WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

ФАДЕЕВА Алевтина Викторовна

Молекулярно-генетический анализ штаммов Vibrio cholerae неО1/неО139

03.02.03 микробиология

Автореферат

диссертации на соискание учёной степени

кандидата биологических наук

Саратов 2012

Работа выполнена в Федеральном казенном учреждении здравоохранения «Российский научно-исследовательский противочумный институт «Микроб»  Федеральной службы по надзору  в  сфере защиты  прав потребителей и благополучия человека

Научный руководитель:

доктор биологических наук,

старший научный сотрудник       Ерошенко Галина Александровна

Официальные оппоненты:

Викторов Дмитрий Викторович – доктор биологических наук, ФКУЗ «Волгоградский научно-исследовательский  противочумный  институт»  Роспотребнадзора, заведующий отделом биохимии и физиологии возбудителей особо опасных инфекций

Микшис Наталья Ивановна – доктор медицинских наук, ФКУЗ «Российский научно-исследовательский противочумный институт «Микроб»  Роспотребнадзора, ведущий научный сотрудник лаборатории прикладной генетики

Ведущая организация:

ФКУЗ «Ростовский-на-Дону научно-исследовательский противочумный институт» Роспотребнадзора

Защита состоится «18»_декабря 2012 г. в 13.00 часов на заседании совета Д 208.078.01 по защите диссертаций на соискание ученой степени кандидата наук, на соискание ученой степени доктора наук при ФКУЗ «Российский научно-исследовательский противочумный институт «Микроб» Роспотребнадзора (410005, г. Саратов, ул. Университетская, д. 46).

С диссертацией можно ознакомиться в научной библиотеке ФКУЗ «Российский научно-исследовательский противочумный институт «Микроб».

Автореферат разослан «___»______________2012 г.

Ученый секретарь диссертационного совета

доктор биологических наук,

старший научный сотрудник  Слудский А.А.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы

Холера продолжает оставаться одной из наиболее важных социально-значимых инфекций и представляет серьезную проблему для мирового здравоохранения, требующую постоянного и всестороннего контроля и интегрированного подхода к ее решению. Наряду с ростом заболеваемости типичной холерой, этиологическими агентами которой  являются холерные вибрионы Vibrio cholerae O1 и О139 серогрупп [Москвитина Э.А. с соавт., 2012; Cholera, Wkly.Epid.Rec., 2011], в различных регионах мира все чаще регистрируются множественные случаи и вспышки острых кишечных инфекций, вызываемых представителями других серогрупп. К настоящему моменту известно более двухсот серогрупп холерных вибрионов, отличающихся по структуре О-боковых цепей основного соматического антигена [Онищенко Г.Г. с соавт., 2001; Beltran P. et al., 1999]. Патогенный и эпидемический потенциал холерных вибрионов неО1/неО139 серогрупп остается малоисследованным. Известны случаи, когда эти вибрионы явились причиной крупных вспышек холероподобных инфекций, таких как произошедшие в Судане и Чехословакии в 1968 г., в Перу в 1994 г., в Индии в 1996 г. [Aldova E. et al., 1968; Dalsgaard A. et al., 1995; Rudra S. et al., 1996; Faruque S.M. et al., 1998]. Чаще патогенные вибрионы неО1/неО139 серогрупп вызывают небольшие локальные вспышки кишечных инфекций или отдельные случаи гастроэнтеритов, септицемий, кожных и других болезней [Rivera I.N.G. et al., 2001; Ottaviani D. et al., 2011]. Аналогичные случаи, обусловленные V. cholerae неО1/неО139  регистрируются и в Российской Федерации – в Поволжском регионе (в Астраханской, Саратовской, Самарской, Нижегородской областях, Калмыкии, Башкирии, Мордовии), других регионах России (в Ростовской, Челябинской, Пермской областях) и в ближнем зарубежье (в Узбекистане, Туркмении, Украине) [Онищенко Г.Г. с соавт., 2001]. В то же время свойства штаммов V.cholerae неО1/неО139, выделенных на этих территориях, исследованы лишь фрагментарно. В литературе имеется ограниченное число публикаций по фенотипическим и генетическим особенностям штаммов V.cholerae неО1/неО139, в том числе и по изучению распространения у них основных и дополнительных факторов патогенности, характерных для традиционных возбудителей холеры О1 и О139 серогрупп. Практически отсутствуют данные по изучению организации геномов штаммов V.cholerae неО1/неО139, выделенных на территории Поволжского региона России. Остаются не вполне ясными механизмы патогенности вибрионов неО1/неО139 серогрупп, лишенных, как правило, генетических детерминант основных факторов вирулентности - генов холерного токсина (ХТ) ctxAB и токсин-корегулируемых пилей адгезии (ТКПА) tcpA. Их выявление представляет собой важную задачу, в том числе и для практического здравоохранения. Лишь отчасти исследовано у холерных вибрионов различных серогрупп распространение генов патогенности, таких

как различные токсины и факторы колонизации, системы секреции разных типов [Монахова Е.В., 2012; Ghosh C. et al., 1997]. Предполагается, что штаммы неО1/неО139 серогрупп являются природными резервуарами генов факторов патогенности, которые они могут передавать другим холерным вибрионам [Chatterjee S. et al., 2009]. Особый интерес представляет изучение токсигенных штаммов V.cholerae неО1/неО139, способных к продукции основных факторов вирулентности – ХТ и ТКПА. Исследование таких штаммов необходимо для получения ответа на вопрос о механизмах образования вирулентных штаммов V.cholerae различных серогрупп и определения наиболее вероятных путей формирования новых опасных вариантов V.cholerae, которые могут оказаться способными к эпидемическому распространению и представить значительную проблему в связи с отсутствием специфических средств диагностики и профилактики вызываемой ими инфекции.

Цель работы

Определение распространения генов факторов патогенности и персистенции и проведение их структурно-функционального анализа у штаммов Vibrio cholerae неО1/неО139 серогрупп.

Задачи исследования

       1. Получить комплексную фенотипическую характеристику штаммов V.cholerae неО1/неО139, выделенных в Российской Федерации, в ближнем и дальнем зарубежье, на основе анализа данных по их культурально-морфологическим, биохимическим, серологическим свойствам и по антибиотикоустойчивости. 

       2. Определить распространение генов основных и дополнительных факторов вирулентности возбудителя холеры у вибрионов неО1/неО139 серогрупп, выделенных в Поволжском и других регионах Российской Федерации и на территории пограничных государств в периоды различных эпидемических ситуаций.

       3. Установить генетические особенности штаммов V.cholerae неО1/неО139, изолированных на эндемичных по холере территориях в Юго-Восточной Азии.

       4. Провести генетический анализ токсигенных вибрионов неО1/неО139 серогрупп, выделенных в Узбекистане и Юго-Восточной Азии. Установить молекулярные механизмы их формирования.

       5. Определить распространение у штаммов V.cholerae неО1/неО139 генов систем секреции третьего и шестого типов, генов некоторых токсинов. Разработать способ детекции различных вариантов структурного гена токсинкорегулируемых пилей адгезии tcpA у холерных вибрионов разных серогрупп и выявить с его помощью новые аллели этого гена.

       6. Разработать способ определения генетического родства штаммов холерных вибрионов различных серогрупп на основе вариабельности генов gmhD, orf2 и rjg, фланкирующих кластер генов биосинтеза О-антигена.

