WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Ткачева Екатерина Сергеевна

Получение и структурно-функциональный анализ актинопоринов мультигенных Hct-A и Hct-S семейств актинии Heteractis crispa

03.01.04 – биохимия

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Владивосток 2012

Работа выполнена в Федеральном государственном бюджетном учреждении науки Тихоокеанском институте биоорганической химии им. Г.Б. Елякова ДВО РАН

Научный консультант:

д.х.н., профессор Козловская Эмма Павловна

Официальные оппоненты:

Костецкий Эдуард Яковлевич, д.б.н., профессор, Дальневосточный федеральный университет, зав. кафедрой биохимии, микробиологии и биотехнологии.

Ковальчук Светлана Николаевна, к.б.н., Федеральное государственное бюджетное учреждение науки Тихоокеанский институт биоорганической химии им. Г.Б. Елякова ДВО РАН, с.н.с. лаборатории Морской биохимии.

Ведущая организация: Федеральное государственное бюджетное учреждение науки Биолого-почвенный институт ДВО РАН, Владивосток

Защита состоится «11» мая 2012 г. в 1000 часов на заседании диссертационного совета Д 005.005.01 при Федеральном государственном бюджетном учреждении науки Тихоокеанском институте биоорганической химии им. Г.Б. Елякова ДВО РАН по адресу: 690022, г. Владивосток, проспект 100 лет Владивостоку, 159, ТИБОХ ДВО РАН. Факс: (423)231-40-50, e-mail: dissovet@piboc.dvo.ru

С диссертацией можно ознакомиться в филиале Центральной научной библиотеки ДВО РАН (г. Владивосток, проспект 100 лет Владивостоку, 159, ТИБОХ ДВО РАН).

Текст автореферата размещен на сайте www.piboc.dvo.ru Автореферат разослан «10» апреля 2012 г.

Ученый секретарь диссертационного совета, к.б.н. Черников О. В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. Актинопорины – белковые цитолизины (20 кДа), продуцируемые ядовитыми морскими кишечнополостными, актиниями, принадлежат к группе -пороформирующих токсинов (-ПФТ) (Parker and Feil, 2005). Огромный интерес исследователей к этим белкам обусловлен наличием у них уникальной пространственной структуры высоко консервативного фолда сэндвича и N-концевой -спирали, способных претерпевать конформационные перестройки при переходе белка из водорастворимого в мембраносвязанное состояние, в котором он осуществляет свое пороформирующее действие. С мембранолитическим действием связывают широкий спектр биологической активности актинопоринов: противоопухолевой, кардиостимулирующей, дерматонекротической, антипаразитарной (Turk, 1991). В последние годы -ПФТ актиний используют для создания потенциальных фармакологических агентов химерных молекул, представляющих собой иммуноконьюгаты актинопоринов (либо их фрагментов, например, N-концевого участка) с лигандами (моноклональными антителами, гормонами или факторами роста) (Tejuca et al., 2009). Действие этих конъюгатов направлено на биологические мишени, мембраны опухолевых и паразитарных клеток. -ПФТ являются незаменимыми инструментами исследования структурной организации и механизмов функционирования биологических и модельных мембран (Чантурия и др., 1990; Shnyrov et al., 1992; Parker and Feil, 2005).

Проявляемые актинопоринами фармакологические эффекты свидетельствуют о том, что эти белки связываются не только с липидными, но и с белковыми компонентами мембран, интегринами, посредством RGD-мотива (трипептида: аргинин-глицинаспарагиновая кислота), что может быть использовано для получения противоопухолевых агентов нового поколения.

Повышенный интерес к изучению взаимосвязи структуры и функции актинопоринов связан, в первую очередь, с необходимостью более глубокого понимания механизма действия этих мембраноактивных белков, играющих важную экологическую и алломональную роль в морском биоценозе. Дальнейшего изучения требует также феномен мультигенности актинопоринов, обнаруженный недавно у актинии Heteractis magnifica (Wang et al., 2008). В настоящее время перспективным и актуальным методом исследования является сайт-направленный мутагенез, который позволяет выяснить ключевую роль аминокислотных остатков (а.о.) актинопоринов в функционально значимых участках молекулы, вовлеченных в различные этапы порообразования (N-концевой -спирализованный фрагмент, фосфорилхолиновый (РОС)-сайт связывания и RGD-мотив).

Цель и задачи исследования. Целью данной работы было установление структурно-функциональных взаимосвязей представителей мультигенных семейств пороформирующих токсинов актинии Heteractis crispa. Для достижения поставленной цели необходимо было решить следующие задачи:

(1) выделить и идентифицировать нативные актинопорины;

(2) получить нуклеотидные последовательности и установить на их основе аминокислотные последовательности актинопоринов семейств Hct-A и Hct-S;

(3) создать генетические конструкции генов актинопоринов для гетерологичной экспрессии в бактериальной системе и получить рекомбинантные белки;

(4) определить физико-химические характеристики рекомбинантных белков и сравнить их с характеристиками нативных актинопоринов;

(5) выполнить сайт-направленный мутагенез функционально значимого участка молекулы актинопорина RGD-мотива;

(6) провести структурно-функциональный и филогенетический анализ актинопоринов.

Научная новизна и практическая ценность работы.

В ходе работы выделен новый актинопорин из H. crispa, последовательность Nконцевого фрагмента которого (20 а.о.) отличалась от ранее установленной последовательности нативного актинопорина RTX-SII, выделенного из H. crispa (=Radianthus macrodactylus). Методами молекулярной биологии установлены нуклеотидные последовательности и на их основе выведены аминокислотные последовательности представителей двух семейств актинопоринов, имеющих Nконцевые остатки аланина (Hct-A семейство) и серина (Hct-S семейство). Получено семь рекомбинантных изоформ актинопоринов, различающихся значениями изоэлектрических точек, параметрами гидрофобности и количеством и локализацией заряженных а.о. N-концевых функционально значимых фрагментов, а также величиной гемолитической активности. Впервые проведен сайт-направленный мутагенез RGD-мотива актинопорина H. crispa. Получены три мутантные формы актинопорина в виде телец включения. Выполнен структурно-функциональный анализ, который позволил установить важную роль для необратимого связывания с мембраной а.о.: Arg53, Tyr113, Tyr133, Tyr138 и/или Tyr137, участвующих в образовании водородных, ионных, CН...-взаимодействий с фосфорилхолиновой головкой липидов, а также положительно и отрицательно заряженных остатков в Nконцевом фрагменте актинопоринов для порообразующей активности белка.

Полученные данные являются основой для дизайна новых структур молекул актинопоринов с заданной активностью с целью их биотехнологического получения и применения.

Основные положения, выносимые на защиту.

1. Новый представитель актинопоринов актинии H. crispa отличается от нативных актинопоринов, выделенных ранее из этого вида актинии, N-концевой аминокислотной последовательностью, молекулярной массой и значением изоэлектрической точки.

2. Семейства актинопоринов Hct-A и Hct-S актинии H. crispa являются мультигенными.

3. Актинопорины H. crispa на филогенетическом дереве группируются в несколько кластеров. Представители семейств актинопоринов Hct-A и Hct-S не формируют собственных, но входят в состав одних и тех же кластеров.

4. Рекомбинантные актинопорины H. crispa отличаются друг от друга по величине гемолитической активности, что обусловлено различиями в количестве и локализации заряженных аминокислотных остатков в функционально значимом Nконцевом фрагменте молекул.

5. Остатки Tyr в положениях 113, 133, 138, входящие в РОС-сайт связывания актинопоринов, а также а.о. Arg53 и Ser105 вовлечены в процесс прочного связывания белков с цитоплазматической мембраной.

Апробация результатов. Результаты работы были представлены на следующих конференциях и симпозиумах: XI Международной молодежной школеконференции по актуальным проблемам химии и биологии, г. Владивосток, 2007; I Дальневосточном симпозиуме с международным участием «Науки о жизни», г.

Владивосток, 2008; III Международной конференции «Химия, структура и функция биомолекул», г. Минск, 2008; VIII региональной конференции студентов, аспирантов вузов и научных организаций Дальнего востока России, г. Владивосток, 2008; XII и XIII Всероссийских молодежных школах-конференциях по актуальным проблемам химии и биологии, г. Владивосток, 2009 и 2010; Международном семинаре по морским природным ресурсам, г. Ханой, 2010; V Российском симпозиуме «Белки и пептиды». г. Петрозаводск, 2011; 9-м Международном конгрессе по токсинологии, г.

