WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Землянская Елена Васильевна

ОБНАРУЖЕНИЕ НОВОЙ 5mC-ЗАВИСИМОЙ САЙТ-СПЕЦИФИЧЕСКОЙ ДНК-ЭНДОНУКЛЕАЗЫ BisI И УСТАНОВЛЕНИЕ ЕЁ СУБСТРАТНОЙ СПЕЦИФИЧНОСТИ

03.01.03 – молекулярная биология

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Кольцово – 2012

Работа выполнена в Обществе с ограниченной ответственностью «СибЭнзайм», г. Новосибирск

Научный консультант:

Дегтярев Сергей Харитонович, доктор биологических наук, профессор, ФБУН Государственный научный центр вирусологии и биотехнологии «Вектор», заведующий отделом производства и применения средств ПЦР-диагностики вирусных и риккетсиозных заболеваний

Официальные оппоненты:

Нетесова Нина Александровна, доктор биологических наук, ФБУН Государственный научный центр вирусологии и биотехнологии «Вектор», заведующая отделом разработки средств ПЦР-диагностики вирусных и риккетсиозных заболеваний Татьков Сергей Иванович, доктор биологических наук, Учреждение РАН Институт цитологии и генетики СО РАН, ведущий научный сотрудник

Ведущая организация:

Федеральное государственное бюджетное учреждение науки Институт общей генетики им. Н.И. Вавилова РАН, г. Москва

Защита состоится «14» декабря 2012 г. в 9-00 часов на заседании диссертационного совета Д 208.020.01 при ФБУН Государственный научный центр вирусологии и биотехнологии «Вектор» по адресу: р.п. Кольцово, Новосибирского района, Новосибирской области, 630599; тел: (383) 336-74-

С диссертацией можно ознакомиться в библиотеке ФБУН ГНЦ ВБ «Вектор» Автореферат разослан «9» ноября 2012 г.

Ученый секретарь диссертационного совета доктор биологических наук, профессор Трошкова Галина Павловна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы Метилзависимые сайт-специфические ДНК-эндонуклеазы (МД-эндонуклеазы, от английского «methyl-directed») – это немногочисленная группа ферментов, которые специфически расщепляют только метилированную ДНК. Среди них различают N6-метиладенин- и 5-метилцитозинзависимые ферменты. МДэндонуклеазы являются малоизученным, но очень интересным объектом, как для фундаментальных исследований, так и с точки зрения практического использования.

Изучение механизма действия МД-эндонуклеаз и их способности специфически узнавать и гидролизовать модифицированную ДНК представляет большой интерес для установления общей картины функционирования сайт-специфических ДНКэндонуклеаз. Важным также представляется изучение роли этой группы ферментов в функционировании бактериальной клетки, которая в настоящее время не совсем ясна.

Следует также отметить большой потенциал практического применения МД-эндонуклеаз в биотехнологии и эпигеномике для решения целого ряда различных задач. При этом наибольший интерес вызывают 5mC-зависимые ферменты, способные узнавать определенную метилированную последовательность ДНК и однозначно расщеплять ее в фиксированной позиции. Это связано с возможностью использования этих ферментов для изучения статуса метилирования ДНК у высших организмов (в том числе у человека), у которых именно 5-метилцитозиновые основания являются эпигенетическим маркером.

Учитывая ограниченное количество известных в настоящее время биохимически охарактеризованных представителей данной группы ферментов, обнаружение и изучение новых 5-метилцитозинзависимых сайт-специфических эндонуклеаз, способных однозначно гидролизовать ДНК, является актуальной задачей.

Цель и задачи исследования Целью данной работы явилось обнаружение и изучение свойств новой 5mC-зависимой сайт-специфической ДНК-эндонуклеазы, способной узнавать и расщеплять метилированную последовательность ДНК 5’-GCNGC-3’/3’-CGNCG-5’.

В задачи настоящего исследования входило:

1. Получение субстрата для 5mC-зависимой сайт-специфической ДНК-эндонуклеазы путем клонирования гена ДНК-метилтрансферазы M.Fsp4HI из Flavobacterium species 4H, узнающей и модифицирующей последовательность 5'-GCNGC-3', и определение положения 5-метилцитозина в метилированной последовательности.

2. Проведение скрининга бактерий из различных природных изолятов на наличие фермента, расщепляющего ДНК полученной плазмиды, и выявление продуцента 5mC-зависимой сайт-специфической ДНК-эндонуклеазы, узнающей и гидролизующей только метилированную ДНК.

3. Характеризация штамма-продуцента 5mC-зависимой сайтспецифической ДНК-эндонуклеазы, отработка методов его культивирования.

4. Очистка новой 5mC-зависимой сайт-специфической эндонуклеазы и определение оптимальных условий функционирования фермента.

5. Определение субстратной специфичности и места гидролиза ДНК эндонуклеазой.

6. Установление возможности практического использования новой 5mC-зависимой сайт-специфической эндонуклеазы в молекулярно-биологических исследованиях.

Научная новизна и практическая ценность работы Впервые получена рекомбинантная плазмида pFsp4HI1, несущая ген C5-ДНКметилтрансферазы M.Fsp4HI, модифицирующей последовательность 5’-GCNGC-3’.

Определена нуклеотидная последовательность вставки и установлены характеристики гена ДНК-метилтрансферазы M.Fsp4HI. Получен препарат рекомбинантной ДНК-метилтрансферазы М.Fsp4HI и показано, что фермент модифицирует сайт узнавания с образованием последовательности 5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’.

Впервые выявлен бактериальный штамм Bacillus subtilis T30, являющийся продуцентом 5mC-зависимой сайт-специфической ДНК-эндонуклеазы BisI. Впервые получен препарат фермента, определены его субстратная специфичность и позиция расщепления ДНК. Показано, что фермент BisI узнает последовательность нуклеотидов 5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’ и расщепляет ДНК в строго фиксированной позиции, как указано стрелками. BisI – это первая 5-метилцитозинзависимая эндонуклеаза, для которой показан сайт-специфический характер расщепления ДНК, свойственный для эндонуклеаз рестрикции второго типа. В работе также впервые проведен анализ субстратной специфичности эндонуклеазы BisI, и показана зависимость активности этой эндонуклеазы от «рисунка» метилирования сайта узнавания.