Научная новизна работы

Получена комплексная фенотипическая и генетическая характеристика штаммов V.cholerae неО1/неО139, выделенных на территории Поволжского и других регионов Российской Федерации, а также в ближнем зарубежье. Выявлен ряд антибиотикоустойчивых (к стрептомицину, ампициллину, канамицину, сульфаметаксазолу и тетрациклину) штаммов холерных вибрионов неО1/неО139 серогрупп, циркулирующих на эндемичных по холере территориях.

Впервые установлено, что в геноме большинства штаммов V.cholerae неО1/неО139, выделенных в Поволжском регионе, как и в других регионах Российской Федерации, отсутствуют гены основных факторов патогенности – ХТ и ТКПА, а также гены островов патогенности VPI, VPI-2; пандемичности VSP-I, VSP-II; коньюгативных транспозонов. В тоже время показано, что в коровой части хромосомы всех этих штаммов содержатся гены hapA, rtxA, hlyA, кодирующие биосинтез факторов патогенности – гемагглютинин/протеазы, мультифункционального автопроцессируемого токсина RTX, гемолизина/цитолизина. Показано, что холерные вибрионы неО1/неО139 серогрупп, выделенные в эпидемически значимые периоды, а также циркулирующие на эндемичных территориях, содержат большее число генов патогенности, что указывает на потенциальную опасность этих штаммов. Впервые проведено развернутое исследование генетической организации токсигенных штаммов неО1/неО139 серогрупп, выделенных в Узбекистане. Установлено, что они имеют уникальный состав генов факторов патогенности и содержат новые аллели этих генов, не встречающиеся у эпидемических штаммов О1 и О139 серогрупп, что подтверждает принадлежность этих штаммов к независимым линиям эволюции вирулентных V.cholerae.

Впервые разработана ПЦР с универсальными праймерами, обеспечивающая детекцию различных вариантов структурного гена tcpA ТКПА, и выявлены новые аллели этого гена у штаммов V.cholerae неО1/неО139. Установлено, что в геноме 30% холерных вибрионов неО1/неО139 серогрупп, выделенных в Российской Федерации и за рубежом, содержатся гены системы секреции третьего типа (СС3Т), и в геномах всех штаммов – системы секреции шестого типа (СС6Т), которые могут отвечать за патогенные свойства этих вибрионов. Впервые разработан эффективный способ определения генетического родства штаммов V.cholerae различного происхождения, основанный на вариабельности генов gmhD, orf2 и rjg, фланкирующих кластер генов О-антигена. Приоритетность разработки подтверждена получением патента на изобретение «Способ определения генетического родства холерных вибрионов различных серогрупп методом секвенирования генов, фланкирующих кластер генов биосинтеза О-антигена» (Патент RU №2393231). С помощью этого метода впервые установлено, что штаммы V.cholerae, имеющие клональное происхождение, могут относиться к различным серогруппам, что свидетельствует о наличии механизма изменения серогрупповой принадлежности, не связанного с горизонтальным переносом генов кластера О-антигена.

Практическая значимость работы

По результатам работы оформлены и утверждены методические рекомендации «Способ определения генетического родства штаммов холерных вибрионов методом секвенирования генов, фланкирующих кластер генов биосинтеза О-антигена», утвержденные директором института 12 декабря 2008 г. Разработаны методические рекомендации «Детекция различных вариантов гена tcpA токсин-корегулируемых пилей адгезии возбудителя холеры в ПЦР с универсальными праймерами», утвержденные директором института 20 апреля 2012 г. Полученные данные молекулярно-генетического анализа V.cholerae неО1/неО139 используются для паспортизации штаммов  ГКПБ при РосНИПЧИ «Микроб». В ГКПБ депонирован Vibrio cholerae КМ227, в качестве модельного штамма холерного вибриона неО1/неО139 серогруппы, содержащего в геноме остров пандемичности VSP-II, SXT элемент и гены СС3Т и СС6Т и рекомендуемого для изучения роли этих генетических элементов в патогенности холерных вибрионов. Полученные в ходе выполнения работы данные по генетической организации штаммов V.cholerae неО1/неО139 используются при чтении лекций на курсах «ПЦР в диагностике инфекционных болезней и индикации патогенных микроорганизмов» при РосНИПЧИ «Микроб».

Положения, выносимые на защиту

1. Штаммы V.cholerae неО1/неО139 серогрупп, выделенные в Поволжском и других регионах Российской Федерации, как правило, не содержат генов ctxA и tcpA основных факторов патогенности – холерного токсина и токсинкорегулируемых пилей адгезии, но несут гены hapA биосинтеза гемагглютинин/протеазы, rtxA мультифункционального автопроцессируемого токсина RTX, hlyA гемолизина/цитолизина. В геномах 30% этих штаммов присутствуют гены системы секреции третьего типа, и у всех штаммов содержатся гены системы секреции шестого типа. Сочетанное действие этих факторов может обеспечивать патогенность штаммов V.cholerae неО1/неО139.

2. Холерные вибрионы неО1/неО139 серогрупп, выделенные в эпидемически значимые периоды, а также циркулирующие на эндемичных территориях, содержат большее число генов патогенности, что делает их потенциально опасными штаммами, а также природными резервуарами этих генов.

3. Токсигенные штаммы неО1/неО139 серогрупп имеют уникальный состав генов факторов патогенности, не встречающийся в таком сочетании у эпидемических штаммов О1 и О139 серогрупп. Значительные отличия в нуклеотидных последовательностях их генов от эпидемических изолятов V.cholerae свидетельствуют о принадлежности большинства изученных токсигенных штаммов неО1/неО139 серогрупп к независимым линиям эволюции токсигенных холерных вибрионов.

4. Впервые на основе использования вариабельности генов gmhD, orf2 и rjg, фланкирующих кластер генов биосинтеза О-антигена, установлено, что штаммы V.cholerae неО1/неО139, имеющие клональное происхождение, могут относиться к различным серогруппам, что подтверждает наличие у них механизма изменения серогрупповой принадлежности, не связанного с горизонтальным переносом генов кластера О-антигена.

Апробация работы

Материалы работы доложены на 10-ой Всероссийской медико-биологической конференции молодых исследователей «Человек и его здоровье», Санкт-Петербург, 2007; VI Всероссийской научно-практической конференции «Молекулярная диагностика – 2007», Москва, 2007; заседаниях проблемной комиссии «Холера и патогенные для человека вибрионы» Межведомственного научного совета по санитарно-эпидемиологической охране территории Российской Федерации, Ростов-на-Дону, 2008, 2009, 2011 гг.; 3-ей научно-практической школе-конференции молодых ученых и специалистов «Современные технологии обеспечения биологической безопасности», Оболенск, 2011;  IV ежегодном Всероссийском конгрессе по инфекционным болезням, Москва, 2012 г.; X съезде Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов, Москва, 2012 г.; итоговых конференциях РосНИПЧИ «Микроб», 2009 г., 2012 г.

Публикации

По теме диссертации опубликовано 12 работ, из них 4 в периодических изданиях из «Перечня ведущих рецензируемых научных журналов, рекомендованных ВАК Министерства образования и науки России».