Владивосток, 2011.

Публикации. Соискателем опубликовано 14 работ, из них все по теме диссертации, в том числе 6 статей, из них 2 в журналах, определенных списком ВАК, 4 в сборниках научных трудов по материалам конференций и 8 тезисов докладов в сборниках трудов региональных, всероссийских и международных конференций.

Структура и объем диссертации. Диссертация состоит из введения, обзора литературы, материалов и методов исследования, результатов исследования и их обсуждения, выводов и списка литературы, включающего 181 цитируемую работу.

Диссертационная работа изложена на 102 страницах машинописного текста и содержит 8 таблиц и 43 рисунка.

Благодарности. Автор выражает искреннюю благодарность научному руководителю д.х.н., зав. лаб. Козловской Э.П., сотрудникам ЛХП: д.х.н.

Монастырной М.М. за неоценимую помощь в выполнении диссертационной работы и обсуждении результатов, к.х.н. Лейченко Е.В. за практическую помощь и постоянное внимание к работе и к.ф-м.н. Зелепуга Е.А. за проведение работ по молекулярному моделированию и участие в обсуждении результатов, а также сотруднику лаборатории морской биохимии к.м.н. Исаевой М.П. за неоценимую помощь в проведении экспериментов по молекулярной биологии, за критический анализ текста диссертации и автореферата. Автор также благодарен сотрудникам других лабораторий за помощь в выполнении отдельных этапов работы: к.ф-м.н. Лихацкой Г.Н., м.н.с. Гузеву К.В, к.б.н. Черникову О.В., к.х.н. Дмитренку П.С., к.х.н. Анастюку С.Д.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

1. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Выделение и очистка белков. Гель-фильтрацию и обессоливание проводили на колонках с Акрилексом П-4 (Reanal, Венгрия), ионообменную хроматографию полипептидов на колонке с целлюлозой КM-32 (Whatman, Англия), ВЭЖХ белков на колонке с обращенной фазой сорбента ZORBAX Eclipse® XDB-C8 (Agilent, США) на хроматографе Agilent 1100 (США) с УФ-детектором.

Концентрацию белка в пробах определяли по методу Лоури и др. (Lowry et al., 1951), в качестве стандарта использовали бычий сывороточный альбумин.

Молекулярную массу актинопорина определяли на времяпролетном массспектрометре ULTRAFLEX III TOF/TOF (Bruker Daltonic, Германия).

Аминокислотную последовательность N-концевого фрагмента актинопорина определяли на автоматическом твердофазном аминокислотном секвенаторе белков Procise 492 cLC (Applied Biosystems, США) по программе производителя.

Дизайн праймеров. Праймеры были спроектированы с применением программы Gene Runner. Синтез праймеров, используемых в работе, был осуществлен в НПО «Евроген», Россия.

Полимеразную цепную реакцию (ПЦР) для получения фрагментов, кодирующих сигнальную последовательность и зрелый актинопорин, проводили с использованием праймеров hct_sign (5’-TCGTTACc/aATGATA-3’) и hct_notransl (5’GATTCTCTATTTGTCTTC-3’), TagSE-полимеразы (НПО «Сибэнзим», Россия) и кДНК актинии H. crispa.

Определение и анализ нуклеотидных последовательностей. ПЦРфрагменты лигировали в плазмидный вектор pTZ57R/T (MBI Fermentas, Литва).

Полученными конструкциями трансформировали электрокомпетентные клетки Escherichia coli DH5 (Stratagene, США). Выделение плазмидной ДНК из клеток осуществляли методом щелочного лизиса (Sambrook and Russel, 2001). ДНК рекомбинантных плазмид секвенировали на ДНК-анализаторе ABI 3130xL (Applied Biosystems, США). Анализ нуклеотидных и аминокислотных последовательностей проводили с использованием пакета программ Vector NTI 8 (Invitrogen, США).

Филогенетический анализ актинопоринов. Аминокислотные последовательности актинопоринов анализировали, используя программу MEGA(Kumar et al., 2008). Филогенетический анализ аминокислотных последовательностей проведен методом ближайших соседей (Neighbour-Joining) (Saitou and Nei, 1987). При построении филогенетического дерева использовали пи-дистанцию (p-distance).

Достоверность филогенетического дерева оценивали «bootstrap» тестом (10реплик).

Создание экспрессионной конструкции гена актинопорина с плазмидным вектором. Фрагменты ДНК размером 550 п.н., кодирующие зрелые актинопорины из H. crispa, были получены с использованием ген-специфических праймеров hct-a(f), hct-s(f) и hct-(r) и рекомбинантных плазмид pTZ57R/T в качестве матриц. ПЦРфрагменты клонировали в плазмиду pET-41a(+) (Novagen, США). Полученными конструкциями трансформировали клетки штамма Rosetta (DE3) E. coli (Novagen, США).

Экспрессия. Трансформированные клетки Rosetta (DE3) E. coli культивировали в среде 2YT, содержащей антибиотики канамицин и хлорамфеникол. Для индукции экспрессии добавляли ИПТГ (изопропил--Dтиогалактозид).

Рекомбинантные белки выделяли методом аффинной хроматографии на Ni-CAMагарозе (Batch-вариант). Для отделения рекомбинантного актинопорина от гибридной молекулы добавляли энтеропептидазу (New England BioLabs, Англия) из расчета 1 ед. фермента на 20 мкг гибридного белка. Белки клеточного лизата и рекомбинантные белки анализировали с помощью белкового электрофореза в полиакриламидном геле методом Лэммли (Laemmli, 1970).

Гемолитическую активность актинопоринов определяли на эритроцитах человека в среде, содержащей 0,9 NaCl.

Измерение электрических характеристик бислойных липидных мембран (БЛМ). Ток через БЛМ измеряли высокоомным вольтметр-электрометром ВК2-16 в режиме фиксации потенциала на мембране с помощью хлорсеребряных электродов (потенциал асимметрии 23 мВ). Регистрацию тока на выходе усилителя осуществляли потенциометром КПС-4.

Сайт-направленный мутагенез был выполнен согласно руководству «QuikChange™ Site-Directed Mutagenesis Kit» (Stratagene, США).

Расчет параметров гидрофобности и количества заряженных а.о. Nконцевого фрагмента актинопоринов проводили c помощью программы HELIQUEST (http://heliquest.ipmc.cnrs.fr) для фрагмента последовательности длиной 18 а.о. (с 10 по 27 а.о.).

Получение теоретической модели трехмерной структуры актинопорина.

Модель пространственной структуры rHct-S3 генерировали с помощью программы SPDBV (http://expasy.org/spdbv) и сервера SWISS-MODEL. Модель оптимизировали в программе MOETM (http://www.chemcomp.com).

Белок-лигандный докинг и молекулярную динамику комплексов актинопоринов с фосфорилхолином проводили с помощью сервера Docking Server (Bikadi and Hazai, 2009) и программы МОЕ соответственно.

2. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ 2.1. Выделение актинопоринов из актинии H. crispa Для выделения нативных актинопоринов из H. сrispa ранее была разработана схема, основанная на осаждении гемолитически активных белков из водного экстракта актинии 80%-ым ацетоном. В результате ацетонового осаждения была получена белковая фракция, водный раствор которой был использован для дальнейшего хроматографического разделения. При гель-фильтрации этой фракции на Акрилексе П-4 было получено три фракции (рис. 1, А, пики 1–3), проявляющие гемолитическую активность. Для дальнейшего разделения гемолитически активных белков катионообменной хроматографией на КМ-32 целлюлозе была использована суммарная белковая фракция пика 3 (рис. 1, А), которая по данным электрофореза в градиенте плотности полиакриламидного геля в присутствии додецилсульфата натрия содержала, главным образом, белки с молекулярной массой около 20 кДа. В результате ионообменной хроматографии белков этой фракции было получено пять гемолитически активных фракций (рис. 1, Б, пики 1–5). Фракция, соответствующая пику 1, обладала высокой гемолитической активностью, содержала, преимущественно, белки с молекулярной массой 20 кДа и была использована для дальнейшего исследования. Остальные фракции в данной работе не исследовали.

Рис. 1. (А) гель-фильтрация белков H. crispa на колонке с Акрилексом П-4. (Б) катионообменная хроматография белковых фракций пика 3 (рис. 1, А) на колонке с целлюлозой КМ-32. (В) ВЭЖХ белков фракции 1 после катионообменной хроматографии.