Впервые предложен способ, и экспериментально показана возможность использования новой 5mC-зависимой сайт-специфической эндонуклеазы BisI в молекулярно-биологических исследованиях для сайт-специфического расщепления протяженных неметилированных молекул ДНК.

Основные положения, выносимые на защиту - Рекомбинантная плазмида pFsp4HI1 содержит метилированные последовательности 5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’.

- Бактериальный штамм Bacillus subtilis Т30 продуцирует 5mC-зависимую сайтспецифическую ДНК-эндонуклеазу.

- 5mC-зависимая сайт-специфическая эндонуклеаза BisI узнает метилированную последовательность ДНК 5’-G(5mC)NGC-3’/3’CGN(5mC)G-5’ и расщепляет ее в фиксированной позиции, как указано стрелками.

- 5mC-зависимая сайт-специфическая эндонуклеаза BisI способна расщеплять последовательность 5’-GCNGC-3’/3’-CGNCG-5’ с различным количеством и расположением модифицированных оснований, при этом каноническим сайтом узнавания эндонуклеазы является метилированная последовательность 5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’.

- Эндонуклеаза BisI может быть использована для сайт-специфического расщепления протяженных неметилированных молекул ДНК.

Апробация работы и публикации Материалы исследований по теме диссертации представлены на следующих российских и международных конференциях: «1-ая Международная научнопрактическая конференция «Медбиотек-2005» (Москва, 2005), «Международная конференция «Биология – наука XXI века» (Москва, 2012). По материалам диссертации опубликованы три печатные работы.

Структура и объем работы Диссертация состоит из семи разделов: «Введение», «Обзор литературы», «Материалы и методы», «Результаты и обсуждение», «Заключение», «Выводы», «Список литературы». Работа изложена на 92 страницах машинописного текста и включает 18 рисунков и 2 таблицы. Список цитируемой литературы содержит 1ссылку.

Вклад автора в диссертационную работу Все основные эксперименты, проведенные в работе, а также анализ полученных результатов выполнены автором лично. Эксперименты по клонированию и микробиологические исследования проводились совместно с сотрудниками ООО «СибЭнзайм».

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

1. Получение рекомбинантной плазмиды, несущей ген ДНК-метилтрансферазы M.Fsp4HI При скрининге бактериальных штаммов на предмет выявления сайтспецифической эндонуклеазной активности в качестве субстратов обычно используют стандартные фаговые и плазмидные ДНК с известной нуклеотидной последовательностью, которые, как правило, не метилированы. Для поиска 5mCзависимой сайт-специфической эндонуклеазы мы планировали использовать в качестве субстрата препарат плазмидной ДНК, несущей ген ДНК-метилтрансферазы из системы рестрикции-модификации (РМ) Fsp4HI. Ферменты РМ системы Fsp4HI из бактериального штамма Flavobacterium species 4H узнают нуклеотидную последовательность 5’-GCNGC-3’. Для клонирования гена fsp4HIM в клетках Escherichia coli ER 2267 была получена геномная библиотека (порядка 150клонов), содержащая встроенные в плазмидный вектор pUC19 EcoRI-фрагменты хромосомы Flavobacterium species 4H. Селекция клонов, содержащих ген ДНКметилтрансферазы M.Fsp4HI, проводилась, основывалась на устойчивости целевых рекомбинантных плазмид к расщеплению эндонуклеазой рестрикции (ЭР) Fsp4HI.

Часть клонов, выросших на среде с ампициллином после трансформации компетентных клеток E. coli ER 2267 продуктами гидролиза ДНК геномной библиотеки эндонуклеазой Fsp4HI, несла плазмиды, устойчивые к расщеплению ЭР Fsp4HI, а, значит, содержащие ген функционально активной ДНК-метилтрансферазы данной РМ системы. Показано, что все эти клоны содержат также специфическую эндонуклеазную активность, свойственную ЭР Fsp4HI. Таким образом, полученные рекомбинантные штаммы E.coli содержали плазмиду с полным опероном РМ системы Fsp4HI. Плазмидная ДНК, выделенная из одного штамма и названная pFsp4HI1, содержала вставку длиной около 5 т.п.н. Было проведено определение нуклеотидной последовательности встроенного фрагмента.

Анализ нуклеотидной последовательности вставки выявил несколько открытых рамок трансляции (ОРТ), две из которых оказались достаточно протяженными для того, чтобы кодировать гены РМ системы (ОРТ1, район 862-2088, и ОРТ2, район 2085-3215) (рис.1). Соответствующие нуклеотидные и аминокислотные последовательности депонированы в банке данных GenBank (Acc.

number EMBL Data Bank DQ848673). Обе открытые рамки трансляции направлены одинаково и перекрываются друг с другом на 4 п.н.

Рис. 1. Схема расположения открытых рамок трансляции, соответствующих генам ДНКметилтрансферазы и эндонуклеазы рестрикции из системы РМ Fsp4HI.

Первая рамка длиной 1227 п.н. кодирует полипептид из 408 аминокислотных остатков с предсказанной молекулярной массой 47134 Да. Анализ аминокислотной последовательности потенциального белкового продукта ОРТ1 показал его принадлежность к классу С5 ДНК-метилтрансфераз: в первичной структуре белка выявляются все 10 консервативных мотивов, характерных для ДНК-метилтрансфераз данного класса, при этом, как и у большинства других С5-метилтрансфераз, между восьмым и девятым консервативными мотивами расположен вариабельный участок, который, как полагают, ответствен за специфическое связывание ДНК (рис. 2).

Таким образом, первая рамка, по-видимому, представляет собой ген ДНКметилтрансферазы M.Fsp4HI.