Структура и объём диссертации

Диссертация представлена на 170 страницах текста, состоит из введения, главы обзора литературы, шести глав собственных исследований (в том числе, одной главы с описанием материалов и методов), заключения и выводов. Работа иллюстрирована 18 таблицами и 19 рисунками. Библиографический указатель содержит 198 отечественных и зарубежных источников.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы

В работе использовано 305 штаммов V.cholerae О1, О139 и неО1/неО139 серогрупп, выделенных от больных людей c острыми кишечными инфекциями, гастроэнтеритами различной степени тяжести, а также из водоемов в Поволжском и других регионах Российской Федерации, в ближнем (Узбекистан, Туркмения, Украина) и дальнем (Индия, Филиппины, Пакистан, Бангладеш) зарубежье. Культивирование штаммов холерных вибрионов проводили в бульоне и агаре Хоттингера, рН 7,6, а также на LB агаре и в LB бульоне при 37 оС в течение 18-24 часов. Изучение культурально-морфологических свойств, определение оксидазной, декарбоксилазной, фосфолипазной, протеолитической, гемолитической активности, способности к ферментации углеводов, подвижности, чувствительности культур V.cholerae к холерным фагам, определение серогрупповой принадлежности  проводили, как это указано в «Практическом руководстве по лабораторной диагностике возбудителей опасных инфекционных болезней» [2009] и в МУК 4.2.2218-07 «Лабораторная диагностика холеры». Чувствительность к антибиотикам определяли на чашках с LB агаром c добавлением антибиотиков в следующих концентрациях: ампициллин – 50 мкг/мл, канамицин – 50 мкг/мл, тетрациклин – 10 мкг/мл, стрептомицин – 25 мкг/мл, хлорамфеникол – 25 мкг/мл, триметоприм – 25 мкг/мл, сульфаметоксазол – 25-100 мкг/мл. 

Выделение ДНК штаммов V.cholerae осуществляли стандартным методом с помощью лизирующего раствора на основе 6М гуанидинтиоизоцианата. Продукты ПЦР анализировали методом электрофореза в 0,8 – 2% агарозных гелях, а определение нуклеотидной последовательности продуктов амплификации осуществляли на генетическом анализаторе модели “CEQ 8000” (Beckman Coulter). Сравнительный анализ нуклеотидных последовательностей штаммов V.cholerae проводили с помощью алгоритма BLAST базы данных NCBI GenBank. Построение дендрограмм выполняли с помощью компьютерных программ Mega 5.0 с использованием дистанционно-матричного метода UPGMA и BioNumerics 6.6 (Appl. Maths, Belgium) с категорическим коэффициентом.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ

1. Анализ фенотипических свойств штаммов V.cholerae неО1/неО139

Для получения комплексной фенотипической характеристики штаммов V.cholerae неО1/неО139 серогрупп нами была изучена коллекция из 270 таких изолятов. Проведено исследование штаммов, выделенных в Поволжском регионе – в Астраханской, Саратовской, Самарской, Ульяновской областях, в Калмыкии, Башкирии, Мордовии, в других регионах – в  Ростовской, Пермской, Оренбургской и других областях, а также в ближнем и дальнем зарубежье. При этом были обобщены  сведения, представленные в паспортах этих штаммов, а также получены дополнительные характеристики, отсутствующие в паспортных данных. Проведенный сравнительный анализ культурально-морфологических, серологических и биохимических свойств штаммов V.cholerae различных серогрупп, относящихся к О2-О39 серогруппам (коллекция Р.Саказаки); к О41, О42, О45, О47, О48, О49, О50, О51, О52, О54 серогруппам, выделенным в России; к О9, О15, О22, О28, О43, О62, О74, О84 серогруппам, изолированным в Узбекистане, а также большого числа штаммов неидентифицированных серогрупп, выявил биохимическую однородность этих штаммов, которая не зависела от их серогрупповой принадлежности и от региона выделения. Штаммы V.cholerae неО1/неО139, изолированные в Поволжском регионе, в ближнем  и  дальнем зарубежье, практически не отличались по биохимической  активности. Все они были оксидазопозитивны, ферментировали глюкозу и маннит до кислоты, а также – сахарозу и маннозу, декарбоксилировали лизин и орнитин, не были способны к дегидрированию аргинина. Не выявлено существенных различий в фенотипических свойствах между нетоксигенными штаммами неО1/неО139 серогрупп и токсигенными штаммами неО1/неО139 серогрупп различного происхождения. В отличие от штаммов V.cholerae О1 серогруппы вибрионы неО1/неО139 серогрупп не лизировались фагами «С» и «эльтор», не агглютинировались сыворотками О1, Огава, Инаба. Гемолитическая активность была характерна для значительного большинства холерных вибрионов неО1/неО139 серогрупп. Выборочное исследование 33 штаммов V.cholerae неО1/неО139 различного происхождения показало, что все они являются прототрофами. Анализ 35 штаммов, изолированных в Астраханской, Ростовской областях, в Калмыкии, в Узбекистане и в Юго-Восточной Азии  выявил наличие среди них шести штаммов, резистентных к различным антибиотикам: к сульфаметаксазолу, стрептомицину, ампициллину, канамицину, тетрациклину. Все шесть антибиотикоустойчивых штаммов были изолированы в Юго-Восточной Азии, что позволяет предположить достаточно широкое распространение у штаммов V.cholerae неО1/неО139, циркулирующих на эндемичных по холере территориях, генов антибиотикорезистентности. Среди 20 выборочно исследованных изолятов, выделенных в различных регионах России и сопредельных стран, антибиотикоустойчивых штаммов не выявлено.

2. Анализ молекулярно-генетических особенностей штаммов холерных вибрионов неО1/неО139 серогрупп, выделенных на территории России и за рубежом

Для определения генетических особенностей штаммов V.cholerae неО1/неО139, выделенных от больных людей и из воды на территории Российской Федерации и в пограничных странах в периоды различных эпидемических ситуаций, нами осуществлен масштабный анализ распространения у них генов основных факторов патогенности – ХТ и ТКПА, других генов, расположенных на островах патогенности VPI и VPI-2, пандемичности VSP-I, VSP-II и конъюгативных транспозонах SXT. Впервые проведен анализ генетических свойств штаммов V.cholerae неО1/неО139, выделенных в Поволжском регионе – в Астраханской, Саратовской, Самарской, Ульяновской областях, в Калмыкии, Башкирии, Мордовии. На этих территориях часто регистрируются случаи болезней, вызываемых холерными вибрионами неО1/неО139 серогрупп, в том числе такие вибрионы постоянно выделяются в Нижнем Поволжье – в Астраханской области от людей с различными формами гастроэнтеритов и острых кишечных инфекций неясной этиологии. Проведенный ПЦР анализ 45 штаммов V.cholerae, выделенных в Астраханской области в период между 1976 г. и 2005 г. от больных и из внешней среды, по генам основных и дополнительных факторов патогенности ctxA, zot и ace (фаг CTX), rstC (фаг RS1); tcpA, aldA, toxT (VPI); nanH (VPI-2), VCO180 (VSP-I), VCO502, VCO514 (VSP-II), TLC, intSXT (SXT) не выявил наличия в геноме астраханских штаммов генов ctxA, zot, ace, кодируемых фагом CTX, а также rstC (активатора транскрипции генов ctxAB) фага RS1. Только у одного из изученных штаммов – клинического изолята V.cholerae 14520 серогруппы О41, выделенного в Астрахани в 1976 г., обнаружены гены VPI:  ген ТКПА tcpAСlass, транскрипционных регуляторных белков TcpP/H – tcpP/H, альдолазы – aldA. В геноме штамма V.cholerae 14520 также присутствовала последовательность attRS, которая является сайтом специфической интеграции фага CTX в хромосому, и ген VPI-2 nanH нейраминидазы, вносящей определенный вклад в патогенез заболеваний, вызываемых холерными вибрионами.