(Г) рехроматография белков фракции 7 (рис. 1, В) при тех же условиях. Отмечены границы объединения фракций, проявляющих гемолитичекую активность.

Белковая фракция 1 (рис. 1, Б) была собрана, обессолена на колонке с Акрилексом П-4 и использована для дальнейшего разделения высокоэффективной жидкостной хроматографией на колонке с обращенной фазой сорбента ZORBAX Eclipse® XDB-C8. В результате ВЭЖХ были получены фракции, содержащие белки с молекулярными массами (по данным MALDI-масс-спектрометрии) от 4 до 6 кДа (пики 15) и 19,3–19,5 кДа (пики 6–8) (рис. 1, В). После рехроматографии гемолитически активной суммарной белковой фракции (рис. 1, В, пик 7) был получен гомогенный белок, названный Hct-S4 (рис. 1, Г), молекулярная масса которого, согласно данным MALDI-анализа, составила 19414 ± 10 Да.

С целью идентификации белка, полученного в результате ВЭЖХ (рис. 1, Г), была определена аминокислотная последовательность его N-концевого фрагмента (а.о.): SAALAGTIIEGASLGFQILD-. Полученная последовательность N-концевого фрагмента отличалась от последовательности RTX-SII (Klyshko et al., 2004) наличием в девятом положении изолейцина вместо треонина и в десятом положении остатка глутаминовой кислоты вместо лейцина. Таким образом, Hct-S4 является новым представителем семейства актинопоринов H. crispa, имеющим N-концевой остаток серина.

2.2. Клонирование генов актинопоринов Анализ ранее полученных последовательностей актинопоринов RTX-A (Il’ina et al., 2006) и RTX-SII H. crispa (Klyshko et al., 2004) позволил предположить, что в ткани щупалец этой актинии могут существовать как минимум два семейства актинопоринов (с N-концевыми остатками серина и аланина). Для установления нуклеотидных последовательностей генов, кодирующих зрелые актинопорины актинии H. crispa, были сконструированы прямой hct_sign и обратный hct_notransl праймеры. Праймер hct_sign был создан на основе анализа сигнальных последовательностей известных актинопоринов, а ген-специфичный обратный праймер hct_notransl был сконструирован к нетранслируемой 3’-области последовательностей rtx-a и rtx-sii.

В результате ПЦР с использованием в качестве матрицы полноразмерной кДНК H. crispa получили фрагмент около 650 п.н., кодирующий часть сигнальной последовательности и зрелый актинопорин. Полученный ПЦР-фрагмент клонировали в плазмидный вектор pTZ57R/T. Рекомбинантными плазмидами трансформировали клетки E. coli штамма DH5. Наличие в отобранных клонах целевой вставки определяли с помощью метода ПЦР “на колониях” с использованием стандартных праймеров sTag и T7-terminator. Рекомбинантные плазмиды выделяли из клеток и секвенировали с помощью тех же праймеров.

При анализе более 100 клонов было обнаружено 44 различные нуклеотидные последовательности, кодирующие часть сигнальной последовательности и зрелый белок. На основании нуклеотидных были выведены аминокислотные последовательности актинопоринов, и было отмечено, что последовательности зрелых белков отличаются N-концевым а.о. (Ser или Ala) (рис. 2). Это хорошо согласуется с экспериментальными данными по нативным актинопоринам (RTX-A и RTX-SII). На рисунке 2 приведены участок сигнальных последовательностей и Nконцевые фрагменты зрелых белков некоторых представителей актинопоринов.

сигнальный пептид зрелый белок Hct-A2 VVTMICATIAVPSRKKLEDQKEQKR--ALAGTIIAGA Hct-A3 VVTMICATIAVPSRKKLEDQKEQKR--ALAGTIIAGA Рис. 2. Выравнивание аминоHct-A4 VVTMICATIAVPSRKKLEDQKEQKR--ALAGTIIAGA кислотных последовательносHct-A5 VVTMICATIAVPSRKKLEDQKEQKR--ALAGTIIAGA Hct-S3 VVTMICATIAVPSREELEDQKEHKRSAALAGTIIEGA тей актинопоринов. Отмечены Hct-S5 VVTMICATIAVPSREELEDQKEHKRSAALAGTIIAGA N-концевые а.о.

Hct-S6 VVTMICATIAVPSREELEDQKEHKRSAALAGTIIAGA На основании отличий в N-концевых а.о. зрелых актинопоринов мы разделили полученные аминокислотные последовательности зрелых белков на два семейства. последовательностей имели N-концевой остаток аланина (Hct-A-семейство) (рис. 3), а 25 последовательностей N-концевой остаток серина (Hct-S-семейство) (рис. 4).

Идентичность нуклеотидных последовательностей составила от 93 до 99%, идентичность аминокислотных последовательностей от 88 до 99%. Наиболее представленными последовательностями оказались Hct-A2 Hct-A5, Hct-S3, Hct-S5 и Hct-S6.

Расчетные значения молекулярных масс актинопоринов семейств Hct-A и Hct-S составили 19,12–19,52 кДа, их изоэлектрические точки лежат в диапазоне значений 9,10–9,74, что соответствует значениям молекулярных масс и изоэлектрических точек нативных актинопоринов (Monastyrnaya et al., 2010).

Отличительным признаком аминокислотного состава актинопоринов, как считалось до последнего времени, является отсутствие остатков цистеина (Anderluh and Maek 2002). Согласно данным Вонга и соавторов, полученным в 2008 году, аминокислотные последовательности некоторых представителей актинопоринов актинии Heteractis magnifica, выведенные на основании 52 нуклеотидных последовательностей (Wang et al., 2008), содержат этот остаток в одном или нескольких положениях аминокислотных последовательностей. Практически все выведенные последовательности актинопоринов семейств Hct-A и Hct-S не имеют остатков цистеина, за исключением последовательности Hct-S19, в которой был обнаружен единственный остаток цистеина в 88 положении (рис. 3, 4).

Полученные данные свидетельствуют о том, что в ткани щупалец актинии H.

сrispa, как и Actinia equina (Maek and Lebez, 1981; Anderluh et al., 1996) и H.

magnifica (Wang et al., 2008), Stichodactyla helianthus (Lanio et al., 2001) синтезируется целый ряд изоформ актинопоринов, кодируемых, очевидно, генами мультигенных семейств. Как видно из рисунков 3 и 4, последовательности актинопоринов различаются единичными аминокислотными заменами, большинство из которых у актинопоринов обоих семейств приходится на N-концевой фрагмент молекулы, принимающий непосредственное участие в порообразовании (Kristan et al., 2004).

1 1 2 3 4 5 6 SSSSS HHHHHHHHHH SSSSSSSSSS SSSSSSSSSS SSS SSSSSSSSSSS SSSSSSSSSSS SSS 10 20 30 40 50 60 70 80 90 1RTX-A ALAGAIIAGASLTFQILDKVLAELGQVSRKIAIGIDNESGGSWTAMNAYFRSGTTDVILPEFVPNQKALLYSGRKNRGPDTTGAVGALAYYMSNGNTL Hct-A2 ----T-------G--------G---K--------V----------L-----------------------------DT--VA----A-F-------H-- Hct-A3 ----T-------G--------G---K------V------------L-----------------------------DT--VA----A-F-------H-- Hct-A4 ----T---------K---E—-G---K------V-V----------L---------------------------------------A-F-----D---- Hct-A5 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A6 ----T---------K---E--G---K------V-A----------L---------------------------------EA----A-F-----D---- Hct-A7 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A8 ----T---------K---E--G---K------V-V----------L-------------------------G-------EA----A-F-----D---- Hct-A9 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A10 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A11 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A12 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A13 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Hct-A14 –-D-T---------K---E--G---K------V-V----------L--------------------R------------EA----A-------D---- Hct-A15 ----T---------K---E--G---K------V-V----------L---------G----------R------------EA----A-F-----D---- Hct-A16 ----T----------------G---K------V-V----------L------------------------------T--EA----A-F-----D---- Hct-A17 ----T-------S--------G---K--------V----------L-----------------------------DT--VA----A-F-------H-- Hct-A18 ----T---------K---E--G---K------V-V----------L---------------------------------EA----A-F-----D---- Рис. 3. Множественное выравнивание аминокислот 8 2 9 10 11 SSSSSS SSSSSSSS HHHHHHHH SSS SSSSS SSSSSS SSSSSSSS ных последовательностей 101 110 120 130 140 150 160 1зрелых актинопоринов RTX-A GVMFSVPFDYNLYSNWWDVKVYSGKRRADQAMYEDLYYSNPYRGDNGWHQKNLGYGLKMKGIMTSAGEAIMEIRISR Hct-A2 -----------F------------------G----M--G------------------RV-----------LQ-K--- семейства Hct-A. Рамками Hct-A3 -----------F------------------G----M--G------------------R-R----------LQ-K--- выделены N-концевые Hct-A4 -------S------------I---------G----M--G-------------------------------LQ-K--- Hct-A5 --------------------I-----------------G-------------------------------LQ-K--- фрагменты актинопоринов (1Hct-A6 --------------------I-----------------G-------------------------------LQ-K--- 29 а.о.) и РОС-сайт Hct-A7 --------------------I--------------P--G-------------------------------LQ-K--- связывания (104-138 а.о.).

