WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

СВЕТЛАКОВА ТАТЬЯНА НИКОЛАЕВНА

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ И ОЦЕНКА СОСТОЯНИЯ ГЕНОФОНДОВ ПОПУЛЯЦИЙ POPULUS TREMULA L. В ПЕРМСКОМ КРАЕ

03.02.07 – генетика

Автореферат диссертации на соискание ученой степени кандидата биологических наук

УФА– 2012

Работа выполнена в федеральном государственном бюджетном учреждении высшего профессионального образования «Пермский государственный национальный исследовательский университет» (ПГНИУ)

Научный консультант: доктор биологических наук, доцент Боронникова Светлана Витальевна

Официальные оппоненты:

Путенихин Валерий Петрович доктор биологических наук, старший научный сотрудник, Федеральное государственное бюджетное учреждение науки Ботанический сад-институт Уфимского научного центра Российской академии наук, заведующий лабораторией дендрологии и лесной селекции доктор биологических наук, доцент, Ветчинникова Федеральное государственное бюджетное Лидия Васильевна учреждение науки Институт леса Карельского научного центра Российской академии наук, руководитель группы биотехнологии воспроизводства древесных растений Ведущее учреждение:

Федеральное государственное бюджетное учреждение науки Институт общей генетики имени Н.И. Вавилова РАН

Защита диссертации состоится ____ ноября 2012 г. в_____ часов на заседании Объединенного Диссертационного совета ДМ 002.133.01 при Федеральном государственном бюджетном учреждении науки Институте биохимии и генетики Уфимского научного центра РАН по адресу: 450054, г. Уфа, просп.

Октября, 71, ИБГ УНЦ РАН.

С диссертацией можно ознакомиться в Научной библиотеке Уфимского научного центра РАН по адресу: 450054, г. Уфа, просп. Октября, 71.

e-mail: molgen@anrb.ru Автореферат разослан ___ октября 2012 г.

Ученый секретарь диссертационного совета, к.б.н. С.М.Бикбулатова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность темы. Исследования, выполняемые в целях оптимизации природопользования и охраны биоразнообразия на популяционном уровне, относятся к наиболее приоритетным направлениям развития науки (Комплексная программа развития биотехнологий..., 2012). Эффективные мероприятия по охране биоразнообразия невозможны без внимания к его генетической компоненте. Вследствие рубок, болезней, загрязнения окружающей среды, осуществления индивидуального отбора в селекции, наблюдается снижение генетического разнообразия лесов (Ирошников и др., 1989; Путенихин, 1993; Видякин, 2004). Для разработки стратегии сохранения и рационального природопользования лесных ресурсов, обеспечивающей удовлетворение экономических потребностей общества и охрану биоразнообразия природных сообществ, необходимы глубокие знания о состоянии генофондов основных лесообразующих пород деревьев (Динамика популяционных…, 2004). Популяционный подход при изучении главнейших видов-лесообразователей важен для понимания закономерностей формирования лесных насажденийи и открывает перспективу эффективного исследования эволюционного процесса у древесных растений (Путенихин, 2000). Только глубокое знание тонкой популяционно-генетической структуры древесных растений позволит проводить мониторинг ее изменений и прогнозировать нарушение ее стабильного воспроизводства во времени (Политов, 2007). Род Populus L. (тополь) является модельным для генетических исследований древесных растений благодаря относительно небольшому размеру генома и огромным адаптивным возможностям (Brunner et al., 2004).

Североамериканский вид тополя Populus trichocarpa Torr. и A.Gray (западный бальзамический тополь, или калифорнийский тополь) был первым древесным видом растений, геном которого был полностью секвенирован (Tuskan, et al.

2006). Populus tremula L. (тополь дрожащий или осина) – один из важнейших лесообразующих и практически значимых древесных видов растений, что подтверждается использованием данного вида в различных отраслях народного хозяйства развитых стран, таких как США, Канада, Финляндия, Япония, Китай (Gordon et al, 1996; Geburek, Turok, 2005). В настоящее время развитие ДНКтехнологий, основанных на полимеразной цепной реакции (ПЦР), открыло новые методические возможности для изучения генетических факторов, обуславливающих особенности динамики популяционно-генетической структуры тех или иных видов древесных растений (Ветчинникова и др., 2012).