Остальные штаммы неО1/неО139 серогрупп, выделенные в Астраханской области, генетических маркеров VPI и VPI-2 не имели. Ни у одного из штаммов, включая и штамм 14520, не выявлены VSP-I, VSP-II, SXT. Однако все эти штаммы содержали расположенные в коровой части генома  гены toxR, hapA, rtxA, hlyA. Комплексное действие кодируемых этими генами факторов патогенности  может обусловливать патогенные свойства штаммов неО1/неО139 серогрупп. В геноме многих астраханских штаммов детектируются гены mshA/Q, кодирующие синтез гемагглютинирующих пилей адгезии MSHA, которые играют важную роль на начальных этапах образовании биопленки холерными вибрионами, а также, по мнению некоторых авторов, могут принимать участие в колонизации кишечника макроорганизма.

По аналогичному алгоритму, использованному для штаммов V.cholerae неО1/неО139 из Астраханской области, проведен анализ генетических свойств холерных вибрионов, полученных в других областях Поволжского и других регионов России, а также в ближнем зарубежье в период с 1968  по 2005 гг. Как показал проведенный ПЦР анализ, подавляющее большинство изученных штаммов лишено профагов CTX и RS1, а также островов  патогенности VPI и VPI-2 с генами tcpA, tcpP/H, toxT, aldA и nanH. У них отсутствуют острова пандемичности VSP-I, VSP-II и конъюгативный транспозон SXT. Однако у всех изученных штаммов в хромосоме выявлены гены toxR, hapA, rtxA, hlyA. У значительного числа штаммов присутствуют mshA/Q, а у части штаммов выявлена последовательность attRS. В геноме лишь двух штаммов О49 и О41 серогрупп, выделенных в Ростовской области в эпидемически значимый период в 1974 и в 1976 гг., присутствуют гены VPI – tcpA, toxT, aldA. Один из этих штаммов содержит ген tсpAСlass, характерный для вирулентных штаммов О1 серогруппы классического биовара, а другой – ген tcpA типа эльтор. Генов острова патогенности VPI-2, пандемичности VSP-I, VSP-II и SXT элемента у этих штаммов не выявлено. У штамма V.cholerae Р-8845 серогруппы О50, изолированного в Ростовской области в 1974 г., обнаружено наличие генов VCO502, VCO514  (VSP-II)  и intSXT (SXT). Дальнейший анализ SXT элемента, показал, что в его составе отсутствуют гены strB, dfr18 и sulII, что коррелирует с отсутствием у этого штамма устойчивости к стрептомицину, триметоприму и сульфаметаксазолу. В то же время у него детектируется интактный оперон rumAB, наличие которого доказывает отсутствие внедрения в него сложной транспозоноподобной структуры с генами антибиотикоустойчивости, характерной для большинства SXT транспозонов, или КОНСТИНОВ. По-видимому, SXT элемент, присутствующий у штамма Р-8845, является «антибиотикочувствительным» (rumAB+) предшественником SXT КОНСТИНОВ и может быть использован для изучения роли этих элементов в эволюции патогенных вибрионов.

В целом проведенный анализ 270 штаммов V.cholerae неО1/неО139, выделенных в Российской Федерации и некоторых пограничных странах, не выявил наличия у них генов ХТ и, следовательно, эти штаммы должны быть отнесены к неэпидемическим штаммам V.cholerae. Однако на этих территориях в эпидемически значимые периоды встречаются штаммы, которые содержат другие гены патогенности, такие, как tcpA, toxT, aldA, tcpP/H (VPI), nanH (VPI-2), гены острова пандемичности VSP-II, SXT, attRS. Наличие этих генов свидетельствует о потенциальной опасности таких штаммов. По-видимому, в эпидемически неблагополучные по холере периоды происходит обогащение локальных популяций холерных вибрионов генами вирулентности за счет глобального распространения штаммов V.cholerae с полным их набором и последующего горизонтального переноса этих генов с помощью МГЭ в неэпидемические штаммы V.cholerae различных серогрупп.

Для изучения свойств штаммов V.cholerae неО1/неО139, циркулирующих на эндемичных по холере территориях, и сравнения генетических особенностей штаммов различного происхождения была исследована коллекция Р.Саказаки [1970], состоящая из 38 штаммов V.cholerae О2–О39 серогрупп, выделенных в Юго-Восточной Азии (Индия, Филиппины) в 1962-1969 гг. Проведенный ПЦР анализ этих штаммов по более, чем двадцати генам патогенности и персистенции показал, что в их геноме содержится достаточно большое число генов факторов патогенности, которые выявляются в различных сочетаниях. Только один штамм 1322-69 серогруппы О37 был токсигенным и включал практически полный набор генов патогенности: ctxA, zot, аce, rstC, TLC, tcpA, tcpP/H, toxT, aldA и nanH, гены msh. В то же время у него отсутствовали VSP-I, VSP-II и SXT. Остальные штаммы были лишены генов ctxA, zot, аce, rstC, но достаточно большая часть из них несла гены ТКПА. Наличие генов tcpA классического типа выявлено нами у штаммов V.cholerae О2, О14, О18, О20, О25 серогрупп, а генов tcpA типа эльтор – у штаммов О10, О17, О19, О27, О31 серогрупп. Практически у всех tcpA-содержащих штаммов присутствовали другие гены острова патогенности VPI – toxT и  aldA. Некоторые штаммы содержали ген nanH острова VPI-2. У пяти штаммов в геноме присутствовал ген VCO180 острова VSP-I, а у четырех штаммов – ген VCO502 острова VSP-II. В геноме двух штаммов 5473-62 (О31) и 1311-69 (О35) содержался ген интегразы intSXT, свидетельствовавший о наличии у них SXT элемента. У штамма 1311-69 выявлен также ген sulII устойчивости к сульфаметаксазолу, что совпадало  с наличием у него резистентности к этому антибиотику. У штамма 5473-62 гены устойчивости к антибиотикам отсутствовали, но у него выявлялся интактный оперон rumАВ, аналогичный этому оперону у описанного выше SXT элемента штамма Р-8845. У ряда других штаммов, несмотря на отсутствие у них SXT элемента, присутствовали гены устойчивости к отдельным антибиотикам, которые, по-видимому, кодировались другими МГЭ. Геномы всех 38 штаммов из коллекции Р.Саказаки содержали гены коровой части хромосомы – toxR, hapA, rtxA и hlyA. Из полученных данных следует, что штаммы V.cholerae неО1/неО139 серогрупп, изолированные в период начала 7-ой пандемии холеры на территории Юго-Восточной Азии имели достаточно широкий набор генов факторов патогенности, кодируемых VPI, VPI-2, VSP-I, VSP-II, SXT и другими МГЭ. Состав генов патогенности отличается у них от состава эпидемических штаммов О1 и О139 серогрупп. Это означает, что они не являются производными последних, а, вероятно, произошли от авирулентных штаммов в результате горизонтального переноса в их геном различных МГЭ с генами патогенности. Данные проведенного нами RAPD ПЦР типирования со случайными праймерами показали, что штаммы V.cholerae неО1/неО139  из коллекции Р.Саказаки имеют различные профили амплификации, отличные друг от друга и от вирулентных штаммов О1 и О139 серогрупп. Из этого следует, что изученные штаммы неО1/неО139 серогрупп представляют собой независимые филогенетические линии эволюции холерных вибрионов. Они являются природными резервуарами генов патогенности и потенциально опасными штаммами.