Вторая рамка длиной 1131 п.н. кодирует полипептид из 376 аминокислотных остатков, при анализе аминокислотной последовательности которого значительной гомологии с другими белками обнаружено не было. Однако отсутствие скольконибудь значительной гомологии первичных структур, за исключением некоторых изошизомеров, характерно для эндонуклеаз рестрикции II-го типа. Таким образом, поскольку других подходящих по длине рамок, которые могли бы кодировать специфическую эндонуклеазу, во вставке нет, а рекомбинантная бактерия проявляет специфическую эндонуклеазную активность, вторая рамка трансляции, Рис. 2. Множественное выравнивание аминокислотных последовательностей С5 ДНК-метилтрансфераз из различных систем рестрикциимодификации. Десять консервативных мотивов отмечены волнистой линией и расположены по порядку от I до Х.

по-видимому, соответствует гену эндонуклеазы рестрикции Fsp4HI (рис. 1).

Плазмида pFsp4HI1 была использована для дальнейшего субклонирования. Был отобран фрагмент Bpu14I (сайт узнавания 5’-TTCGAA-3’) длиной порядка 1,8 т.п.н., содержащий ОРТ1, который был встроен в плазмиду pMTL22 по сайту Bsa29I (сайт узнавания 5’-ATCGAT-3’). Полученная плазмида, названная pFsp4HI2, оказалась устойчивой к расщеплению ЭР Fsp4HI, но клон, содержащий ее, не проявляет специфической эндонуклеазной активности. Это означает, что вставка содержит ген функционально активной ДНК-метилтрансферазы M.Fsp4HI, и не содержит полноразмерного гена эндонуклеазы рестрикции Fsp4HI.

2. Определение позиции модифицируемого основания ДНК-метилтрансферазу M.Fsp4HI выделяли из штамма E. coli, несущего рекомбинантную плазмиду pFsp4HI2 с геном fsp4HIM. Чтобы определить, какое из двух цитозиновых оснований в сайте узнавания модифицирует ДНК-метилтрансфераза, анализировали включение тритиевой метки при метилировании ДНК ферментом в присутствии [3Н]-SAM. Для этого синтетический олигонуклеотидный дуплекс, содержащий расположенные рядом сайты узнавания ДНК-метилтрансферазы M.Fsp4HI (GCNGC) и эндонуклеазы рестрикции подтипа IIS BstF5I (GGATG2/0) (рис. 3А), метилировали ферментом M.Fsp4HI в присутствии А 5' CTCGGATG CAGCATTGCACCTGTC 3' 24 нт 3' GAGCCTACGT CGTAACGTGGACAG 5' 24 нт Б 1164 cpm 469 cpm 10 нт 5' CTCGGATGCA GCATTGCACCTGTC 3' 14 нт 8 нт 3' GAGCCTAC GTCGTAACGTGGACAG 5' 16 нт 132 cpm 2886 cpm Рис. 3. Определение модифицируемого основания в сайте узнавания M.Fsp4HI. А – структура олигонуклеотидного дуплекса. Б – включение тритиевой метки в одноцепочечные фрагменты ДНК, полученные после расщепления олигонуклеотидного дуплекса ЭР BstF5I.

Сайт узнавания метилазы M.Fsp4HI выделен жирным шрифтом, сайт узнавания ЭР BstF5I подчеркнут, место расщепления ДНК ЭР BstF5I указано стрелками.

[3Н]-SAM, далее [3Н]-меченый дуплекс расщепляли ЭР BstF5I, продукты реакции разделяли путем денатурирующего электрофореза в полиакриламидном геле и определяли количество радиоактивной метки в каждом из четырех одноцепочечных фрагментов ДНК. Результаты измерений приведены на рис. 3Б. Видно, что тритиевая метка включается преимущественно во фрагменты длиной 10 и 16 нт. Такая картина может наблюдаться только в том случае, если метилтрансфераза M.Fsp4HI модифицирует первый цитозин узнаваемой последовательности, таким образом, метилированная ДНК содержит модифицированные сайты 5’-G(5mC)NGC-3’.

3. Обнаружение и характеристика штамма-продуцента новой эндонуклеазы, специфически расщепляющей ДНК плазмиды pFsp4HIПлазмиду pFsp4HI1, полученную в результате клонирования гена ДНК-метилтрансферазы M.Fsp4HI, использовали наряду с другими ДНК-субстратами для скрининга бактериальных штаммов на предмет выявления сайт-специфической эндонуклеазной активности. При исследовании мезофильных бактериальных штаммов, выделенных из образцов почвы, было обнаружено, что один из штаммов продуцирует эндонуклеазу, которая не гидролизует стандартные вирусные и плазмидные ДНК, используемые для нахождения и определения активности эндонуклеаз рестрикции (ДНК фагов , Т7, аденовируса-2, плазмид pUC19 и pBR322), но специфически расщепляет ДНК плазмиды pFsp4HI1, которая метилирована по сайтам 5'-GCNGC-3', благодаря содержащемуся в ней гену метилтрансферазы M.Fsp4HI.

Штамм имеет следующие культурально-морфологические и физиологобиохимические характеристики. На среде Лурия-Бертрани образует белые, зернистые, непрозрачные, слегка выпуклые, круглые колонии с ровными краями 4 мм в диаметре. Клетки подвижные, палочковидные, размером 1х(3-5) мкм, одиночные, в парах или в коротких цепочках. Образуют эллиптические центрально-расположенные споры без разбухания спорангия. Грамположительные. Не способны к анаэробному росту, каталазоположительные, оксидазоотрицательные. Растут при температуре 10-40оС. Оптимальная температура роста 300С, рН 7,0-7,2. По совокупности морфологических и биохимических свойств, а также на основании анализа нуклеотидной последовательности фрагмента гена 16S рибосомальной РНК штамм был определен как Bacillus subtilis Т30. Продуцируемая им эндонуклеаза названа BisI.