Hct-A8 --------------------I-----------------G-------------------------------LQ-K--- Hct-A9 --------------------------------------G-------------------------------LQ-K--- Наиболее значимые для Hct-A10 --V-----------------I-----------------G-------------------------------LQ-K--- порообразования а.о. показаHct-A11 --------------------I----G------------G-------------------------------LQ-K--- Hct-A12 --------------------I-G---------------GY------------------------------LQ-K--- ны на сером фоне. Буквами H Hct-A13 -----I--------------I---R-------------G-------------------------------LQ-K--- и S показана длина Hct-A14 --------------------I-----------------G-------------------------------LQ-K--- Hct-A15 -------------------------------------HG-------------------------------LQ-K--- спиралей и -тяжей Hct-A16 --------------------N-----------------G----E--------------V-----------LQ-K--- соответственно.

Hct-A17 ------------F-----------------G----M--G------------------R------------LQ-K--- Hct-A18 --------------------I-----------------G-------------------------------L------ 1 1 2 3 4 5 6 SSSSS HHHHHHHHHH SSSSSSSSSS SSSSSSSSS SSS SSSSSSSS SSSSSSSSSS SS 10 20 30 40 50 60 70 80 90 1RTX-SII SAALAGTITLGASLGFQILDKVLGELGKVSRKIAVGVDNESGGSWTALNAYFRSGTTDVILPEFVPNQKALLYSGRKDTGPVATGAVAAFAYYMSNGHTL Hct-S3 --------IE------------------------I----------------------------------------------------------------- Hct-S7 ---------E------------------------I----------------------------------------------------------------- Hct-S11 --------------S---------K-----------I----------------------------------------------A---------------- Hct-S15 --------------S-------------------I--------------V-------------------------------------------------- Hct-S5 --------IA----T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S6 --------IA----T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S8 --------------T----E---------------------------------------------------------NR----------------D-N-- Hct-S9 --------------T-K---E--------------------------------------V-----------------NR--E-------------D-N-- Hct-S10 --------------T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S12 --------------T-K---E-------------------P------------------------------------NR--E-A-----------D-N-- Hct-S13 --------------T---PE--------------------P------------------------------------NR--E-------------D-N-- Hct-S14 --------------T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S16 --------------T-K-—GE--------------------------------------------------------NR--E-------------D-N-- Hct-S17 --------------T-K---E--------------------------------------------------------NR--E----A--------D-N-- Hct-S18 --------------T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S19 --------------T--------A---Q------I-I----------M-----------------------------NR--DT----C-L-------N-- Hct-S20 --------------T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S21 -----------V-—T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S22 --------------T-K---E--------------------------------------------------------NR--E-------------D-N-- Hct-S23 --------ID------D--N----------------------------------------------------------R------------------N-- Hct-S24 --------ID------D--N----------------------------------------------------------R--------T---------N-- Hct-S25 --------ID------D--N-------R--------------------------------------------------R------------------N-- Hct-S26 --------ID------D--N----------------------------------------------------------R------------------N-- Hct-S27 --------ID------D--N--------A-------------------------------------------------R------------------N-- Hct-S28 --------ID------D--N----------------------------------------------------------R------------------N-- 7 8 2 9 10 11 SSSSSS SSSSSSSS HHHHHHH SSS SSSSSS SSSSSS SSSSSSSSS 110 120 130 140 150 160 1RTX-SII GVMFSVPFDYNLYSNWWDVKIYSGKRRADQAMYEDMYYGNPYRGDNGWHQKNLGYGLKMKGIMTSAVEAILEIRISR Hct-S3 -----------F--------V---------G--------------------------R--------G----Q-K--- Hct-S7 -----------F--------V---------G--------------------------R--------G----Q-K--- Hct-S11 -----------F--------V---------G--------------------------R--------G----Q-K--- Hct-S15 -----------F--------V---------G--------------------------R--------G----Q-K--- Hct-S5 -----------------------------------L------------------------------G----Q-K--- Hct-S6 -----------------------------------L------------------------------G--M-Q-K--- Рис. 4. Множественное выравнивание Hct-S8 -----------------------------------L------------------------------G----Q-K--- Hct-S9 -----------------------------------L------------------------------G----Q-K--- аминокислотных последовательностей Hct-S10 -----------------------------------L------------------------------G----Q-K--- Hct-S12 -----------------------------------L------------------------------G----Q-K--- зрелых актинопоринов семейства Hct-A.

Hct-S13 -------------------------------L---L------------------------------G----Q-K--- Рамками выделены N-концевые Hct-S14 --------------D--------------------L------------------------------G----Q-KS-- Hct-S16 -------------N---------------------L------------------------------G----Q-K--- фрагменты актинопоринов (1-29 а.о.) и Hct-S17 -----------------------------------L------------------------------G----Q-K--- Hct-S18 --I----------G---------------------L----------------P-------------G----Q-K--- РОС-сайт связывания (104-138 а.о.).

Hct-S19 --------------------V--------------L--S------------------R--------G----Q-K--- Наиболее значимые для пороHct-S20 -------------------------------L---L------------------------------G---VQ-K--- Hct-S21 -----------------------------------L------------------------------G----Q-KF-- образования а.о. показаны на сером Hct-S22 -----------------------------------L------------------------------G----Q-KF-- Hct-S23 -----------------------------------L------------------------------G--M-Q-K--- фоне. Буквами H и S показана длина Hct-S24 --------------------------K--------L---------------------------A--G---------- спиралей и -тяжей соответственно.

Hct-S25 ----------S---------------K--------L------------------------------G---------- Hct-S26 --------------------------K--------L------------------------------G---------- Hct-S27 --------------------------K--------L---------------D--------------G---------- Hct-S28 --------------------------K--------L--------------------P---------G---------- 2.3. Филогенетический анализ последовательностей актинопоринов Эволюционные взаимоотношения известных актинопоринов, а также представителей семейств Hct-A и Hct-S актинии H. crispa отражены на филогенетическом дереве, согласно которому актинопорины формируют семь кластеров с “bootstrap”-поддержкой от 50% и выше (рис. 5). Высокая степень идентичности актинопоринов из семейств Hct-A и Hct-S H. crispa с актинопоринами из H. magnifica (86–99%) коррелирует с их принадлежностью к одному роду. Первые четыре кластера образованы актинопоринами семейства Stichodactylidae, в пятый и шестой кластеры вошли представители семейства Actiniidae, в седьмом кластере объединены актинопорины семейств Sargatiidae и Alisiidae. Основываясь на высокой степени идентичности последовательностей актинопоринов актиний H. crispa и H.

magnifica, можно предположить, что дивергенция актинопоринов на кластеры (I–III) произошла до разделения видов на H. crispa и H. magnifica. При этом в каждом кластере появляются специфичные для видов группы. Более того, представители семейств актинопоринов Hct-A и Hct-S не формируют собственных, а входят в состав одних и тех же кластеров.