3. Генетическая характеристика токсигенных штаммов V.cholerae неО1/неО139, выделенных в Узбекистане

При исследовании штаммов V.cholerae неО1/неО139 различного происхождения нами была изучена группа из 22 токсигенных штаммов, выделенных в Узбекистане в 1971, 1986, 1987 и 1990 гг. На территории этой страны на протяжении нескольких последних десятилетий выделяются токсигенные V.cholerae О1 и не О1 серогрупп. До сих пор свойства этих штаммов остаются малоисследованными, и неясно их филогенетическое положение относительно других холерных вибрионов. Большинство изученных нами токсигенных штаммов V.cholerae неО1/неО139 выделено в летне-осенний период в 1990 г. на территории сразу нескольких регионов Узбекистана, что свидетельствует о достаточно широком распространении таких штаммов в то время. Отличительная особенность этих штаммов заключалась в том, что они относились к разным – О9, О15, О28, О74, О84 и не идентифицированным серогруппам, что на первый взгляд свидетельствовало об отсутствии у них клонального происхождения. Как показал проведенный ПЦР анализ, все 22 штамма содержали гены ctxA, zot, ace, rstC, toxT, aldA, tcpP/H (таблица). Однако у штаммов V.cholerae неО1/неО139, выделенных в 1987-1990 гг., не было выявлено генов tcpAСlass или tcpAelt, хотя ген tcpАСlass присутствовал у штамма  КМ3 (1971 г.), а ген tcpAelt – у штаммов КМ159 (1986 г.) и Р16150 (1987 г.). Все изученные штаммы содержали гены nanH и mshA/Q. У штаммов 1987-1990 гг. присутствовал TLC элемент, локализованный рядом с генами ctxA, который отсутствовал у штаммов КМ3 и КМ159, выделенных ранее. У всех штаммов независимо от года выделения не были выявлены VSP-I, VSP-II, SXT. В их геномах содержалась инсерционная последовательность IS1358 и гены rjg, gmhD, orf2, фланкирующие кластер генов биосинтеза О-антигена. Таким образом, состав генов токсигенных штаммов, выделенных в Узбекистане, значительно отличался от такового токсигенных штаммов V.cholerae О1 серогруппы биовара эльтор и О139 серогруппы, так как у первых отсутствовали гены tcpAelt, VSP-I, VSP-II и SXT. От штаммов V.cholerae О1 классического биовара их отличало отсутствие гена tcpAСlass. Это позволяет предположить, что токсигенные узбекские штаммы не имеют клонального родства с эпидемическими  штаммами О1 и О139 серогрупп.

Секвенирование генов патогенности выявило наличие одной нуклеотидной замены в фрагменте гена ctxA размером 564 п.н. у штаммов КМ3 и КМ159, которая отсутствовала у штаммов, выделенных в 1987 г. и 1990 г. (таблица). В других генах патогенности – zot, ace, rstC, toxT у токсигенных узбекских штаммов присутствовало большое число замен по сравнению со штаммами О1 и О139 серогрупп, а также с другими штаммами, представленными в базе данных NCBI GenBank.

Таблица. Сравнение нуклеотидных последовательностей генов  вирулентности и жизнеобеспечения токсигенных штаммов V.cholerae неO1/неO139, выделенных в Узбекистане, с генами V.cholerae N16961 O1 биовара эльтор (NCBI GenBank)

Штаммы

(год выделения)

Количество нуклеотидных замен в секвенированных фрагментах генов, п.н.

ctxA

564*

zot

947

ace

316

rstC

245

toxT

934

Tlc

1548

tcpAClas/tcpAelt/

tcpAuzb 732

rjg

1328

gmhD

930

orf2

1350

1322-69 (1968)

1

0

2

0

0

0

130/-/-

21

47

49

КМ3 (1971)

1

0

5

6

12

130/0/-

26

27

44

КМ159 (1986)

1

10

2

5

9

-/0/-

30

38

41

Р16132, Р16134, Р16136, Р16139, Р16142, Р16152  (1987, 1990)

0

9

8

2,3

8

0

-/-/165

35

46

63

Р16150 (1987)

0

9

7

3

7

0

-/0/-

31

26

44

* размер секвенированного фрагмента

Из этого следует, что гены факторов патогенности токсигенных узбекских штаммов значительно отличаются от таковых пандемических штаммов V.cholerae O1 и О139 серогруппы и от штаммов других серогрупп  (таблица).  В том числе обнаружены две новые аллели гена zot,  три – ace, четыре – toxT. Это подтверждает сделанное выше на основании анализа состава генов предположение о том, что узбекские штаммы относятся к независимой линии эволюции токсигенных V.cholerae.

Для изучения филогенетического родства этих штаммов мы провели их типирование с помощью RAPD ПЦР и мультилокусного секвенирования.

Все штаммы 1990 г имели идентичные RAPD ПЦР профили, что подтверждает наличие клонального родства между ними, а штаммы КМ3, КМ159 и Р-16150 отличались по профилям RAPD ПЦР и не имели близкого родства со штаммами 1990 г. Построение филогенетического дерева с помощью программы Bionumerics 6.6 (Applied Maths, Belgium) выявило наличие отдельного кластера, представленного токсигенными штаммами из Узбекистана 1990 г. и штаммом Р16152 (рисунок 1).

Выше         нам не удалось выявить наличия генов tcpA классического и эльтор типов у штаммов неО1/О139 серогрупп из Узбекистана, однако, способность этих токсигенных вибрионов вызывать острые кишечные инфекции и наличие гена ctxA указывали на присутствие и гена tcpA, нуклеотидная последовательность которого, возможно, существенно отличалась от tcpAClass и tcpАelt.

Рисунок 1. Филогенетическое родство штаммов V.cholerae неО1/неО139, выделенных в Узбекистане в 1971-1990 гг., на основе вариабельности генов ctxA, zot, ace, toxT, tcpA. Maximum parsimony tree с категорическим коэффициентом с использованием программы Bionumerics 6.6 (Applied Maths, Belgium).

На основе компьютерного анализа нуклеотидных последовательностей генов tcpA у штаммов V.cholerae из NCBI GenBank нами выявлены консервативные участки ДНК, один из которых расположен в последовательности гена tcpA ближе к 5’ концу, кодирующему N-терминальную часть молекулы пилина TcpA, а второй высоко консервативный участок лежит за пределами этого гена и примыкает к гену tcpA с 3’ конца. Для детекции этих консервативных участков нами были сконструированы универсальные праймеры: tcpAuniv-S GAAGAACACGATAAGAAAAC и tcpAuniv-As CCTTGTTGGTATTTTCTCAT, и подобраны оптимальные условия проведения ПЦР. С их помощью нам удалось выявить наличие генов tcpA у токсигенных штаммов, выделенных в Узбекистане. В ПЦР у этих штаммов образовывались специфические амплификаты размером 732 п.н. Их секвенирование выявило наличие на вариабельном 3’ конце гена tcpA 165 нуклеотидных замен относительно штамма О1 серогруппы биовара эльтор N16961. Этот новый вариант гена был обозначен нами как tcpAuzb (таблица).

С помощью этой ПЦР с универсальными праймерами нам был проведен поиск новых вариантов гена tcpA у штаммов неО1/неО139 серогрупп, выделенных на территории других  регионов. (рисунок 2).