4. Выделение новой эндонуклеазы BisI и определение оптимальных условий гидролиза ДНК Вследствие невысокой целевой эндонуклеазной активности в биомассе клеток нами была разработана специальная схема очистки фермента BisI. Выделение проводили из грубого клеточного экстракта посредством колоночной хроматографии с использованием в качестве сорбентов 80 мл фосфоцеллюлозы Р-11, 50 мл DEAE-целлюлозы, 7 мл фосфоцеллюлозы Р-11, 3 мл гепарин-сефарозы и 1,5 мл аффинного сорбента CPG-2000 Oligo. Последний представляет собой иммобилизованные на стекле олигонуклеотиды, в первичной структуре которых присутствует сайт 5’-GCNGC-3’ (5’ TGGATGCAGCGCTTCG-p), с присоединенной комплементарной цепью (5’ GAAGCGCTGCATCCA 3’). Использование аффинного сорбента CPG-2000 Oligo на заключительном этапе хроматографической очистки позволило получить препарат фермента BisI, свободный от примесных эндо- и экзонуклеазной, а также фосфатазной активностей.

В результате проведенного выделения было получено 1,75 мл препарата эндонуклеазы BisI с удельной активностью 500 ед/мл. За единицу активности (ед) принимали минимальное количество фермента, необходимое для полного расщепления 1 мкг ДНК плазмиды pFsp4HI1 в течение 1 часа при температуре 37С в 50 мкл реакционной смеси. Выход составил 20 единиц активности на грамм сырой биомассы.

В результате экспериментов по оптимизации условий функционирования нового фермента было показано, что эндонуклеаза BisI наиболее активна при температуре 30-42С, нагрев реакционной смеси выше 50С приводит к резкому снижению активности фермента. Эндонуклеазная активность BisI максимальна при высоких значениях рН реакционного буфера (8,5 – 9,5), что отличает новый фермент от подавляющего большинства известных сайт-специфических эндонуклеаз, которые проявляют максимальную активность в диапазоне рН 7,0 – 8,5. Оптимальная концентрация одновалентных ионов (в составе солей KCl или NaCl) для проявления эндонуклеазной активности BisI находится в диапазоне от 100 до 200 мМ, ионов Mg2+ – от 10 до 30 мМ. Кроме того, в экспериментах по оптимизации условий реакции показано, что активность эндонуклеазы BisI не зависит от присутствия в реакционной смеси АТФ и SAM. В соответствии с полученными данными, все дальнейшие эксперименты по гидролизу ДНК эндонуклеазой BisI проводили при 37С в буфере следующего состава: 10 мМ Трис-HCl (pH 9,0), 10 мМ MgCl2, 150 мМ KCl, 1 мМ дитиотреитол.

5. Определение нуклеотидной последовательности, узнаваемой эндонуклеазой BisI Специфичность эндонуклеазы BisI определяли, анализируя картины специфического гидролиза различных ДНК. В качестве субстратов использовали стандартные вирусные и плазмидные ДНК (фагов и Т7, аденовируса-2, pUC19, pBR322), используемые для нахождения и определения активности эндонуклеаз рестрикции, а также плазмидные ДНК, содержащие клонированные гены некоторых бактериальных метилаз, модифицирующих цитозиновые основания в ДНК (M.Fsp4HI метилирует ДНК с образованием последовательности 5’-G(5mC)NGC-3’, M.HspAI модифицирует ДНК с образованием последовательности 5’-G(5mC)GC-3’, M.FauIA и M.FauIB метилируют ДНК образованием последовательностей 5’-C(5mC)CGC-3’ и 5’-G(5mC)GGG-3’, соответственно). Результаты экспериментов показали, что фермент BisI специфически расщепляет только ДНК плазмиды pFsp4HI1, которая метилирована по сайтам 5'-GCNGC-3'. В случае остальных субстратов, как метилированных, так и немодифицированных, гидролиз ДНК не происходит.

Полученные данные свидетельствуют, что фермент BisI обладает специфичностью к определенной последовательности ДНК, содержащей 5-метилцитозиновые основания.

Расщепление ДНК плазмиды pFsp4HI1 происходит с образованием большого числа фрагментов (рис. 4, дорожки 7, 12), что свидетельствует о множественном присутствии сайтов узнавания в первичной структуре плазмиды. Длины фрагментов, получающиеся в результате расщепления плазмиды pFsp4HI1 ферментом BisI, совпадают с расчетными при расщеплении ДНК по метилированным сайтам 5’G(5mC)NGC-3’ (рис 4Б). Для подтверждения предполагаемого сайта узнавания фермента BisI ДНК плазмиды pUC19 была исчерпывающе метилирована ДНКметилтрансферазой M.Fsp4HI, модифицирующей первое цитозиновое основание последовательности 5'-GCNGC-3'. Из рис. 4А видно, что ДНК плазмиды pUCустойчива к действию фермента BisI, но расщепляется ЭР Fsp4HI. Тогда как ДНК плазмиды pUC19, модифицированная ферментом M.Fsp4HI, наоборот, устойчива к действию ЭР Fsp4HI, но расщепляется эндонуклеазой BisI. Сравнение электрофоретических картин расщепления ДНК позволило установить, что гидролиз модифицированной плазмиды pUC19 приводит к образованию фрагментов с длинами, соответствующими длинам фрагментов, образующихся при расщеплении той же немодифицированной плазмидной ДНК ЭР Fsp4HI (рис. 4А). Полученные данные 1 2 3 4 5 6 7 8 9 10 11 12 13 76331043...

А Б Рис. 4. Сравнение длин фрагментов, образуемых при расщеплении плазмидных ДНК, линеаризованных ЭР BamHI, эндонуклеазами BisI и Fsp4HI. А – электрофорез в 2% агарозном геле. Дорожки: 1-3 – ДНК pUC19, соответственно: интактная, обработанная эндонуклеазой BisI, обработанная ЭР Fsp4HI; 4-6 – ДНК pUC19, метилированная ферментом M.Fsp4HI, соответственно: обработанная эндонуклеазой BisI, обработанная ЭР Fsp4HI, интактная; 7-9 – ДНК pFsp4HI, соответственно: обработанная эндонуклеазой BisI, обработанная ЭР Fsp4HI, интактная; 10 – маркер молекулярного веса 1 Kb со следующими длинами фрагментов ДНК (т.п.н.): 10; 8; 6; 5; 4; 3х2; 2,5; 2; 1,5; 1х3; 0,75; 0,5х2; 0,25. Б – электрофорез в 1% агарозном геле. Справа указаны расчетные длины фрагментов в п.н., образующихся при расщеплении ДНК pFsp4HI1 по сайтам 5’-G(5mC)NGC-3’. Дорожки: 11 – маркер молекулярного веса 1 Kb; 12-14 – ДНК pFsp4HI, соответственно: обработанная эндонуклеазой BisI, обработанная ЭР Fsp4HI, интактная.