Кластер I включает 24 последовательности актинопоринов и делится на две ветви: первую образуют актинопорины H. crispa и H. magnifica, вторую – стихолизины StnI и StnII из S. helianthus. Отличительной особенностью последовательностей, принадлежащих к первому кластеру, является наличие в 1положении ароматического а.о., Phe или Trp, входящего в состав РОС-сайта связывания, тогда как у остальных актинопоринов из H. crispa и H. magnifica в этом положении находится остаток Leu. Особенностью этого кластера является также наличие положительно заряженного остатка His в положении 98. Другие актинопорины (за исключением нативных StnI и StnII) имеют в этом положении незаряженный остаток Asn. Идентичность последовательностей кластера I составляет 87–99%. Кластер II включает в основном представителей актинопоринов H. magnifica, которые формируют отдельную группу. Интересно, что эта группа представлена последовательностями, имеющими в своем составе остаток цистеина. Идентичность последовательностей этого кластера составляет 94–99%. Большинство актинопоринов семейств Hct-A и Hct-S представлено, главным образом, в кластере III (идентичность 92–99%). Четвертый кластер включает только три последовательности: два актинопорина H. crispa (RTX-A и цистеин-содержащую последовательность Hct-Sиз семейства Hct-S) а также гигантоксин-4, нативный актинопорин, выделенный недавно из Stichodactyla gigantea (Hu et al., 2011). Кластеры VVIII содержат последовательности нативных актинопоринов: Or-A и Or-G из Oulactis orientalis (Ильина и др., 2005) (кластер V), EqtII, EqtIV и EqtV из A. equina, FraC из Actinia fragacea (Bellomio et al., 2009), образующие отдельную группу, Bp-1 из Anthopleura asiatica (Kohno et al., 2009) и UcI из Urticina crassicornis (Razpotnik et al., 2009) (кластер VI), PsTX-20 из Phyllodiscus semoni (Nagai et al., 2002), Avt-1 из Actineria villosa (Uechi et al., 2005) и Src-1 из Sagartia rosea (Jiang et al., 2002), находящийся на отдельной ветви (кластер VII).

Причина огромного разнообразия изоформ актинопоринов, полученных из одного вида актинии (A. equina, H. magnifica, S. helianthus, H. crispa, O. orientalis), пока не ясна. Несомненно, этот феномен представляет большой научный интерес в связи с экологической и алломональной ролью представителей этой уникальной группы цитотоксинов в морском биоценозе, а также их различной активностью.

К ластер III 4-Sct1-Hct-S24 Hct-S5 Hct-AScb2-Кластер II Hct-S 25 Hct-S10 Hct-SScb2-Hct-S26 Hct-A5 Hct-ASct1-Hct-S27 Hct-S17 Hct-SSct2-Hct-S28 Hct-S Hct-A11 Sct2-4-2 H Hct-Sct-AD 4-1 Hct-S9 Hct-ASct1-Hct-AHct-SHct-SSct1-Hct-SHct-SScb2-EHct-AHst-SEКластер I Hct-A62 Hct-ARTX-SII D4 Hct-AHct-A EStnI Hct-SHct-AStnII DGHct-SG2 Hct-AHct-SDEE2 EEHct-ADHMgIII EDEHct-AD3 GHct-SDGRTX-A Hc t-AGH ct-SHmT Hct-SHct-SGigantoxin-Кластер IV Актинопорины H.crispa Магнификализины H.magnifica Стихолизины S.helianthus Or-G Гигантоксин S.gigantea Актинопорины O.orienthalis Or-A Кластер VI Эквинатоксины A.equina Фрагасиатоксин A.fragacea Бандапорин A.asiatica EqtII Кластер V Уртицинатоксин U.crassicornis Bp-Актинопорин S.rosea UcI EqtIV Актинопорин A.villosa EqtV FraC Актинопорин P.semoni 99 Src-Avt-0.PsTX-20A Кластер VII Рис. 5. Филогенетическое дерево аминокислотных последовательностей актинопоринов, построенное методом ближайших соседей.

2.4. Экспрессия, выделение и гемолитическая активность рекомбинантных актинопоринов Для создания экспрессионных конструкций генов актинопоринов H. crispa, кодирующих зрелые белки, была выбрана pET система, в частности, плазмидный вектор pET-41a(+), предназначенный для экспрессии в E. coli гибридных белков с белком-носителем – глутатионтрансферазой (GST).

С целью получения целевых фрагментов были сконструированы генспецифичные праймеры на основе анализа нуклеотидных последовательностей генов актинопоринов семейств Hct-A и Hct-S. К 5’-концам прямых праймеров были добавлены по одному G для сохранения энтеропептидазного сайта. В обратный праймер был включен сайт рестрикции для HindIII (AAGCTT), совмещенный со стопкодоном (табл. 1).

Таблица 1. Олигонуклеотидные праймеры, использованные для ПЦР-амплификации Аминокислотная Нуклеотидная Температура Праймер последовательность отжига, С последовательность (5' 3')* GGCTTTAGCTGGTACAATTAT hct-a(f) ALAGTIIAGA CGCGGGTGCA (31) 77, GTCGGCGGCTTTAGCTGGCA hct-s(f) SAALAGTITL CAATTACTCTC (31) 77, CCCCAAGCTTAGCGTGAGAT hct-(r) ILQIKISRStopHindIII4N CTTAATTTGCAGTAT (35) 74,Примечание: * полужирным шрифтом выделены дополнительные нуклеотиды, подчеркнут сайт рестрикции для рестриктазы HindIII.

В качестве матрицы были использованы рекомбинантные плазмиды, содержащие фрагменты генов наиболее представленных в семействах Hct-A и Hct-S актинопоринов (hct-a2 hct-a5, hct-s3, hct-s5 и hct-s6). Полученные ПЦР-фрагменты были лигированы в экспрессионный вектор pET41 по сайтам рестрикции PshAI и HindIII (рис. 6) и далее результирующими плазмидами были трансформированы клетки E. coli штамма Rosetta (DE3).

Рис. 6. Физическая карта генетической конструкции pET41– hct-a/hct-s (Сконструирована в программе Vector NTI 8).

В ходе проведения экспрессии были оптимизированы условия для получения в препаративных количествах химерного белка: температура наращивания составила 30С, концентрация ИПТГ 1мМ, время наращивания – 3 часа. В результате экспрессии были получены предшественники рекомбинантных актинопоринов в виде химерных белков, включающих GST и шесть остатков гистидина на N-конце His6tag (GSTHis6rHct-A/S). Присутствие химерных белков (52 кДа) подтверждали ДСН-электрофорезом в полиакриламидном геле белков клеточного лизата (рис. 7).

Рис. 7. Электрофореграммы белков клеточного лизата после экспрессии: 1 – контроль (pET41/hct-a2 без добавления ИПТГ); 2 – pET41/hct-a2; 3 – pET41/hct-a3; маркеры молекулярной массы; 5 pET41/hct-a4; 6 pET41/hct-a5; 7 – контроль (pET41/hct-s3 без добавления ИПТГ); 8 – pET41/hct-s3; 9 –pET41/hct-s5; 10 pET41/hct-s6; 11 маркеры молекулярной массы.

Выделение рекомбинантных зрелых актинопоринов (rHct-A2 rHct-A5, rHctS3, rHct-S5 и rHct-S6) осуществляли с помощью аффинной хроматографии на смоле Ni-CAM (схема). Общий выход рекомбинантных белков составил в среднем 4 мг с литра клеточной культуры.

Схема. Этапы выделения рекомбинантных актинопоринов.

На рисунке 8 показаны результаты ДСН-электрофореза в полиакриламидном геле очищенных рекомбинантных белков, полосы на уровне 20 кДа соответствуют рекомбинантным актинопоринам.

А Б Рис. 8. Электрофореграммы рекомбинантных актинопоринов. (А) семейства Hct-A: 1 rHct-A2, 2 rHctA3, 3 rHct-A4, 4 rHct-A5, 5 маркеры молекулярной массы. (Б) семейства Hct-S: 1 rHct-S3, 2 rHctS5, 3 rHct-S6, 4 – маркеры молекулярной массы.

Для установления N-концевых фрагментов рекомбинантных актинопоринов были проведены электроблоттинг и секвенирование белков. Последовательности Nконцевых фрагментов (15 а.о.) рекомбинантных белков оказались идентичными последовательностям, которые были выведены на основании нуклеотидных последовательностей актинопоринов (рис. 3 и 4). Рекомбинантные актинопорины имели близкие значения молекулярных масс и изоэлектрических точек (табл. 2). При сравнении гемолитической активности рекомбинантных белков было обнаружено, что только три из них, rHct-A2, rHct-A3 и rHct-S3, имеют активность, сравнимую с активностями нативных белков (табл. 2).