Наличие амплификатов, полученных с помощью универсальных праймеров (рисунок 2, А), и их отсутствие при использовании праймеров на гены tcpAclass и tcpelt (рисунок 2, Б) свидетельствовало о присутствии других вариантов этого гена. С помощью ПЦР с универсальными праймерами нами выявлены еще два штамма215-68

A

Б

Рисунок 2. ПЦР детекция различных вариантов генов tcpA у штаммов V.cholerae разных серогрупп с использованием универсальных праймеров (А) и праймеров на гены tcpAclass и tcpAelt (Б). Штаммы V.cholerae – Узбекистан: 1. P16132 (серогруппа O28, 1990), 2. Р16152 (O74, 1987); коллекция Саказаки: 3. 215-68 (О38), 4. 4711 (О2), 5. 180-68 (О23); 6. MO45 (O139, Индия, 1993), 7. Дакка 35 (O1 классический биовар, Бангладеш, 1958), 8. В-53-5 (O1 классический биовар, Индия, 1962), 9. 4А (O1 биовар эльтор, Индия, 1963), 10. Т23 (O1 биовар эльтор, Индия, 1962), 11. Р-8845 (O50, Россия, 1974), 12. отрицательный контроль.

(серогруппы О38) и 180-68 (О23) из  коллекция Р.Саказаки, которые также содержали новые варианты гена tcpA. В целом с помощью разработанной ПЦР среди 138 исследованных штаммов V.cholerae неО1/неО139 (включая токсигенные штаммы из Узбекистана) выявлен 21 штамм (16% от числа изученных), содержащий гены tcpA, отличные от tcpAclass и tcpАelt. Следовательно, разработанная ПЦР позволяет более эффективно выявлять разные варианты гена tcpA у штаммов холерных вибрионов различных серогрупп.

Для установления причин вариабельности серогрупповой принадлежности токсигенных узбекских штаммов мы провели секвенирование у них фрагментов генов gmhD, orf2 и rjg, фланкирующих кластер wb* биосинтеза О-антигена (таблица). В секвенированном фрагменте (1328 п.н.) гена rjg у всех штаммов 1990 г. содержалось одинаковое число замен – 35, относительно штамма N16961 (NCBI GenBank), а у других токсигенных штаммов из Узбекистана оно составляло от 21 до 31 замен. Фрагмент гена gmhD размером 930 п.н. у штамма Р16152  и у всех штаммов 1990 г. содержал 37 замен, в то время как у других штаммов число замен колебалось от  27 до 47. В фрагменте гена orf2 1350 п.н. у штамма Р16152 и штаммов 1990 г. присутствовало 63 замены нуклеотидов, а у других штаммов их количество составляло от 41 до 44 замен. Таким образом, протяженные фрагменты генов gmhD, orf2 и rjg были идентичными у штаммов 1990 г. и штамма Р-16152 (1987 г.), что означает, что wb* кластер сформировался у них в результате единого рекомбинационного события, и что эти штаммы, несмотря на их принадлежность к различным серогруппам, имеют клональное происхождение. Из этого следует, что вариабельность последовательности wb* кластера и принадлежность к различным серогруппам вызвана у них не переносом генов О-антигена, а перестройками внутри кластера генов биосинтеза О-антигена. Возможно, эти перестройки обусловлены последовательностью IS1358, которая присутствует в этом кластере у всех 22 токсигенных узбекских штаммов различных серогрупп или другим пока не выявленным механизмом изменения кластера О-антигена. В любом случае полученные нами данные  позволяют предположить, что признанный в настоящее время механизм гомологичной рекомбинации не является единственным механизмом изменения серогрупповой принадлежности штаммов V.cholerae.

4. Анализ распространения генов систем секреции и термостабильного токсина у холерных вибрионов  различных серогрупп

Проведенный выше анализ V.cholerae неО1/неО139 показал, что у всех этих штаммов присутствуют гены hapA, rtxA, hlyA, комплексное действие продуктов которых может отвечать за патогенный потенциал этих вибрионов. Нами также проведен анализ распространения у штаммов V.cholerae различных серогрупп генов, ассоциируемых с патогенностью самих V.cholerae неО1/неО139, таких как гены системы секреции третьего (СС3Т) и шестого (СС6Т) типов, stn термостабильного токсина ST. Распространение генов СС3Т было изучено у 86 штаммов О1-О39, O41-O43, О50, О52, О56, О62, О74, О82, О84, О139 и неидентифицированных серогрупп, выделенных в период с 1962 по 2005 гг. на территории различных областей России, в ближнем зарубежье и в странах Юго-Восточной Азии. Детекцию кластера генов СС3Т проводили в ПЦР с праймерами на ряд генов этой системы – vcsC2, vcsN2, vcsV2, vspD [Dziejman M. et al., 2005]. Проведенный анализ распространения генов СС3Т у вирулентных штаммов О1 серогруппы  классического (4 штамма) и эльтор (4 штамма) биоваров, а также 7 вирулентных штаммов О139 серогруппы показал, что они не содержат ни одного из 4 генов - vcsC2, vcsN2, vcsV2, vspD (рисунок 3, дор.13-16). Не обнаружено генов СС3Т у токсигенного штамма 1322-69 серогруппы О37 из Юго-Восточной Азии и у 22 токсигенных штаммов из Узбекистана. Из этих данных следует вывод о том, что у токсигенных штаммов О1, О139 и других серогрупп СС3Т, как правило, не встречается, и, значит, она не вносит своего вклада в патогенность эпидемически значимых холерных вибрионов. У нетоксигенных холерных вибрионов неО1/неО139 серогрупп, напротив, кластер генов СС3Т достаточно широко распространен. Среди 48 изученных штаммов V.cholerae неО1/неО139 он присутствовал у 14 (рисунок 3, дор. 1-12). В число этих 14 штаммов входили три штамма из Саратовской области (1974, 1981 и 2002 гг.), четыре штамма из Ростовской области (1968, 1974 и 1976 гг.); один из Куйбышевской области (1983 г.), один из Башкирии (1976 г.), один из  Туркмении (1976 г.), один из Узбекистана (1968 г.), три из Юго-Восточной Азии (1960-е г.). Они относились к О9, О17, О41, О50, О85, О87 и неидентифицированным серогруппам. Это означает, что штаммы различных серогрупп, содержащие СС3Т, выделяются на различных территориях в разные годы. По всей видимости, штаммы V.cholerae неО1/неО139, содержащие СС3Т, могут использовать ее в качестве одного из факторов патогенности.

Нами также исследовано распространение СС6Т, гены которой были недавно обнаружено при секвенировании штамма холерного вибриона неО1/неО139 серогруппы. CC6Т или VAS система используется вибрионами для транслокации эффекторных белков в клетки-мишени макроорганизмов [Pukatzki S. et al., 2006]. Нами был проведен компьютерный анализ 18 генов СС6Т у штаммов V.cholerae, представленных в базе данных NCBI GenBank.

Рисунок 3. ПЦР анализ штаммов холерных вибрионов с праймерами на гены СС3Т - vcsC2 (дор. 1, 5, 9, 13), vcsN2 (2, 6, 10, 14) , vspD (3, 7, 11, 15), vcsV2 (4. 8, 12. 16). Штаммы: Р-4107 (Ростовская обл., 1974) – дор. 1-4; М423 (Астраханская обл., 2002 г.) - дор.5-8; П258/1099 (Туркмения, 1976) - дор.9- 12; Р16064 токсигенный О139 серогруппы (Ростовская обл., 1993 г.) дор. 13-16; маркеры мол масс (GenRuler ТМ, MBI Fermentas. Литва) –дор.17.