Цель исследований – изучение генетической компоненты биологического разнообразия и оценка состояния генофондов популяций P. tremula в Пермском крае.

Для достижения цели были поставлены следующие задачи:

1) провести молекулярно-генетический анализ популяций P. tremula с использованием ISSR-маркеров;

2) изучить генетическую структуру популяций P. tremula, определить генетические расстояния между популяциями P. tremula;

3) определить нуклеотидные последовательности генов P. tremula, которые используются для сравнительной геномики видов рода Populus и выявить в них SNPs (Single Nucleotide Polymorphisms);

4) проанализировать частоту и расположение SNPs в изученных генах и провести их сравнительный анализ с SNPs других видов рода Populus;

5) провести молекулярно-генетическую идентификацию популяций P. tremula в Пермском крае с использованием ISSR-PCR маркеров и SNPs;

6) дать оценку состояния генофондов популяций P. tremula в Пермском крае.

Научная новизна работы. Впервые в Пермском крае проведено комплексное изучение генофондов популяций P. tremula. Генетическое разнообразие оценено с использованием межмикросателлитного, или ISSR (Inter-Simple Sequence Repeats)-метода анализа полиморфизма ДНК. Изучена генетическая дифференциация популяций P. tremula, установлены генетические расстояния, определены коэффициенты генетической оригинальности популяций (КГО). Секвенированы последовательности пяти генов P. tremula.

Впервые проведены исследования по детекции SNPs (Single Nucleotide Polymorphisms) в геноме пермских популяций P. tremula. Проведен сравнительный анализ частот SNP P. tremula с частотами SNPs двух других видов рода Populus. Впервые на основании данных молекулярно-генетического анализа разработан подход и дана оценка состояния семи популяций P. tremula в Пермском крае. Разработана модельная система генетической идентификации древесных видов растений на основе ДНК маркеров (ISSR-PCR маркеров) с учетом SNP.

Практическая значимость диссертационной работы заключается в разработке подхода к определению состояния генофондов популяций лиственных древесных видов растений на примере P. tremula и модельной системы генетической идентификации древесных видов растений на основе полиморфизма ISSR-PCR маркеров и SNP. Результаты работы, научные выводы и рекомендации могут быть использованы при разработке программ сохранения и развития генетических ресурсов P. tremula. Результаты работы внедрены в учебный процесс Пермского государственного национального исследовательского университета и Башкирского государственного университета, что подтверждено актами внедрения. Результаты исследований и практические рекомендации диссертации предлагаются для использования Министерством природных ресурсов, научными учреждениями, высшими учебными заведениями, для разработки программ сохранения и рационального использования генофонда вида на популяционной основе, для генетической идентификации древесных видов растений, включая определения места происхождения древесины. Результаты исследований могут быть использованы для оптимизации методов и мер сохранения генетической компоненты биологического разнообразия популяционных систем лиственных древесных видов растений и в других регионах страны.

Связь работы с научными программами. Диссертационная работа выполнена при частичной финансовой поддержке инновационного образовательного проекта «Образование», гранта РФФИ р_урал_а № 07-0496032 «Динамика генетического разнообразия и структуры популяционных систем ресурсных растений Пермского края при антропогенных воздействиях» (2007-2009 гг.), Аналитической ведомственной целевой программы «Развитие научного потенциала высшей школы» (2009-2010 гг.), НИР «Оценка состояния генофондов и популяционных систем ресурсных видов растений при естественных колебаниях и антропогенной трансформации среды с использованием новых геномных и биоинформационных технологий» (20122014 гг.) государственного задания на оказание услуг Министерства образования и науки РФ, программы развития ПГНИУ «Рациональное природопользование: технологии прогнозирования и управления природными и социально-экономическими системами» (2010-2019 гг.), Международного договора о сотрудничестве ПГНИУ и Университета Эври Вал де Эссон (Франция).