Таблица 2. Физико-химические характеристики и биологическая активность рекомбинантных актинопоринов семейств Hct-A и Hct-S, и нативных актинопоринов RTX-A (Monastyrnaya et al., 2002), RTX-SII (Klyshko et al., 2004), EqtII (Maek and Lebez, 1981), StnII (Lanio et al., 2001), HMgI и HMgII (Khoo et al., 1993) Актинопорин Молекулярная Изоэлектричеcкая Гемолитическая масса, кДа точка активность, ГЕ/мг RTX-A ~20,0 ~9,3,51rHct-A2 19,14* 9,76** (4,0±0,36)104*** rHct-A3 19,20* 9,75** (2,0±0,49)104*** rHct-A4 19,16* 9,50** (2,2±0,40)102*** rHct-A5 19,23* 9,45** (1,0±0,26)103*** RTX-S II 19,28 3,61rHct-S3 19,39* 9,31** (3,3±0,31)104*** rHct-S5 19,33* 9,33** (1,0±0,53)103*** rHct-S6 19,39* 9,10** (4,2±0,52)103*** EqtII 19,0 10,5 3,61StnII 17,6 9,8 3,11HMgI 19,0 9,4 3,61HMgII 19,0 10,0 3,31Примечания: * Расчетные значения по аминокислотной последовательности.

** Расчетные значения по программе PROPKA 3.0 (Olsson et al., 2011).

*** Средние значения из шести независимых экспериментов±стандартное отклонение. Достоверность различий между показателями оценивали по однопараметрическому тесту ANOVA.

Каналообразующую активность рекомбинантного актинопорина rHct-Aопределяли на бислойных липидных мембранах (БЛМ), сформированных из моноолеина и сфингомиелина (1:3). Показано, что rHct-A2 в концентрации 50 нг/мл вызывает дискретные флуктуации тока в мембране, что свидетельствует о появлении в ней проводящих структур ионных каналов. Величины поводимости каналов, образуемых в БЛМ, были аналогичны таковым нативного актинопорина RTX-A (рис.

9).

Рис. 9. Проводимость БЛМ, индуцированная актинопоринами H. crispa: rHct-A(50 нг/мл) и RTX-A (нг/мл). Мембранный потенциал – 20 мВ.

Анализ проводимости каналов, индуцированных rHct-A2, показал, что наиболее вероятная проводимость каналов в 0,1 М NaCl при значении рН 7,составляет 180±30 пСм (рис. 10).

Рис. 10. Гистограммы проводимости мембран, модифицированных рекомбинантным и нативным актинопоринами, rHct-A2 и RTX-A.

Величина наиболее вероятной проводимости каналов составляет 180±30 пСм.

2.5. Сайт-направленный мутагенез С целью изучения функциональной значимости а.о. в RGD-мотиве актинопорина, играющего важную роль в связывании ряда адгезивных белков и пептидов с мембранными интегринами, был выполнен сайт-направленный мутагенез.

Для проведения мутагенеза была выбрана нуклеотидная последовательность hct-a2, кодирующая белок rHct-A2, обладающий высокой гемолитической активностью. Для получения мутаций в RGD-мотиве были сконструированы прямые (f) и обратные (r) праймеры, содержащие различные варианты мутаций (табл. 3).

Таблица 3. Праймеры, использованные при проведении мутагенеза Праймер Нуклеотидная последовательность (5' 3') hct-a-GGA(f) CAATCCATATGGAGGGGCCAATGGATGG (28) hct-a-GGA(r) CCATCCATTGGCCCCTCCATATGGATTG (28) hct-a-RGG(f) TCCATATCGAGGGGGCAATGGATGGCAC (28) hct-a-RGG(r) GTGCCATCCATTGCCCCCTCGATATGGA (28) hct-a-GGD(f) TGGCAATCCATATGGAGGGGACAATGGA (28) hct-a-GGD(r) TCCATTGTCCCCTCCATATGGATTGCCA (28) Для получения мутантных плазмид использовали клетки E. coli штамма XL-Blue. Выделенные из клеток плазмиды секвенировали с праймерами sTag и Т7terminator. Эффективность мутагенеза составила от 20 до 30%. Рекомбинантные плазмиды, содержащие мутации (pET41-hct-a2-GGA, pET41-hct-a2-RGG, pET41-hcta2-GGD), экспрессировали в E. coli штамм Rosetta (DE3). Химерные белки (52 кДа), содержащие GSTHis6, были обнаружены в тельцах включения (рис. 11).

В дальнейшем планируется получить функционально активные мутантные актинопорины и провести изучение их действия на искусственные (БЛМ) и биологические мембраны (эритроциты и яйцеклетки морского ежа S. intermedius), а также биосенсорный анализ связывания мутантных белков с интегрином Vметодом SPR (поверхностного плазмонного резонанса).

Рис. 11. Электрофореграмма белков клеточного лизата после экспрессии. 1 химерный белок, содержащий трипептид GGA; 2 химерный белок, содержащий трипептид RGG; 3 химерный белок, содержащий трипептид GGD; 4 маркеры молекулярной массы.

2.6. Структурно-функциональный анализ актинопоринов представителей семейств Hct-A и Hct-S 2.6.1. Компьютерное моделирование рекомбинантного актинопорина rHct-SВвиду отсутствия кристаллографических данных для структур актинопоринов H. crispa определение локализации функционально важных участков рекомбинантного актинопорина rHct-S3 (самого активного из полученных рекомбинантных белков представителя семейства Hct-S (табл. 2)) было проведено методами компьютерного моделирования.

В качестве прототипа для построения модели использовали кристаллическую структуру StnII (PDB код 1gwyA) из актинии S. helianthus. Согласно теоретической 3D-модели актинопорин rHct-S3 содержит 12 -тяжей и две, расположенные на N- и С-концах молекулы, -спирали, обрамляющие -кор. Антипараллельные -тяжи соединены между собой и с -спирализованными фрагментами молекулы петлями различной протяженности (рис. 12).

C Рис. 12. Ленточная диаграмма 3D структуры rHct-S3, полученной методом гомологичного моделирования с помощью программ SPDBV (http://expasy.org/spdbv) и сервера SWISSMODEL (Schwede et al., N 2003). Параметры RMSD 175 С-атомов генерированной 3D модели и прототипа не Trp1Tyr1превышали 0,5 . Элементы вторичной Gly144 структуры получены с помощью Asp1Tyr1программы МОЕ. N-концевая и С-концевая Tyr1-спирали показаны красным цветом, Trp1Lysтяжи – голубым. Остатки, входящие в РОС Arg1сайт связывания актинопорина с Tyr1Высокоосновная петля SRK мембраной, обозначены серыми стержнями, Phe1RGD-мотив – синими.

2.6.2. Выяснение функциональной значимости а.о. рекомбинантных актинопоринов при порообразовании Известно, что большинство глобулярных белков, имеющих на N-конце амфифильные спирализованные фрагменты длиной около 18 а.о. и более, проявляет мембранную (пороформирующую) активность (Saier et al., 1988). Ее количественную оценку дают параметры гидрофобности (средний гидрофобный момент и средняя гидрофобность ), рассчитываемые по известному методу (Eisenberg et al., 1984), с помощью которых можно предсказать аффинность -спирали по отношению к липидному гидрофобному кору мембраны. Согласно теоретическим и экспериментальным данным (Eisenberg et al., 1984; Hristova and White, 1998) значения среднего гидрофобного момента () N-концевых спирализованных фрагментов белков, варьирующие в пределах значений 0,3–0,4, указывают на их способность включаться в гидрофобный кор мембраны. Для связывания амфифильных белковых структур с мембраной не менее важна сеть положительно заряженных а.о. (Seelig, 2004; Lee et al., 1998), благодаря которым происходит электростатическое взаимодействие белковых молекул с отрицательно заряженными фосфорилхолиновыми группами мембранных липидов.

Для визуализации трансмембранного -спирального участка N-концевого фрагмента актинопорина, принимающего участие в пороформировании, применен графический подход, основанный на анализе так называемых «спиральных колец Шиффера-Эдмундсона» (Shiffer and Edmundson, 1967). Расчет параметров гидрофобности рекомбинантных актинопоринов Hct-A и Hct-S семейств проведен для N-концевых фрагментов молекул с 10 по 27 а.о. Согласно литературным данным именно этот фрагмент молекулы включается в мембрану и участвует в формировании ион-проницаемой поры с экспонированными в ее полость полярными а.о. (Mancheo et al., 2003; Malovrh et al., 2003). Установлено, что параметры гидрофобности Nконцевых фрагментов рекомбинантных белков rHct-A2 – rHct-A5, rHct-S3, rHct-S5 и rHct-S6 находятся в пределах значений, необходимых для сильных гидрофобных взаимодействий с жирнокислотными остатками липидов (табл. 4).