На консервативные участки пяти из этих генов – hcp, vasA, vasF, vasK и vgrG в программе Primer Express нами рассчитаны пары праймеров и подобраны оптимальные условия проведения ПЦР. Гены vasA, vasF, vasH, hcp кодируют структурные компоненты СС6Т, в то время как продукт гена vgrG, является, по-видимому, секретируемым эффекторным белком, обладающим цитотоксичностью. С помощью разработанных ПЦР нами изучено присутствие генов СС6Т у 42 штаммов холерных вибрионов различных серогрупп. Установлено, что у всех изученных штаммов V.cholerae в геноме присутствуют практически все 5 выбранных генов СС6Т, что предполагает наличие у них всего кластера генов этой системы. Гены vasA, vasF, vasK, vgrG, hcp выявлялись как у вирулентных штаммов V.cholerae O1 и O139 серогрупп и токсигенных штаммов О9, О15, О28, О37, О74 и других серогрупп (Узбекистан, Юго-Восточная Азия), так и у нетоксигенных неО1/неО139 вибрионов, выделенных в Астраханской, Саратовской, Ростовской областях, Калмыкии, а также за рубежом. Для изучения экспрессии СС6Т холерными вибрионами, содержащими гены этой системы, нами была использована модель амебы Dictyostelium discoideum штамм XM3 (Dicty Stock Center, Columbia University, USA). В природе эта амеба может питаться культурами бактерий, и in vitro ее легко обнаружить по появлению на чашках с бактериальным газоном после нанесения суспензий или отдельных плодовых тел амеб зон просветления. Отсутствие таких зон свидетельствует об устойчивости бактериальной культуры (за счет экспрессии СС6Т) к D.discoideum. При изучении чувствительности  культур к поеданию  амебой нами установлено, что  на газоне вирулентных штаммов V.cholerae O1 (штаммы CRC 579/67, T-23 биовара эльтор и 569В классического биовара), а также О139 (SG24, РО-7) штаммов зоны проcветления образуются достаточно быстро, что свидетельствует об отсутствии у них устойчивости к D.discoideum. Чувствительными к поеданию амебой были и токсигенные узбекские штаммы (5 штаммов) 1987 и 1990 гг. выделения, что доказывает отсутствие у них функциональной активности этой системы. В то же время 29 нетоксигенных штаммов неО1/неО139 серогрупп, выделенных в России, Узбекистане и в Юго-Восточной Азии, были устойчивы к воздействию амебы D.discoideum, что предполагает функциональную активность у них СС6Т и ее возможный вклад в патогенность этих штаммов. Таким образом, полученные данные свидетельствуют о широком распространении у нетоксигенных холерных вибрионов неО1/не О139 серогрупп генов СС3Т и СС6Т, которые, могут быть факторами патогенности этих вибрионов или же способствовать их выживанию во внешней среде в ассоциации  с простейшими. 

Нами также было исследовано распространение у штаммов V.cholerae неО1/неО139 гена stn термостабильного токсина ST. Для его детекции в ПЦР были использованы праймеры, сконструированные A.C.Vicente et al. [1997]. С их помощью проверено 85 штаммов V.cholerae неО1/неО139, выделенных в Астраханской, Саратовской, Ростовской областях, Калмыкии, в Узбекистане и в Юго-Восточной Азии с 1963 по 2003 гг. Ни в одном из этих штаммов в ПЦР не было получено положительного сигнала, свидетельствующего о наличии гена stn в геноме этих штаммов, что подтверждает справедливость отнесения токсина ST к категории редко встречаемых токсинов холерных вибрионов [Монахова Е.В.. 2012; Arita M. et al., 1986].

5. Разработка способа определения генетического родства штаммов V.cholerae методом секвенирования генов gmhD, orf2 и rjg, фланкирующих кластер генов биосинтеза О-антигена

Нами была исследована возможность применения вариабельности нуклеотидных последовательностей генов rjg, gmhD, orf2, фланкирующих кластер wb* синтеза О-антигена, для молекулярного типирования штаммов V.cholerae разных серогрупп. На основе последовательностей rjg, gmhD, orf2 различных штаммов V.cholerae (NCBI GenBank) нами рассчитаны праймеры, отличные от ранее сконструированных [Stroeher U.N. et al., 1998; Sozhamannan S, et al., 1999] и обеспечивающие получение в ПЦР меньших (для упрощения анализа) фрагментов этих генов. При секвенировании полученных в ПЦР фрагментов генов rjg, gmhD, orf2 у 30 штаммов V.cholerae установлено, что у вирулентных штаммов О1 серогруппы биовара эльтор последовательности генов rjg, gmhD, orf2 были идентичны между собой и близки (но содержали по несколько замен нуклеотидов) вирулентным штаммам классического биовара, но в тоже время значительно отличались от авирулентных штаммов О1 серогруппы биовара эльтор, изолированных из внешней среды. При сравнении их с вирулентными штаммами О139 серогруппы установлено, что последовательность гена orf2 у них была идентична, в то время как в гене rjg у штаммов О139 серогруппы содержалось 13 замен нуклеотидов, а в гене gmhD – 7 замен. В отличие от вирулентных штаммов О139 серогруппы авирулентный штамм М420 этой серогруппы, выделенный из открытого водоема, имел существенные отличия по генам  gmhD, orf2 и rjg (11, 22 и 16 замен) относительно вирулентных штаммов и был не родственен им. Данные по секвенированию этих генов показали их идентичность у токсигенных узбекских штаммов 1990 г. выделения, и в тоже время существенные отличия от вирулентных штаммов О1 и О139 серогрупп. Шесть исследованных нетоксигенных штаммов V.cholerae неО1/неО139, выделенных в Ростовской, Астраханской и Саратовской областях, имели последовательности генов, отличающиеся друг от друга и от токсигенных штаммов О1, О139 и неО1/неО139 серогрупп и, следовательно, принадлежали к независимым филогенетическим линиям эволюции холерных вибрионов. Таким образом, разработанный способ молекулярного типирования позволяет определять наличие родственных связей между штаммами V.cholerae и проводить дифференциацию холерных вибрионов различного происхождения.

Подводя общий итог выполненных в этой работе исследований, следует заключить, что большинство V.cholerae неО1/неО139, выделенных в Российской Федерации и в ближнем зарубежье, не содержат генов двух основных факторов вирулентности – ХТ и ТКПА и, следовательно, они не относятся к эпидемически значимым штаммам V.cholerae. В то же время в их геноме присутствуют гены rtxA, hapA, hlyA, кодирующие факторы патогенности, сочетанное действие которых может отвечать за патогенность вибрионов неО1/неО139 серогрупп. Часть этих штаммов содержит гены СС3Т, и у всех них присутствуют гены СС6Т, которые также могут вносить свой вклад в патогенность V.cholerae неО1/неО139. В эпидемически значимые периоды времени в некоторых регионах России выделяются штаммы, содержащие большее число генов факторов патогенности. На эндемичных по холере территориях в Юго-Восточной Азии циркулируют вибрионы неО1/неО139 серогрупп, которые являются природными резервуарами различных генов патогенности и представляют повышенную опасность для здоровья населения. Выделенные в Узбекистане токсигенные штаммы V.cholerae неО1/неО139 серогрупп содержат набор генов патогенности, отличный от такового вирулентных штаммов О1 и О139 серогрупп. По-видимому, эти штаммы представляют независимые линии эволюции вирулентных V.cholerae, не родственные эпидемическим штаммам О1 и О139 серогрупп. В целом многие штаммы V.cholerae неО1/неО139 обладают патогенными свойствами, что требует проявления к ним пристального внимания и проведения постоянного мониторинга этих потенциально опасных холерных вибрионов.

ВЫВОДЫ

1. Комплексный анализ фенотипических свойств штаммов V.cholerae неО1/неО139 серогрупп, выделенных в Российской Федерации, в ближнем и дальнем зарубежье, показал их биохимическую однородность, не зависящую от их серогрупповой принадлежности и от региона  выделения. Обнаружен ряд антибиотикоустойчивых штаммов неО1/неО139 серогрупп, выявление которых  свидетельствует о возможности распространения резистентности к лекарственным препаратам в популяциях этих вибрионов.