Личное участие автора. Автором лично проведены полевые и лабораторные исследования, выполнена обработка и интерпретация полученных результатов, сопоставление их с литературными данными, написание и оформление диссертационной работы. Подготовка публикаций выполнена лично или при активном участии автора, результаты работы опубликованы в 20 печатных работах.

Апробация работы. Основные результаты работы были представлены на 12 научных и научно-практических конференциях, в их числе Международных конференций: «Нанотехнологии в сельском хозяйстве» (Москва, 2008); «Биотехнология начала III тысячелетия» (Саранск, 2010); «ЕС – Россия: 7-я Рамочная программа в области биотехнологии, сельского, лесного, рыбного хозяйства и пищи» (Уфа, 2010); «Антропогенная трансформация природной среды» (Пермь, 2010); «Третье международное совещание по сохранению лесных генетических ресурсов Сибири» (Красноярск, 2011);





«Актуальные проблемы ботаники и экологии» (Киев, 2011); «Актуальные проблемы биологии, нанотехнологий и медицины» (Ростов-на-Дону, 2011);

«Синтез знаний в естественных науках. Рудник будущего: проекты, технологии, оборудование» (Пермь, 2011) и 3 Всероссийских с международным участием: «Симбиоз-Россия 2010» (Нижний Новгород, 2010); «Симбиоз-Россия 2011» (Воронеж, 2011); «Биологические системы: устойчивость, принципы и механизмы функционирования» (Нижний Тагил, 2012); «Биология - наука XXI века» (Москва, 2012).

Публикации. По теме диссертации опубликовано 20 работ, в их числе статьи в журналах из перечня ВАК РФ.

Структура и объем работы. Диссертационная работа состоит из введения, 5 глав, выводов, списка литературы и приложений. Общий объем диссертационной работы составляет 145 машинописных страниц, работа содержит 21 таблицу, 22 рисунка. Список литературы содержит 1источников, из них 112 на иностранном языке.

Благодарности. Автор выражает глубокую благодарность за руководство диссертационной работы научному руководителю д.б.н., профессору, заведующему кафедрой ботаники и генетики растений «Пермского государственного национального исследовательского университета» С. В. Боронниковой, за консультации д.б.н., профессору кафедры лесоводства и ландшафтного дизайна ФГБОУ ВПО «Башкирский государственный аграрный университет» Ю.А. Янбаеву, за освоение современных методов молекулярногенетического анализа руководителю группы по изучению генетики тополей Института сравнительной геномики растений Университета Эври Вал де Эссон (Франция) П. Файвре Рампан, за консультации при проведении биоинформационного анализа доценту лаборатории растительной геномики Института биотехнологии университета Хельсинки (Финляндия) Р.Н. Календарю, за консультации заведующему лабораторией экологии леса Естественнонаучного института ПГНИУ М. В. Рогозину, за помощь в статистической обработке материала с использованием компьютерных программ коллегам по лаборатории и соавторам по публикациям.

РЕГИОН, ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЙ Исследования проведены в Пермском крае, входящем в состав Приволжского федерального округа. Пeрмский край расположeн на восточной окраинe Русской равнины и западном склонe Уральских гор, в бассeйнe вeрхнeй и срeднeй Камы. В качестве объектов исследований избраны популяции вида тополь дрожащий или осина (Populus tremula L.). С 2007 по 2012 годы были проведены комплексные исследования 7-ми природных популяций P. tremula, которые располагаются в разных участковых лесничествах: в Пермском (Pt1), Полазненском (Pt2), Кунгурском (Pt3), Суксунском (Pt4), Частинском (Pt5), Ильинском (Pt6) и Губахинском (Pt7) муниципальных районах Пермского края. Выделение ДНК из листьев растений проводили по методике Д. Роджерса (Rogers, 1985) с небольшими модификациями. Концентрацию и спектральную характеристику ДНК определяли на приборе SpectrofotometrTM NanoDrop 2000 («Thermo scientific», USA). Молекулярно-генетический анализ проведен в молекулярногенетической лаборатории кафедры ботаники и генетики растений биологического факультета ПГНИУ с использованием ISSR- (Inter Simple Sequence Repeats, Zietkiewicz et al., 1994). Амплификацию ДНК проводили в термоциклере Gene Amp PCR System 9700 («Applied Biosystems», США) по стандартной для ISSR-метода программе (Молекулярная генетика…, 2007).