доказывают, что новая эндонуклеаза BisI узнает и расщепляет метилированную последовательность 5'-G(5mC)NGC-3'.

Способность эндонуклеазы BisI узнавать и гидролизовать последовательность 5'-G(5mC)NGC-3' подтвердилась также в экспериментах по расщеплению синтетических олигонуклеотидных ДНК-дуплексов, содержащих метилированную и неметилированную последовательность 5'-GCNGC-3' в одинаковом нуклеотидном окружении. Ниже приведены структуры соответствующих олигонуклеотидов (сайты 5’-GCNGC-3’ подчеркнуты):

L7 5’ GAGTTTAGCGGCTATCGATCT 3’ L8 5’ AGATCGATAGCCGCTAAACTC 3’ L9 5’ GAGTTTAG(5mC)GGCTATCGATCT 3’ L10 5’ AGATCGATAG(5mC)CGCTAAACTC 3’ L11 5’ GAGTTTAG(5mC)AGCTATCGATCT 3’ L12 5’ AGATCGATAG(5mC)TGCTAAACTC 3’.

Из электрофореграммы, приведенной на рис. 5, видно, что BisI действительно расщепляет только ДНК-дуплексы, содержащие метилированные сайты 5'-G(5mC)NGC-3' (дорожки 6 и 9) и не расщепляет ДНК, содержащую ту же неметилированную последовательность (дорожка 3).

Рис. 5. Расщепление олигонуклеотидных 1 2 3 4 5 6 7 8 дуплексов эндонуклеазами BisI и Fsp4HI. [32P]меченные олигонуклеотиды отмечены "*".

Дорожки: 1-3 – L7*/L8 (сайт 5’-GCGGC-3’), соответственно: интактный, обработанный ЭР Fsp4HI, обработанный эндонуклеазой BisI; 4-6 – L9*/L10 с сайтом 5’-G(5mC)GGC-3’, соответственно: интактный, обработанный ЭР Fsp4HI, обработанный эндонуклеазой BisI; 7-9 – L11*/L12 с сайтом 5’-G(5mC)AGC-3’, соответственно: интактный, обработанный ЭР Fsp4HI, обработанный эндонуклеазой BisI.

6. Исследование чувствительности МД-эндонуклеазы BisI к 4mC-метилированию сайта узнавания При определении нуклеотидной последовательности, узнаваемой эндонуклеазой BisI, были использованы метилированные ДНК-субстраты, содержащие 5-метилцитозиновые основания, однако в природе цитозиновые основания могут быть также метилированы в положении N4. Для определения чувствительности фермента BisI к N4-метилцитозину были проведены эксперименты по расщеплению олигонуклеотидных дуплексов, содержащих метилированную последовательность 5’-G(4mC)NGC-3’. Ниже приведены структуры используемых олигонуклеотидов (сайты 5’-GCNGC-3’ подчеркнуты):

С5 5’ GCTTGTACTTTAG(5mC)GGCATTGATTCTCACCACG 3’ С5’ 5’ CGTGGTGAGAATCAATG(5mC)CGCTAAAGTACAAGC 3’ N4 5’ GCTTGTACTTTAG(4mC)GGCATTGATTCTCACCACG 3’ N4’ 5’ CGTGGTGAGAATCAATG(4mC)CGCTAAAGTACAAGC 3’.

Из электрофореграммы на рис. 6 видно, что эндонуклеаза BisI гидролизует дуплекс, содержащий метилированную последовательность 5’-G(5mC)NGC-3’ (дорожка 2), но не 5’-G(4mC)NGC-3’ (дорожка 4). Таким образом, фермент BisI является 5mС-зависимой эндонуклеазой.

1 2 3 Рис. 6. Расщепление метилированного сайта узнавания, содержащего C5- и N4-метилцитозиновые основания, эндонуклеазой BisI. [32P]-меченные олигонуклеотиды отмечены знаком "*". Дорожки: 1-2 – дуплекс С5*/C5’ с сайтом 5’-G(5mC)GGC-3’, соответственно:

интактный, обработанный эндонуклеазой BisI; 3-4 – дуплекс N4*/N4’ с сайтом 5’-G(4mC)GGC-3’, соответственно:

интактный, обработанный эндонуклеазой BisI.

7. Определение места гидролиза ДНК эндонуклеазой BisI Позиции гидролиза ДНК в сайте узнавания были установлены с помощью определения длин фрагментов, образующихся при расщеплении синтетического олигонуклеотидного дуплекса L9/L10, содержащего метилированную нуклеотидную последовательность 5’-G(5mC)NGC-3’, ферментом BisI. На рис. 7 приведены результаты гидролиза [32P]-меченных олигонуклеотидных дуплексов L7*/L8 и L9*/L10 эндонуклеазами BisI и Fsp4HI. Дуплексы имеют одинаковую первичную структуру и отличаются только метилированием цитозинового основания в сайте 5’-G(5mC)NGC-3’ в обеих цепях дуплекса L9/L10. В качестве маркера молекулярного веса использовали продукты частичного гидролиза тех же дуплексов экзонуклеазой III из E.coli.

Сравнение длин фрагментов, образующихся при гидролизе этих субстратов специфическими эндонуклеазами, указывает на то, что BisI расщепляет меченую цепь метилированного дуплекса так же, как Fsp4HI расщепляет меченую цепь неметилированного дуплекса. Для проверки позиции расщепления второй цепи был Рис. 7. Определение позиции гидролиза ДНК 1 2 3 4 5 6 7 эндонуклеазой BisI. [32P]-меченные олигонуклеотиды отмечены "*". ExoIII - экзонуклеаза III E. coli. Дорожки: 1-4 – дуплекс L7*/L8 с сайтом 5’-GCGGC-3’, соответственно:

интактный, обработанный эндонуклеазой BisI, обработанный ExoIII, обработанный ЭР Fsp4HI; 58 – метилированный дуплекс L9*/L10 с сайтом 5’G(5mC)GGC-3’, соответственно: обработанный эндонуклеазой BisI, обработанный ExoIII, обработанный ЭР Fsp4HI, интактный.

