н., Скворцова, Н.В., Черноловская, Е.Л., Зенкова, М.А., Поспелова, Т.И., Лосева, М.И., Власов, В.В. Экспрессия генов MDR1 и MRP с первичным поражением костного мозга // Бюллетель СО РАМН. - 2004. - № 4. - С. 43-48.

28. Поспелова, Т.И., Лосева, М.И., Ковынев, И.Б., Агеева, Т.А., Зенкова, М.А., Черноловская, Е.Л., Зенков, А.Н., Скворцова, Н.В., Власов, В.В. Основы опухолевой прогрессии гемобластозов // Бюллетель СО РАМН. - 2004. - № 2. - С. 73-76.

29. Логашенко, Е.Б., Кабилова, Т.О., Владимирова, А.В., Власов, В.В., Черноловская, Е.Л. Подавление экспрессии генов c-myc и mdr1 в линиях опухолевых клеток человека короткими двуцепочечными РНК (siRNA) // Вестник НОЦ. - 2004. - № 5-6. - С. 22-25.

30. Zenkov, А.N., Scvortsova, N.V., Chernolovskaya, E.L., Pospelova, T.I., Vlassov, V.V.

Expression of the MDR1 and MRP genes in patients with lymphoma with primary bone marrow involvement // Nucleosides, Nucleotides & Nucleic Acids. - 2004. - V. 23. - P. 843-847.

31. Kabilova, T.O., Chernolovskaya, E.L., Vladimirova, A.V., Vlassov, V.V. Silencing of cmyc expression in tumor cells by siRNA // Nucleosides, Nucleotides & Nucleic Acids. - 2004. - V. 23. - P. 867-872.

32. Logashenko, E.B., Vladimirova, A.V., Chernolovskaya, E.L., Repkova, M.N., Venyaminova, A.G., Vlassov, V.V. Silencing of multiple drug resistance gene in cancer cells by short double stranded RNA // Nucleosides, Nucleotides & Nucleic Acids. - 2004. - V. 23. - P.

861-866.

33. Черноловская, Е.Л., Зенков, А.Н., Зенкова, М.А., Власов, В.В. Подавление множественной лекарственной устойчивости с помощью синтетических олигонуклеотидов // Наука производству. - 2003. - № 3. - С. 57-62.

34. Логашенко, Е.Б., Черноловская, Е.Л., Владимирова, А.В., Репкова, М.Н., Веньяминова, А.Г., Власов, В.В. Подавление экспрессии гена множественной лекарственной устойчивостив опухолевых клеткахс помощью короткой двуцепочечной РНК // Доклады Академии Наук, серия химическая. - 2002. - T. 386. - C. 274-276.







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.