Всего было протестирвоано 20 ISSR-праймеров, из которых было избрано для дальнейшего анализа 5: M1 (AC)8CG, M27 (GA)8C, X9 (ACC)6G, X10 (AGC)6C, Х11 (AGC)6G. Температура отжига в зависимости от G/C состава праймеров варьировала от 46°С до 56°С. В качестве отрицательного контроля (К-) в реакционную смесь для проверки чистоты реактивов добавляли вместо ДНК мкл деионизированной воды. Продукты амплификации разделяли электрофорезом в 1,7% агарозном геле в 1х ТВЕ буфере (Tris-Borate-EDTA), окрашивали бромистым этидием и фотографировали в проходящем ультрафиолетовом свете в системе гель-документации Gel Doc XR («Bio-Rad», США).

Для определения длин фрагментов ДНК использовали маркер молекулярной массы (100 bp +1.5 + 3 Кb DNA Ladder, ООО «СибЭнзим-М», Москва) и программу Quantity One («Bio-Rad», USA). Для проверки достоверности полученных результатов опыты (или ПЦР) повторяли не менее трех раз. Эффективность выявления полиморфизма ДНК 20 ISSR-PCR праймеров рассчитана в соответствии со шкалой 1–5 (Боронникова, Календарь, 2007). Проведен компьютерный анализ молекулярно-генетического полиморфизма ДНК с помощью компьютерных программ POPGENE 1.31 (Yeh et al., 1999) и специализированного макроса GenAlEx6 (Peakall, Smouse, 2006) для MS-Excel с определением доли полиморфных локусов (Williams et al., 1990) при Р95, абсолютного числа аллелей ( na ), эффективного числа аллелей ( ne ) (Kimura еt al., 1964), ожидаемой гетерозиготности ( НЕ ) (Nei, 1987). Для описания генетической структуры подразделенной популяции были использованы следующие параметры: ожидаемая доля гетерозиготных генотипов ( HT ) во всей популяции, как мера общего генного разнообразия;

ожидаемая доля гетерозиготных генотипов в субпопуляции ( H ), как мера ее S внутрипопуляционного разнообразия; доля межпопуляционного генетического разнообразия в общем разнообразии или показатель подразделенности популяций (GST ) (Nei, 1975). Генетическое расстояние между популяциями ( D ) определяли по формулам M. Нея (Nei, 1978; Nei et al., 1979). На основе матриц бинарных признаков были рассчитаны матрицы генетических различий (Nei, 1972), на основании полученной матрицы невзвешенным парно-групповым методом (UPGMA – unweighed pair-grup method using arithmetic average) были построены дендрограммы, отражающие степень родства исследуемых популяций по ISSR- и IRAP-спектрам при помощи компьютерных программ Treecon 1.3b и POPGENE 1.31.

Для детекции SNPs (Single Nucleotide Polymorphisms) амплификацию проводили в термоциклере Gene Amp PCR System 9700 («Applied Biosystems», USA), по программе: 2 мин - 94°C, следующие 35 циклов (94°C0 - 20секунд, 60°C - 20 сек (-1° каждый цикл), 72°C- 40 сек.) 68°C - 10 мин. Дизайн праймеров проведен в программе Primer 3 на основе генома P. trichocarpa в Институте растительной геномики (Франция). Предварительную детекцию продуктов амплификации проводили электрофорезом в 2% агарозном геле в 1х ТВЕ буфере (Tris-Borate-EDTA), окрашивали бромистым этидием и фотографировали в проходящем ультрафиолетовом свете в системе гельдокументации Gel Doc XR («Bio-Rad», USA). Для реакции секвенирования был использован Big Dye® Terminator v3.1 Cycle Sequencing Kit («Applied Biosystems», USA), в качестве праймера была использована реверсная последовательность из пары праймеров, с которой была поставлена ПЦР.