проведен аналогичный эксперимент с использованием тех же дуплексов, но радиоактивная метка была включена в другую цепь (L8*/L7 и L10*/L9). Длины фрагментов, образующихся при гидролизе ДНК ферментами BisI и Fsp4HI, также совпали. Таким образом, BisI гидролизует ДНК в сайте узнавания как показано стрелками:

5' - G(5mC)N G C - 3' 3' - C G N(5mC)G - 5'.

8. Определение канонического варианта метилирования сайта узнавания МД-эндонуклеазы BisI Чтобы оценить влияние «рисунка» метилирования сайта узнавания на возможность гидролиза ДНК эндонуклеазой BisI, были проведены эксперименты по расщеплению ДНК, содержащей последовательность 5’-GCNGC-3’ с различным количеством и расположением 5-метилцитозиновых оснований. Существуют девять различных вариантов метилирования последовательности 5’-GCNGC-3’. Три из них обладают палиндромной симметрией, при которой расположение метилированных оснований в верхней цепи соответствует таковому в нижней цепи. Еще три варианта представлены полуметилированными сайтами, в которых 5-метилцитозиновые основания присутствуют только в одной из цепей узнаваемой последовательности. В остальных случаях модифицированные основания представлены в обеих цепях, но их расположение различается (непалиндромное метилирование).

В качестве субстрата были использованы синтетические олигонуклеотидные дуплексы, содержащие последовательность 5’-GCNGC-3’ с различным количеством и распределением метилированных цитозиновых оснований. Выбор олигонуклеотидного дуплекса в качестве субстрата обусловлен сложностью получения плазмидной, фаговой или иной природной ДНК, содержащей нужную последовательность с необходимыми вариантами метилирования. Использованные в эксперименте олигонуклеотидные субстраты имеют одинаковую первичную структуру, разница заключается лишь в метилировании сайта 5’-GCNGC-3’:

1 5’ GCTTGTACTTTAG(5mC)GGCATTGATTCTCACCACG 3’ 1c 5’ CGTGGTGAGAATCAATG(5mC)CGCTAAAGTACAAGC 3’ 2 5’ GCTTGTACTTTAGCGG(5mC)ATTGATTCTCACCACG 3’ 2c 5’ CGTGGTGAGAATCAATGCCG(5mC)TAAAGTACAAGC 3’ 3 5’GCTTGTACTTTAG(5mC)GG(5mC)ATTGATTCTCACCACG 3’ 3c 5’ CGTGGTGAGAATCAATG(5mC)CG(5mC)TAAAGTACAAGC 3’ 4 5’GCTTGTACTTTAGCGGCATTGATTCTCACCACG 3’ 4c 5’ CGTGGTGAGAATCAATGCCGCTAAAGTACAAGC 3’.

Из электрофореграмм, представленных на рис. 8, видно, что гидролизу подвергаются дуплексы, содержащие сайт узнавания с любым из описанных выше вариантов метилирования, при этом позиция расщепления ДНК эндонуклеазой BisI остается неизменной. Устойчивым к действию BisI оказался лишь ДНК-дуплекс 4/4c, содержащий немодифицированную последовательность 5’-GCNGC-3’. Это означает, что метилзависимая сайт-специфическая эндонуклеаза BisI расщепляет обе цепи узнаваемой последовательности 5’-GCNGC-3’/3’-CGNCG-5’, содержащей от одного до четырех 5-метилцитозиновых оснований в любых позициях. Таким образом, необходимым и достаточным условием для гидролиза ДНК эндонуклеазой BisI является присутствие как минимум одного 5-метилцитозинового основания в любой позиции узнаваемой последовательности.

Из электрофореграмм, представленных на рис. 8, видно, что при расщеплении эндонуклеазой BisI сайта узнавания с различными вариантами метилирования степень гидролиза ДНК варьирует в широких пределах. Очевидно, что фермент расщепляет метилированный сайт узнавания 5’-GCNGC-3’ с различной эффективностью в зависимости от варианта метилирования. Для выявления оптимального субстрата определяли временную зависимость доли расщепленных цепей ДНК-дуплексов с девятью возможными вариантами метилирования.

Полученные результаты представлены на рис. 9 и 10. Из рисунков видно, что наиболее эффективно расщепляется сайт узнавания, в котором метилированы А Б Рис. 8. Расщепление эндонуклеазой BisI олигонуклеотидных дуплексов, содержащих последовательность 5’-GCNGC-3’ с различными вариантами метилирования. A – расщепление олигонуклеотидных дуплексов, в которых последовательность 5’-GCNGC-3’ содержит не более одного 5-метилцитозина в каждой цепи (умеренное метилирование сайта узнавания). Б – расщепление олигонуклеотидных дуплексов, содержащих последовательность 5’-GCNGC-3’, хотя бы в одной из цепей которой метилированы оба цитозина (избыточное метилирование сайта узнавания). [32P]-меченные олигонуклеотиды отмечены “*”. Минус (-) обозначает, что в реакционную смесь не добавляли эндонуклеазу.