При анализе «спиральных колец» было установлено, что у всех рекомбинантных молекул отрицательно заряженные а.о. на полярной поверхности Nконцевых спирализованных фрагментов преобладают над положительно заряженными (табл. 4). Наличие высокоосновной петли 30SRK32 (рис. 12), соединяющей N-концевую -спираль с -кором, и положительно заряженных остатков Lys21 (у rHct-S3, rHct-A2 и rHct-A3, как и у нативных StnI и StnII) и Lys17 (у Hct-S5, Hct-S6, Hct-A4 и Hct-A5) определяют электростатическое взаимодействие этих молекул с мембранным интерфейсом (рис. 13). Одним из необходимых условий функциональной активности актинопоринов является, как показывают «спиральные кольца», наличие внутри формируемой полости поры нескольких отрицательно заряженных а.о., которые определяют ее катионную селективность и, соответственно, величину гемолитической активности белка. Последовательности N-концевых спирализованных фрагментов рекомбинантных белков обоих семейств соответствуют требованиям, необходимым для проявления порообразующей активности, т.к. имеют отрицательно заряженные а.о.: Glu10, Asp20, Glu25 (у rHct-S3), Asp20, Glu25 (у rHctA2 и rHct-A3,) и Asp20, Glu21, Glu25 (у rHct-A3, rHct-A4, rHct-S5 и rHct-S6).

Более низкие значения гемолитической активности рекомбинантных актинопоринов rHct-A4, rHct-A5, rHct-S5 и rHct-S6, по сравнению с rHct-A2, rHct-A3, rHct-S3 и нативными белками (табл. 2) можно объяснить наличием положительно заряженного остатка Lys17, частично блокирующего проницаемость поры для ионов К+, тогда как у других актинопоринов в этом положении находятся либо отрицательно заряженные а.о. (у EqtII и StnI), либо незаряженный остаток глутамина (у актинопоринов HmgIII, StnII, rHct-A2, rHct-A3 и rHct-S3) (рис. 13).

Таблица 4. Значения средней гидрофобности (H) и среднего гидрофобного момента (H), а также количества заряженных остатков N-концевого -спирализованного фрагмента актинопоринов* Количество заряженных Диаграмма H H Актинопорин а.о. на N-концевом «спиральных колец фрагменте 10–27 ШиффераЭдмундсена»** () заряд () заряд RTX-A 0,349 0,563 2 RTX-SII 0,278 0,609 2 rHct-A2, 0,351 0,532 2 rHct-ArHct-S3, 0,402 0,479 3 Hct-A4, Hct-A5, 0,392 0,523 3 rHct-S5, rHct-SПримечание: * расчет произведен по программе HELIQUEST (http://heliquest.ipmc.cnrs.fr/).

** (Shiffer and Edmundson, 1967) Ранее было показано, что остатки Trp112 и Trp116, локализованные на 8 тяже РОС-сайта связывания функционально значимы для EqtII II, т.к. их замена на Phe уменьшает способность белка связываться с мембраной и более чем на 90% снижает его гемолитическую активность (Hong et al., 2002).

HmgIII (1)SAALAGTIIEGASLGFQILDKVLGELGKVSRK(32) EqtII (1)--DV--AV-D----S-D--KT--EA--N-K--(32) Рис. 13. Множественное выравнивание StnI (1)*SE------D----T-EV--------------(31) StnII (1)**-------A----T--V-----E--------(30) N-концевых аминокислотных последоrHct-S3 (1)--------------------------------(32) вательностей актинопоринов. HmgIII rHct-A2 (1)**-------A----------------------(30) (Swiss-Prot, Q9U6X1) из H. magnifica;

rHct-A3 (1)**-------A----------------------(30) rHct-A4 (1)**-------A----T-K---E-----------(30) EqtII (Swiss-Prot, P61914) из A. equina;

rHct-A5 (1)**-------A----T-K---E-----------(30) StnI, StnII (Swiss-Prot, P81662, P07845) rHct-S5 (1)---------A----T-K---E-----------(32) из S. helianthus.

rHct-S6 (1)---------A----T-K---E-----------(32) Однако этим фактам противоречат близкие величины гемолитической активности нативных Radianthus актинопоринов RTX-A, RTX-S, RTX-SII, Phyllodiscus актинопорина PsTX-20A и магнификализинов HMgII и HMgIII, которые имеют в положении, эквивалентном EqtII-Trp112, остатки Leu или Phe. Недавно Бакраком с сотрудниками было установлено, что помимо Trp112 для связывания со сфингомиелином мембраны необходим Tyr113 (Bakra et al., 2009) – остаток, имеющийся у всех известных актинопоринов и во всех последовательностях рекомбинантных белков семейств Hct-A и Hct-S (рис. 3 и 4).

2.6.3. In silico исследование комплекса актинопорина с лигандом, фософорилхолином Оценку функциональной роли аминокислотных остатков, локализованных в области POC-сайта связывания (Trp112, Tyr113, Tyr133, Tyr137 и Tyr138), в образовании комплексов актинопоринов StnII, rHct-S3 и rHct-S5, содержащих в 1положении остатки Trp, Phe или Ley соответственно, с фофорилхолином, проводили методами молекулярного моделирования (белок-лигандный докинг и молекулярная динамика). В качестве начального состояния комплекса rHct-S3 с фосфорилхолином (рис. 14, А) нами была принята архитектура комплекса, аналогичная таковой для стихолизина II (PDB ID 1O72). Показано, что в результате молекулярной динамики (МД) комплекса rHct-S3 с фосфорилхолином (в вакууме и в водном окружении, 5псек, Т=300K) происходит прочное связывание лиганда с актинопорином, обусловленное образованием шести водородных связей, ионного и от одного до трёх СН...-взаимодействий (рис. 14, Б). Следует отметить, что для исходного состояния характерно наличие только трех водородных связей и ионного взаимодействия (рис.

14, А).

Согласно результатам МД комплекса остатки Tyr113, Tyr133 и Tyr138 РОСсайта связывания, а также положительно заряженный Arg53 вносят значительный вклад во взаимодействие актинопорина с фосфорилхолином за счет образования водородных связей. При этом комплекс Hct-S3 с лигандом стабилизируют не только эти четыре водородные связи, образующиеся непосредственно между белком и фосфорилхолином, но и водородные связи, возникающие между остатками Ser105 и Arg53 и фосфатной группой опосредовано через молекулы воды (рис. 14, Б).

Ранее Бакрак и соавторы отметили, что электростатические взаимодействия не играют важной роли в связывании EqtII с мембраной (Bakra et al., 2009). Однако расчетные данные МД показали, что положительно заряженный остаток Argобразует ионную связь с атомами кислорода фосфорилхолина (рис. 14, Б). В процессе МД происходит уменьшение расстояния между гуанидиновой группой Arg53 и фосфатной группой лиганда с 6,60 до 3,63 . Это приводит к увеличению вклада электростатического взаимодействия в свободную энергию образования комплекса rHct-S3 и фосфорилхолина от 1,9 ккал/М до 14,1 ккал/М. Данный факт позволяет предположить, что электростатические взаимодействия всё-таки вносят существенный вклад в образование комплекса актинопорина с лигандом.

Установлено, что остаток Tyr113 образует водородную связь с атомом кислорода фосфатной группы, а также участвует в формировании по крайней мере одного СН…-взаимодействия между электронным облаком бензольного кольца и атомом водорода фосфорилхолина (рис. 14, Б). Как известно -взаимодействия играют важную роль в межмолекулярном распознавании при образовании белокбелковых и белок-лигандных комплексов (Tayubi and Sethumadhavan, 2011). В ходе молекулярной динамики мы не обнаружили возникновения взаимодействий между Trp112 и фосфорилхолином. Аналогичные результаты МД были получены и для комплексов актинопоринов StnII и rHct-S5 с лигандом. Расчетные методы показывают, что описанные выше молекулярные контакты, возникающие при взаимодействии актинопоринов с фосфорилхолиновой головкой, обеспечивают достаточно прочное связывание белка с лигандом.