Очистку продуктов реакции секвенирования от невступивших в реакцию меченых нуклеотидов осуществляли с помощью набора BigDye® XTerminatorTM Purification Kit («Applied Biosystems», USA). Секвенирование синтезированных последовательностей проводили в ПЦР-лаборатории кафедры ботаники и генетики растений ПГНИУ (Россия) в 24-капиллярном генетическом анализаторе Genetic Analyzer 3500xL («Applied Biosystems», USA).

Секвенированные последовательности были сравнены с имеющимися последовательностями в генетической базе данных NCBI посредством системы автоматического on-line выравнивания BLASTN 2.2.26+ на сайте NCBI http://www.ncbi.com. Множественное выравнивание последовательностей проводилось в MULTALIN. При анализе популяционных генофондов P. tremula использованы общепринятые подходы и методики (Lewontin, 1972; Nevo, 1987;

Алтухов, 1995, 2003; Динамика...., 2004). Оценка состояния генофондов популяций проведена в соответствии с методикой С.В. Боронниковой (2009).

Молекулярно-генетическая идентификация популяций изучаемого вида проведена на основании технологии, предложенной С.В. Боронниковой (2008) с учетом нуклеотидного полиморфизма. Статистическая обработка полученых данных проведена с использованием стандартных для популяционногенетических исследований методов (Животовский, 1983, 1990; Лакин, 1990).

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ 1. АНАЛИЗ ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ POPULUS TREMULA L. С ИСПОЛЬЗОВАНИЕМ ISSR-PCR МАРКЕРОВ Проведен молекулярно-генетический анализ с использованием ISSR-PCR маркеров, амплифицированных пятью праймерами, в семи популяциях P. tremula в Пермском крае (рис. 1). Среднее число фрагментов ДНК, выявляемых праймером, равнялось 23,8, максимальное – 27 (праймер М1), а минимальное – 19 (праймер Х11). Доля полиморфных локусов ( Р95 ), выявленных в результате ПЦР со всеми ISSR-праймерами в изученных популяциях, составила 0,731. Низкая доля полиморфных локусов установлена в популяциях Pt1 и Pt5 (0,530 и 0,565 соответственно). При этом доля полиморфных локусов в популяциях, выявляемых отдельными праймерами, варьировала от 0,200 (праймер Х9, Pt5) до 0,933 (праймер М1, Pt3, Pt6).

Праймер М27 выявил низкие показатели полиморфизма ДНК в популяциях ( Р95 =0,575), а праймер М1 – наиболее высокие ( Р95 =0,815).

Рис. 1. ISSR-спектр второй популяции P. tremula (Pt2) c праймером Х10;

Цифрами сверху обозначены номера проб, М - молекулярный маркер, цифрами слева обозначены длины фрагментов ДНК. Стрелками указаны некоторые полиморфные фрагменты ДНК Наибольшее абсолютное число аллелей выявлено в популяциях Pt( na =1,465) и Pt4 ( na =1,449). Эффективное число аллелей оказалось наибольшим в популяции Pt2 ( ne =1,275). Наименьшие показатели абсолютного и эффективного числа аллелей отмечены в двух популяциях Pt6 ( ne =1,186;

na =1,354) и Pt7 ( ne =1,141; na =1,315). Ожидаемая гетерозиготность ( НЕ ) на общую выборку составила 0,129. Самое высокое значение этого показателя выявлено в популяции Pt2 ( НЕ =0,160), самое низкое, ниже практически в два раза, – в популяции Pt7 ( НЕ =0,088). В литературе встречаются показатели ожидаемой гетерозиготности для этого вида от 0,026 до 0,834 (Lexer et al., 2005).

Изучение генетической структуры популяций показало, что HT гетерозиготных генотипов в общей популяции ( ) P. tremula составила 0,281, а ожидаемая доля гетерозиготных генотипов в субпопуляции ( HS ) – 0,127 (табл.

1). Наименьшие показатели генетического разнообразия получены при анализе HT с праймером Х9 ( =0,249, HS =0,080), а наибольшее – с праймером МHT ( =0,308) и М1 ( HS =0,162). Коэффициент подразделенности популяций (GST ) показывает, что на межпопуляционную компоненту приходится 55% генетического разнообразия (GST =0,550). Это говорит о том, что на внутрипопуляционную составляющую разнообразия приходится меньшая доля общего разнообразия, что является закономерным для вида P. tremula. При сравнении уровень генетической дифференциации изученных популяций P. tremula был значительно выше, чем у других видов тополя, исследованных с помощью AFLP (Chen et al., 2010) и SSR-маркеров (Wang, 2011; Li et al., 2006).