внутренние цитозиновые основания (5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’). Это палиндромный вариант метилирования, и гидролиз обеих цепей происходит с одинаковыми скоростями (данные не приводятся). При непалиндромном расположением двух 5-метилцитозинов (5’-G(5mC)NGC-3’/3’-(5mC)GNCG-5’) узнаваемая последовательность расщепляется медленнее. Еще менее эффективно гидролизуется полуметилированный сайт узнавания, в котором внутреннее цитозиновое основание метилировано только в одной из цепей (5’-G(5mC)NGC-3’/3’-CGNCG-5’) (рис. 9). При расщеплении избыточно метилированных дуплексов (то есть содержащих хотя бы в одной из цепей узнаваемой последовательности два метилцитозиновых основания) также наблюдается снижение эффективности гидролиза ДНК эндонуклеазой BisI по сравнению с субстратом, содержащим метилированную последовательность 2*(-) 2*/2c 2*/1c 2*/4c 4*(-) 4*/1c 4*/2c 4*/4c 2c*(-) 2c*/2c*/4c*(-) 4c*/4c*/4c*/1*(-) 1*/1c 1*/2c 1*/4c 1c*(-) 1c*/1c*/1c*/2c*/3*(-) 3* /3c 3*/1c 3* /2c 3*/4c 1*(-) 1*/1c 1*/3c 2*(-) 2*/3c 4*(-) 4*/3c 3c*(-) 3c*/3c*/3c*/3c*/1c*(-) 1c*/1c*/2c*(-) 2c*/4c*(-) 4c*/70 1*/1' NN1/NNNN22*/NNNN1/NNNN02*/NNNN11/NNNN11*/NNNN02/NN0 10 20 30 Время, мин Рис. 9. Временная зависимость доли BisI-расщепленных дуплексов с умеренным метилированием. -- 1*/1c, ---- 1*/2c, ---- 2c*/1, -- 1*/4c, -- 4c*/1, -- 2*/2c, -- 2*/4c, - 4c*/2.

NN1/NN(6) NN1/DD60 (6) DD1/NN(6) DD1/DD(6) DD1/NN(5) NN02*/DDDD1/NN(5) NN22*/DD0 10 20 30 Время, мин.

Рис. 10. Временная зависимость доли BisI-расщепленных дуплексов с избыточным метилированием. -- 1*/1c, -- 1*/3c, -- 3*/1с, -- 3*/3c, -- -- 3*/4с, ---- 4с*/3, - - 3*/2с, - 2с*/3.

Доля расщепленной цепи, % Доля расщепленной цепи, % 5’-G(5mC)NGC-3’/3’-CGN(5mC)G-5’, причем сайт узнавания, в котором метилированы оба внутренних и один наружный цитозин расщепляется эффективнее, чем тот, в котором метилированы два наружных и один внутренний цитозин, а также чем полуметилированный сайт 5’-G(5mC)NG(5mC)-3’/3’-CGNCG-5’ (рис. 10).

Наименьшая эффективность гидролиза ДНК эндонуклеазой BisI наблюдается при расщеплении узнаваемой последовательности, в которой модифицированные основания занимают только наружное положение (5’-GCNG(5mC)-3’/3’-(5mC)GNCG5’ и 5’-GCNG(5mC)-3’/3’-CGNCG-5’) (рис. 9). Таким образом, каноническим будем считать вариант метилирования, при котором модифицированы два внутренних цитозиновых основания в сайте узнавания BisI, поскольку он обеспечивает наибольшую скорость расщепления ДНК-субстрата.

Интересно, что при расщеплении эндонуклеазой BisI субстрата, содержащего сайт узнавания BisI с четырьмя 5-метилцитозиновыми основаниями, после быстрого образования некоторого количества продукта реакции его дальнейшего накопления с течением времени не происходит (рис. 10). Это свойство МД-эндонуклеазы BisI требует дополнительного изучения, однако можно предположить, что при взаимодействии эндонуклеазы с таким субстратом происходит инактивация фермента в результате образования прочного комплекса с продуктом реакции.

9. Возможность практического использования МД-эндонуклеазы BisI в молекулярно-биологических исследованиях Одной из особенностей эндонуклеазы BisI является способность расщеплять полуметилированный сайт узнавания, в котором модифицирована только одна цепь, не разрушая при этом ДНК, не содержащую 5-метилцитозиновых оснований.

Благодаря этому свойству, помимо потенциальной возможности использовать 5mCзависимую сайт-специфическую эндонуклеазу BisI в эпигенетических исследованиях, представляется возможным применять этот фермент для расщепления двуцепочечных молекул ДНК в произвольно выбранном сайте с последовательностью нуклеотидов 5’-GCNGC-3’ внутри. Это достигается благодаря формированию уникального полуметилированного сайта узнавания эндонуклеазы BisI на молекуле ДНК, в которой последовательности 5’-GCNGC-3’ не содержат 5-метилцитозиновых оснований, путем присоединения к двуцепочечной молекуле ДНК олигонуклеотида, комплементарного сайту-мишени и содержащего метилированную последовательность 5’-G(5mC)NGC-3’. В этом случае специфичность гидролиза обеспечивается специфичностью гибридизации, а также отмеченными выше свойствами эндонуклеазы. Согласно предлагаемой схеме осуществили гидролиз заданной последовательности 5’-GCNGC-3’ на двуцепочечной ДНК плазмиды pUC19.

ДНК плазмиды содержит 19 сайтов 5’-GCNGC-3’. Для расщепления выбрали сайт 5’-GCТGC-3’, расположенный в районе 254-258 п.н. Для присоединения к двуцепочечной ДНК использовали комплементарные разным цепям сайта-мишени олигонуклеотиды с метилированными сайтами 5’-G(5mC)NGC-3’ (подчеркнуты):

р1: 5' CATTCAGG(5mC)TGCGCAACTGTTGGGAAGGGCGATCG 3' р2: 5' CAGTTGCG(5mC)AGCCTGAATGGCGAATGGCGCCTGATG 3'.

1 2 3 4 5 Рис. 11. Расщепление эндонуклеазой BisI ДНК плазмиды pUC19, линеаризованной ЭР DriI, по сайту 5’GCNGC-3’ в районе 254-258 п.н. Дорожки: 2 – линеаризованная ДНК pUC19; 3 – линеаризованная ДНК pUC19, обработанная эндонуклеазой BisI; 4 – линеаризованная ДНК pUC19 с присоединенными метилированными олигонуклеотидами; 5 – линеаризованная ДНК pUC19 с присоединенными метилированными олигонуклеотидами, обработанная эндонуклеазой BisI; 1 и 6 – маркер молекулярного веса 1 Kb со следующими длинами фрагментов ДНК (т.п.н.):

10; 8; 6; 5; 4; 3х2; 2,5; 2; 1,5; 1х3; 0,75; 0,5х2; 0,25.