2. В геноме штаммов V.cholerae неО1/неО139, выделенных в Поволжском и других регионах России, как правило, отсутствуют гены основных факторов патогенности – холерного токсина и токсинкорегулируемых пилей адгезии, а также гены островов патогенности VPI, VPI-2, пандемичности VSP-I, VSP-II, конъюгативных транспозонов. В тоже время в геномах этих штаммов содержатся гены hapA, rtxA, hlyA, кодирующие биосинтез факторов патогенности – гемагглютининпротеазы, мультифункционального автопроцессируемого токсина RTX, гемолизина/цитолизина.

3. Холерные вибрионы неО1/неО139 серогрупп, выделенные в эпидемически значимые периоды, а также циркулирующие на эндемичных территориях в Юго-Восточной Азии, содержат большее число генов факторов патогенности, что делает их потенциально опасными  штаммами, а также природными резервуарами этих генов.

4. Изученные токсигенные штаммы неО1/неО139 серогрупп, выделенные в Узбекистане и Юго-Восточной Азии, имеют состав генов патогенности, не встречающийся в таком сочетании у эпидемических штаммов О1 и О139 серогрупп. Выявлены значительные отличия в нуклеотидных последовательностях их генов патогенности от генов эпидемических V.cholerae О1 и О139 серогрупп.

5. Разработанная нами  ПЦР с универсальными праймерами позволяет выявлять различные варианты структурного гена tcpA. С ее помощью у штаммов V.cholerae неО1/неО139 серогрупп обнаружены новые аллели этого гена.

6. В геноме 30 % нетоксигенных холерных вибрионов неО1/неО139 серогрупп, выделенных в Российской Федерации и за рубежом, содержатся гены системы секреции третьего типа, и в геномах всех штаммов – системы секреции шестого типа, которые могут отвечать за патогенные свойства этих вибрионов.

7. С помощью разработанного нами метода определения генетического родства штаммов V.cholerae на основе вариабельности генов gmhD, orf2 и  rjg, фланкирующих кластер генов О-антигена, впервые установлено, что штаммы V.cholerae, имеющие клональное происхождение, могут относиться к различным серогруппам.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО МАТЕРИАЛАМ ДИССЕРТАЦИИ

1. Фадеева А.В., Ерошенко Г.А., Кутырев В.В.  Разработка алгоритма выявления штаммов Vibrio cholerae с полным и неполным набором генов вирулентности// «Фундаментальная наука и клиническая медицина». Мат. 10-ой Всероссийск. медико-биологической конф. молодых иссл. «Человек и его здоровье». – С-Пб., 2007. – С.469-470.

2. Ерошенко Г.А., Краснов Я.М., Фадеева А.В., Кутырев В.В.  Использование вариабельности генов, фланкирующих кластер биосинтеза О-антигена, для дифференциации штаммов холерных вибрионов// Генодиагностика инф. болезней. 6 Всеросс. науч.-практ. конф. Сб. трудов/ колл. авт.: под ред. В.И. Покровского – М.:Университетская книга Паис. – 2007. – V.1. – Р.374-377.

3. Ерошенко Г.А., Шавина Н.Ю., Краснов Я.М., Гусева Н.П., Фадеева А.В., Валова Т.В., Кутырев В.В. Генетические особенности вирулентных холерных вибрионов неО1/неО139 серогруппы, выделенных в Узбекистане// Холера и непатогенные для человека вибрионы. Мат. совещания специалистов Роспотребнадзора и пробл. комиссии Координационного научного совета по сан-эпид.охране территории РФ. – Ростов-н/Д. – 2008.– Вып.№21. – С.63-67.

4. Ерошенко Г.А., Кутырев В.В., Фадеева А.В., Шавина Н.Ю., Степанов А.В. Распространение генов системы секреции III типа у холерных вибрионов различных серогрупп// Журнал микробиол., эпидемиол. и иммунобиол. - 2008. - №4. С. 23-27.

5. Ерошенко Г.А., Краснов Я.М., Фадеева А.В., Шавина Н.Ю., Гусева Н.П., Кутырев В.В. Способ определения генетического родства штаммов холерных вибрионов  методом секвенирования генов, фланкирующих кластер генов биосинтеза О-антигена. Заявка № 2008152534. Приоритет изобретения. 29 декабря 2008 г. Патент РФ №2393231.

6. Ерошенко Г.А., Видяева Н.А., Фадеева А.В., Валова Т.В., Кутырев В.В. Распространение генов системы секреции VI  типа у холерных вибрионов неО1/неO139 серогрупп// Холера и патогенные для человека вибрионы. Сборник материалов проблемной комиссии Координационного научного совета по санитарно-эпидемиологической охране территории РФ – Ростов-н/Д., 2009. – Вып.№ 22. – С.117-120.

7. Фадеева А.В., Одиноков Г.Н., Валова Т.В., Ерошенко Г.А., Кутырев В.В. Изучение распространения генов tcpA у штаммов Vibrio cholerae не О1/не О139  серогрупп// Холера и патогенные для человека вибрионы. Мат. Совещания специалистов Роспотребнадзора по вопросам  совершенствования эпид. надзора за холерой и материалы проблемной комиссии (48.94). – Ростов-н/Д. 2011. – Вып.24. – С. 104-106.

8. Фадеева А.В., Ерошенко Г.А., Кутырев В.В. Генетический анализ штаммов Vibrio cholerae неО1/неО139, выделенных в Российской Федерации// Матер. 3 научно-практ. школы-конф. молодых ученых и специалистов. «Современные технологии обеспечения биологической безопасности». – Оболенск, 2011. – С. 140.

9. Фадеева А.В., Ерошенко Г.А., Кутырев В.В. Выявление генов патогенности эпидемических штаммов Vibrio cholerae О1 и О139 у холерных вибрионов неО1/неО139 серогрупп. Мат. IV ежегодного Всероссийского конгресса по инфекционным болезням (Москва, 26-28 марта 2012 г., С.398.

10. Фадеева А.В., Ерошенко Г.А., Одиноков Г.Н, Валова Т.В., Кутырев В.В. Молекулярно-генетические  особенности холерных вибрионов неО1/неО139 серогрупп. Мат.X съезда Всероссийск. науч.-практ. общества эпидемиологов, микробиологов и паразитологов (Москва, 12-13 апреля 2012 г.)// Инфекция и иммунитет.-2012. – Т.2., №1-2– С. 332-333.

11. Фадеева А.В., Ерошенко Г.А., Одиноков Г.Н., Шарапова Н.А., Валова Т.В., Кутырев В.В. Разработка ПЦР с универсальными праймерами для выявления различных вариантов гена tcpA//Проблемы особо опасных инф. 2012. 1(111). С. 102-103.

12. Фадеева А.В., Ерошенко Г.А., Шавина Н.Ю., Кутырев В.В. Анализ SXT констина антибиотикочувствительного штамма Vibrio cholerae неО1/неО139 серогруппы.// Проблемы особо опасных инф. 2012. N 3(113). С. 102-103.

Подписано к печати 14.11.2012

Формат 60 х 84 1/16 Печать лазерная Бумага офисная

Объем 1,0 усл. п.л. Тираж 100 экз.

Отпечатано на полиграфическом оборудовании ФКУЗ РосНИПЧИ «Микроб»

410005, г. Саратов, ул. Университетская, 46

 






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.