Таблица 1.

Генетическая структура семи популяций P. tremula HS GST ISSR-праймер HT М1 0,285 (0,023) 0,162 (0,012) 0,4М27 0,308 (0,025) 0,147 (0,006) 0,5Х9 0,249 (0,036) 0,080 (0,005) 0,6Х10 0,296 (0,030) 0,130 (0,006) 0,5Х11 0,265 (0,035) 0,117 (0,006) 0,5На общую выборку 0,281 (0,030) 0,127 (0,007) 0,5Примечание: HT – ожидаемая доля гетерозиготных генотипов в общей популяции; HS – ожидаемая доля гетерозиготных генотипов в субпопуляции;

GST – доля межпопуляционного генетического разнообразия в общем разнообразии; в скобках даны стандартные отклонения Наименьшее генетическое расстояние отмечено между популяциями Pt6 и Pt7 ( D =0,089), а наибольшее – между популяциями Pt1 и Pt6 ( D =0,429).

Кластерный анализ был проведен невзвешенным парно-групповым методом (UPGMA) и построена дендрограмма, отражающая степень родства исследуемых популяций (рис. 2).

На дендрограмме растения P. tremula cформировали 7 кластеров, соответствующих исследованным семи популяциям.

0.6 0.5 0.4 0.3 0.2 0.Pt_1100 Pt_Pt_Pt_Pt_1Pt_1Pt_Рис. 2. UPGMA-дендрограмма генетического сходства 7-ми популяций P. tremula, построенная на основании полиморфизма ISSR-маркеров. Шкала сверху – генетические дистанции. На дендрограмме указаны значения бутстрепа (в %) Узлы ветвления имеют высокий индекс бутстрепа (>78%), что говорит о достоверности межпопуляционных различий.

2. АНАЛИЗ ОДНОНУКЛЕОТИДНЫХ ЗАМЕН В СЕКВЕНИРОВАННЫХ ПОСЛЕДОВАТЕЛЬНОСТЯХ ДНК POPULUS TREMULA L.

В Институте Растительной геномики (Франция) разработана стратегия для изучения нуклеотидного разнообразия видов рода Populus (Paolucci, 2008), отобраны 27 генов-кандидатов, к которым разработаны 36 пар праймеров. С каждой из 36 пар праймеров была проведена ПЦР в качестве матрицы с геномной ДНК P. tremula. Информативными для P.tremula оказались 16 пар праймеров к 14 генам. Последовательности этих праймеров фланкируют гены или их элементы, вовлеченные в процессы, которые можно разделить на группы: формирование клеточный стенки и клеточная дифференциация (PopLTP1, PopFLA, PtrCOBL4, PopCHT), устойчивость к водному стрессу и дегидротации (Erecta, PopDhn1), биосинтез лигнина (Ptr4CL1, CAM1, F5H1, C4H1, GH3-5) устойчивость к патогенам (PIN-T, TR-INH2, PatRelProt, OX-RED, RIB-PROT). Для анализа частот и расположения SNPs нами выбраны локусы, вовлеченные в процессы биосинтеза лигнина. У 5 локусов из генов группы биосинтеза лигнина (Ptr4CL1, CAM1, F5H1, C4H1, GH3-5) были секвенированы последовательности и выявлены частоты SNPs в 7 популяциях P. tremula (табл.

2).

Таблица 2.