А Б Рис. 14. Схемы межмолекулярных взаимодействий rHct-S3 с фосфорилхолином в начальном состоянии (А) и в результате молекулярной динамики (Б), где:

Контакт с растворителем Ионная связь Водородная связь C-H...-взаимодействие Таким образом, наличие или отсутствие в молекуле остатка Trp112 не играет принципиальной роли для проявления гемолитической активности актинопорина, поскольку остатки тирозина в положениях 113, 133, 137 и 138 обеспечивают молекуле возможность образования достаточно прочных контактов с фосфорилхолиновой головкой мембранного сфингомиелина (и/или фосфатидилхолина) посредством водородных связей, электростатических и СН…-взаимодействий (рис. 14, Б). Это подтверждают также результаты кристаллографических исследований комплекса StnII с фосфорилхолином (Mancheo et al., 2003) и экспериментальные данные, свидетельствующие о необратимости связывания актинопорина RTX-А с БЛМ (Чантурия и др., 1990). На величину гемолитической активности влияет не столько замена остатков в каком-то определенном положении молекулы, сколько наличие и локализация положительно и отрицательно заряженных остатков в функционально значимом N-концевом фрагменте актинопорина.

ВЫВОДЫ 1. Из актинии H. crispa выделен в индивидуальном состоянии новый актинопорин Hct-S4, молекулярная масса которого согласно данным MALDI TOFMS составляет 19414±10 Да. Определена аминокислотная последовательность его N-концевого фрагмента (20 аминокислотных остатков).

2. Установлены нуклеотидные последовательности генов и на их основе выведены аминокислотные последовательности 42 актинопоринов, принадлежащих к двум высокогомологичным мультигенным семействам, с Nконцевыми остатками аланина (Hct-A семейство) и серина (Hct-S семейство).

3. Проведен филогенетический анализ всех известных аминокислотных последовательностей актинопоринов. Показано, что на филодереве они объединяются в семь кластеров. Актинопорины H. crispa группируются в четыре кластера. Представители семейств актинопоринов Hct-A и Hct-S не формируют собственных, но входят в состав одних и тех же кластеров.

Предполагается, что дивергенция актинопоринов семейства Stichodactylidae произошла до разделения видов на H. crispa и H. magnifica.

4. Получено семь рекомбинантных форм актинопоринов семейств Hct-A и Hct-S, отличающихся аминокислотными последовательностями, а также величинами гемолитической активности. Установлено, что рекомбинантный белок rHct-Aтакже как и нативный актинопорин RTX-A вызывает дискретные флуктуации тока, характерные для проводящих структур ионных каналов.

5. Проведен сайт-направленный мутагенез RGD-мотива, получены три мутантные формы актинопоринов в виде телец включения.

6. На основании структурно-функционального анализа определены ключевые для функциональной активности актинопоринов из H. crispa заряженные аминокислотные остатки в N-концевых фрагментах и ароматические остатки РОС-связывающего сайта.

Список работ, опубликованных по теме диссертации 1. Ткачева Е.С. Функциональная экспрессия актинопорина RTX-S3, нового цитолитического токсина актинии Heteractis crispa // Вестник ДВО РАН. 2010. № 4. С. 134137.

2. Ткачева Е.С., Лейченко Е.В., Монастырная М.М., Исаева М.П., Зелепуга Е.А., Анастюк С.Д., Дмитренок П.С., Козловская Э.П. Новые актинопорины актинии Heteractis crispa: клонирование и функциональная экспрессия // Биохимия. 2011. Т. 76, вып. 10. С. 1387 – 1397.

3. Gladkikh I.N., Leychenko E.V., Monastyrnaya M.M., Isaeva M.P., Zelepuga E.A., Eskov A.A., Chausova V.E., Tkacheva E.S., Kozlovskaya E.P. Biologically active polypeptides from sea anemones: prospects of investigation // Intern. workshop on marine living resources of Vietnam. Hanoi. 2010. [proc.] – Hanoi: Inst. Nat. Prod.

Chem.,Vietnam Acad. Sci. Technol., 2011. P. 101110.

4. Меньшов А.С., Ткачева Е.С., Монастырная М.М. Новые актинопорины из актинии Heteractis crispa: выделение и частичная характеристика // Актуальные проблемы биологии, химии, физики: материалы международной заочной научно-практической конференции. (27 декабря 2011 г.) Новосибирск: Изд.

«ЭКОР-книга», 2011. С. 98106.

5. Ткачева Е.С. Гетерологичная экспрессия, выделение и очистка рекомбинантного белка Hct-A3 актинии Heteractis crispa // Актуальные проблемы биологии, химии, физики: материалы международной заочной научно-практической конференции. (27 декабря 2011 г.) Новосибирск: Изд.

«ЭКОР-книга», 2011. С. 1722.

6. Ткачева Е.С., Лейченко Е.В., Монастырная М.М., Исаева М.П., Зелепуга Е.А., Козловская Э.П. Получение нового рекомбинантного актинопорина актинии Heteractis crispa // Актуальные научные вопросы: реальность и перспективы:

сборник научных трудов по материалам Международной заочной научнопрактической конференции. (26 декабря 2011 г.) Тамбов: Изд. ТРОО «БизнесНаука-Общество», 2012. С. 133137.

7. Лейченко Е.В., Соболева (Ткачева) Е.С. Получение конструкции фрагмента гена, кодирующего зрелый актинопорин из актинии Radianthus macrodactylus с плазмидным вектором // XI Международная молодежная школа-конференция по актуальным проблемам химии и биологии: сб. тез. докл. Владивосток, (1118 сент. 2007 г.) Владивосток: ДВО РАН, 2007 С. 26.

8. Лейченко Е.В., Монастырная М.М., Исаева М.П., Еськов А.А., Ткачева Е.С., Козловская Э.П. Структурно-функциональные исследования актинопоринов // Химия, структура и функция биомолекул: сб. тез. докл. III Междунар. конф., Минск, (1-3 окт. 2008 г.) – Минск: Ин-т биоорган. химии НАН Беларуси, 2008.

– С. 145–146.

9. Tkacheva E.S., Eskov A.A., Leychenko E.V., Isaeva M.P., Gusev K.V., Monastyrnaya M.M., Kozlovskaya E.P. Cloning, sequencing and expression of actinoporin from the sea anemone, Radianthus macrodactilus // 1-st Far Eastern International Symposium on Life Science: proceed. Vladivostok, (Sept. 2-7, 2008) – Vladivostok: PIBOC FEB RAS, 2008. – P. 76.

10. Ткачева Е.С., Лейченко Е.В., Исаева М.П., Монастырная М.М., Козловская Э.П. Получение рекомбинантного актинопорина, пороформирующего токсина, из актинии Radianthus macrodactilus // Актуальные проблемы экологии, морской биологии и биотехнологии: сб. тез. докл. VIII регион. конф. студентов, аспирантов вузов и науч. организаций Дальнего Востока России, Владивосток, (11-14 дек. 2008 г.) Владивосток: ДВФУ, 2008 С. 144.

11. Ткачева Е.С., Лейченко Е.В., Исаева М.П., Монастырная М.М., Козловская Э.П. Получение рекомбинантных форм актинопоринов и исследование их гемолитической активности // XII Всероссийская молодежная школаконференция по актуальным проблемам химии и биологии: сб. тез. докл. Владивосток, (7-14 сент. 2009 г.) Владивосток: ДВО РАН, 2009 С. 75.

12. Ткачева Е.С., Еськов А.А., Лейченко Е.В., Исаева М.П., Монастырная М.М., Козловская Э.П. Мультигенное семейство актинопоринов из актинии Heteractis crispa // XIII Всерос. молодеж. школа-конф. по актуал. проблемам химии и биологии: сб. тез. докл. Владивосток, (7-14 сент. 2010 г.) Владивосток: ДВО РАН, 2008 С. 70.

13. Ткачева Е.С., Еськов А.А., Лейченко Е.В., Исаева М.П., Монастырная М.М., Козловская Э.П. Новое мультигенное семейство актинопоринов (Hct-S) актинии Heteractis crispa // V Российский симп. «Белки и пептиды»: сб. тез.

докл. Петрозаводск, (7-11 авг. 2011 г.) Петрозаводск: Карельский науч.

центр РАН, 2011 С. 310.

14. Tkacheva E.S., Leychenko E.V., Monastyrnaya M.M., Isaeva M.P., Kozlovskaya E.P. New multigene groups of the sea anemone actinoporins from Heteractis crispa // 9th IST Asia Pacific meet. on animal, plant and microbial toxins: proceed. Vladivostok, (4-8 Sept. 2011) Vladivostok: FEB RAS, 2011 P. 57.

Соискатель Ткачева Е. С.







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.