Для комплементарного присоединения олигонуклеотидов ДНК плазмиды, линеаризованной эндонуклеазой рестрикции DriI (сайт узнавания GACNNNNNGTC), инкубировали совместно со 100-кратным избытком олигонуклеотидов при 95°С в течение 5 мин, после чего помещали в лед.

На рис. 11 представлена электрофореграмма продуктов расщепления ДНК плазмиды pUC19 с присоединенными олигонуклеотидами и без них эндонуклеазой BisI. Видно, что ДНК расщепляется ферментом BisI только после комплементарного присоединения к ней метилированных олигонуклеотидов. При этом образуются два фрагмента ДНК, длины которых соответствуют ожидаемым при расщеплении ДНК плазмиды в районе 254-258 п.н. (1242 п.н. и 1444 п.н.). Таким образом, показана возможность применения на практике предложенного способа сайт-специфического расщепления ДНК.

ВЫВОДЫ 1. Проведено клонирование генов РМ системы Fsp4HI из Flavobacterium species 4H и получена плазмида pFsp4HI1, в которой все последовательности 5’GCNGC-3’ метилированы с образованием сайтов 5’-G(5mC)NGC-3’/3’CGN(5mC)G-5’.

2. В результате скрининга бактерий из различных природных изолятов на наличие ферментов, расщепляющих ДНК плазмиды pFsp4HI1, выявлен штамм Bacillus subtilis Т30 – продуцент 5mC-зависимой сайт-специфической ДНКэндонуклеазы BisI, узнающей и расщепляющей последовательность 5’G(5mC)NGC-3’/3’-CGN(5mC)G-5’ и не расщепляющей неметилированную ДНК.

3. Определены культурально-морфологические и физиолого-биохимические характеристики штамма-продуцента 5mC-зависимой сайт-специфической ДНК-эндонуклеазы. Установлены оптимальная температура (30°С) и рН среды (7,0-7,2) для культивирования бактериальных клеток.

4. Предложен метод аффинной очистки эндонуклеазы BisI на ДНК-сорбенте, содержащем иммобилизованные олигонуклеотиды. С помощью последовательных хроматографических стадий очистки получен препарат ДНК-эндонуклеазы BisI с активностью 500 ед/мл, свободный от примесей нуклеаз и фосфатаз. Определены оптимальные условия гидролиза ДНК ферментом BisI: температура 37°С; pH 9,0; концентрация моновалентных ионов (KCl) 150 мМ.

5. Установлено, что BisI расщепляет последовательность ДНК 5’-G(5mC)NGC3’/3’-CGN(5mC)G-5’ в строго фиксированной позиции, как показано стрелкой.

6. Показано, что фермент BisI способен расщеплять различные варианты метилированной последовательности 5’-GCNGC-3’/3’-CGNCG-5’, в которой меняется как количество, так и положение 5-метилцитозинов. Наиболее эффективно расщепляется последовательность 5’-G(5mC)NGC-3’/3’CGN(5mC)G-5’, которая является каноническим сайтом узнавания BisI.

7. На основании способности BisI расщеплять полуметилированный сайт узнавания 5’-G(5mC)NGC-3’/3’-CGNCG-5’ предложена схема использования эндонуклеазы BisI для сайт-специфического расщепления протяженных неметилированных молекул ДНК, и экспериментально показана применимость данной схемы на практике.

СПИСОК ПУБЛИКАЦИЙ 1. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Чернухин В.А., Охапкина С.С., Гончар Д.А., Дедков В.С., Абдурашитов М.А., Дегтярев С.Х. 2007.

Клонирование генов, сравнительный анализ структуры белков системы рестрикции-модификации Fsp4HI и биохимическая характеристика рекомбинантной ДНК-метилтрансферазы M.Fsp4HI. Молекулярная биология, т. 41, № 1, с. 43-50.

2. Дегтярев С.Х., Чмуж Е.В., Абдурашитов М.А., Каширина Ю.Г., Дедков В.С., Томилова Ю.Э., Мезенцева Н.В., Гончар Д.А. Штамм бактерий Bacillus subtilis - продуцент эндонуклеазы рестрикции BisI. Патент РФ №2270859 C1, опубл. 27.02.2006, Бюл. № 6.

3. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Гончар Д.А., Абдурашитов М.А., Дегтярев С.Х. 2005. Новая эндонуклеаза рестрикции Bis I из Bacillus subtilis Т30 узнаёт метилированную последовательность ДНК 5’-G(5mC)NGC-3’.

Биотехнология, № 3, с. 22-26.

ТЕЗИСЫ МАТЕРИАЛОВ КОНФЕРЕНЦИЙ 1. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Гончар Д.А., Абдурашитов М.А., Дегтярёв С.Х. 2005. Материалы 1-й Международной научно-практической конференции «Медбиотек2005», Москва, с. 128-129.

2. Землянская Е.В., Дегтярев С.Х. 2012. Материалы научной конференции «Биология – наука XXI века», Москва, с. 292-294.

БЛАГОДАРНОСТИ Автор выражает благодарность сотрудникам ООО «СибЭнзайм» к.б.н. Гончару Д.А. за помощь в клонировании генов, к.б.н. Абдурашитову М.А. за помощь в компьютерном анализе аминокислотных и нуклеотидных последовательностей, к.б.н.

Дедкову В.С. за помощь в проведении микробиологических исследований, к.б.н.

Чернухину В.А. за помощь в экспериментальной работе и ценные замечания. Автор также благодарит Каширину Ю.Г. за помощь в выделении ферментов, Томилову Ю.Э.

и Болтенгаген А.А. за помощь в экспериментальной работе.

СПИСОК СОКРАЩЕНИЙ МД-эндонуклеаза – метилзависимая сайт-специфическая ДНК-эндонуклеаза ЭР – эндонуклеаза рестрикции Система РМ – система рестрикции-модификации 5mC – С5-метилцитозин 4mC – N4-метилцитозин нт. – нуклеотид п.н. – пары нуклеотидов т.п.н. – тысяча пар нуклеотидов SAM – S-аденозил-L-метионин Трис – трис-(гидроксиметил)аминометан АТФ – аденозинтрифосфат ОРТ – открытая рамка трансляции




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.