SNPs в последовательностях 5 генов P. tremula Кол-во Кол-во Последовательности праймеров Всего Локус замен замен не (5’-3’) SNPs синонимов синонимов F-AATCTCTTTCAGTACTCCTTTGG C4H1 1 1 R-GCAGCCTTCTCTCTTTAACC F- AACTCACCATCTCTCCCTCT Ptr4CL1 6 5 R- CCTCCAGATTTTATCATCCTC F- GTGGATGCTGACAAGGACAA САМ1 4 3 R- TCCACTTACAGAAATTTAAGAGAGG F- AACATCCATAGGCACCAAC F5H1 10 10 R- CAGGGAATGAAATCAGACA F- ACCCATCATCATTACCTCAA GH3-5 8 6 R- TTGAATGCCCAAGTTCTG Всего: 29 25 Всего в секвенированных последовательностях 5 локусов P. tremula выявлено 29 SNPs. Суммарная длина анализированной последовательности по всем пяти локусам у каждого растения составила 2955 пн. Самым консервативным в изученных генах P. tremula является локус С4Н1. При множественном выравнивании обнаружено, что и у других видов этого рода (P. tremuloides P. trichocarpa и P. tomentosa) локус С4Н1 достаточно консервативен. Проведен анализ нуклеотидного полиморфизма на предмет замены кодируемой аминокислоты. Всего 13,8% замен из обнаруженных приводили к замене кодируемой аминокислоты (рис. 3).

Рис. 3. Результаты множественного выравнивания. Обозначения: А – вставка триплета, кодирующего стоп-кодон; В – синонимичная замена нуклеотида, кодоны GTA, GTC, GTT кодируют одну и ту же аминокислоту валин (Val); С – несинонимичные замены: триплеты AGT и AGC кодируют сератонин (Ser), триплет AAC кодирует аспергин (Asn); 1 – Populus tremula, – Medicago truncatula, 3 – Glycine max, 4 – Glycine max, 5 – Populus trichocarpa, 6 – Populus trichocarpa, 7 – Vitis vinifera, 8 – Populus trichocarpa, 9 – Vitis vinifera, 10 – Arabidopsis lyrata.

Популяции Pt6 и Pt7 в большинстве случаев имели одинаковые частоты SNPs. В популяции Pt4 в двух случаях были обнаружены замены, которых не наблюдается в других популяциях, это замена A/G в 272 положении гена GH35 с частотой 0,500 и замена С/Т в 85 положении гена GH5-3 с частотой 0,375.

При сравнении нуклеотидного полиморфизма с аналогичными показателями двух других видов рода Populus у осины на территории Пермского края выявлен более высокий уровень нуклеотидной изменчивости, SNP на каждые 92 нуклеотида (табл. 3).

Таблица 3.

Сравнение частот SNPs у трех видов рода Populus Частота SNP Вид тополя Общая UTR регион Экзон Интрон P. nigra 1/112 1/78 1/201 1/P. trichocarpa 1/104 1/75 1/143 1/P. tremula 1/92 1/77 – 1/В секвенированных последовательностях 5-ти генов в пермских популяциях P. tremula наиболее часты замены в интронах, как и у других видов.

Для кодирующих участков нами не выявлены полиморфные позиции в исследуемых пяти генах, вовлеченных в процесс биосинтеза лигнина.

3. АНАЛИЗ СОСТОЯНИЯ ГЕНОФОНДОВ ПОПУЛЯЦИЙ P. TREMULA Установленные нами при молекулярно-генетическом анализе параметры генетического разнообразия разделены на четыре группы. К первой группе относятся «Основные показатели генетического разнообразия», это доля полиморфных локусов ( Р95 ) и ожидаемая гетерозиготность ( НЕ ). Вторую группу параметров генетического разнообразия составляют показатели выравненности частот локусов (K). Этот показатель рассчитан отдельно для частот локусов, выявленных ISSR-PCR маркерами, и частот однонуклеотидных полиморфных позиций. Показатели выравненности частот локусов, выявленные по этим двум типам маркеров, демонстрируют высокий коэффициент корреляции (0,96). Генетическую структуру и дифференциацию популяций предлагаем характеризовать показателем внутрипопуляционного разнообразия () и долей редких фрагментов ДНК ( h ). Четвертую группу показателей генофондов предлагается оценивать по таким показателям как число редких аллелей ( R ) и коэффициент генетической оригинальности (КГО).

С использованием ISSR-метода анализа полиморфизма ДНК в Pt1, Pt4, Pt6, Pt7 популяциях P. tremula выявлено по одному уникальному фрагменту ДНК, а в Pt2, Pt3, Pt5 – по 5 уникальных фрагментов ДНК. Нами предложено дополнение в технологию молекулярно-генетической идентификации древесных видов растений, которое заключается в том, что в молекулярногенетическую формулу помимо идентификационных фрагментов ДНК, амплифицированных в результате ПЦР, вносятся и другие структурные изменения геномов, такие как делеции, дупликации, однонуклеотидные замены, выявленные при сравнительном анализе нуклеотидных последовательностей после секвенирования геномной ДНК. Например, популяция Ptидентифицируется с помощью обнаружения однонуклеотидной замены С на А в 126 положении гена Erecta, при этом в записи молекулярно-генетической формулы указывается: Pt4_Erecta_SNP126"C/A". Популяция Ptидентифицируется наличием делеции пяти нуклеотидов ААЕGA в интроне гена Erecta с 259 по 263 позицию. При этом в записи молекулярно-генетической формулы указывается: Pt5_Erecta_Del259-263"AATGA".

Для комплексной оценки состояния популяционных генофондов все избранные показатели генетического разнообразия переведены в разработанную нами пятибалльную шкалу оценки. Наибольшую сумму баллов по результатам пятибалльного оценивания восьми избранных показателей генетического разнообразия популяций – 34 балла из 40 – набрала популяция Pt4 (рис. 4).

P4,КГО 3,5 He 2,1,0,R KISSR h KSNP Рис. 4. Оценка состояния генофонда популяции Pt4 P. tremula.

Обозначения: Р95 – доля полиморфных локусов; НЕ – ожидаемая гетерозиготность; KISSR – коэффициент выравненности частот аллелей по результатам ISSR-PCR-маркирования; KSNP – коэффициент выравненности частот аллелей по результатам SNP-маркирования; – среднее число морф; h – доля редких морф; R – число уникальных фрагментов; КГО – коэффициент генетической оригинальности.

На втором месте популяция Pt3, которая набрала 30 баллов. Популяции Pt1, Pt2, Pt6 и Pt7 набрали 28, 26, 25 и 23 балла соответственно. Наименьшая сумма баллов по предложенной шкале оценивания наблюдается в популяции Pt5 – 19 баллов из 40 возможных. Популяции Pt5, Pt6 и Pt7 характеризуются также не выравненными оценками по предложенной пятибалльной шкале. На основе восьми показателей популяционного генетического разнообразия, переведенных в предложенную нами пятибалльную шкалу оценивания, мы предлагаем следующую шкалу оценки состояния генофондов древесных видов растений. Таким образом, установлено, что в удовлетворительном состоянии находятся генофонды 6 из изученных в Пермском крае популяций P. tremula, а в одной популяции (Pt5) отмечены процессы обеднения популяционного генофонда.

На основании результатов исследований даны следующие рекомендации:

1. Из изученных семи популяций P. tremula в Пермском крае три популяции (Pt1, Pt3 и Pt4) рекомендуются нами в качестве модельных для генетических исследований лиственных древесных видов растений. Эти популяции характеризуются высоким уровнем генетического разнообразия, а также наиболее выравненными его показателями.

2. Разработанный метод генетической идентификации древесных видов растений, в котором в молекулярно-генетическую формулу помимо традиционных идентификационных фрагментов ДНК (ISSR-PCR), вносятся позиции и частотные характеристики SNP-маркеров, рекомендуется для определения места происхождения древесины.

3. Данные молекулярно-генетического анализа рекомендуется использовать для идентификации видов рода Populus и гибридных форм тополей.

4. При оценке состояния генофондов популяций лиственных древесных видов растений рекомендуется учитывать их специфические особенности, установленные как с использованием ISSR метода, так и с учетом SNP и их частот.

ВЫВОДЫ 1. Установлено, что изученные в Пермском крае популяции P. tremula характеризуются высоким уровнем генетического разнообразия (Р95=0,731;

He=0,129; ne =1,217), при этом наибольшие значения изученных параметров отмечены в Pt4 (Р95=0,790; He=0,138; ne = 1,225), а наименьшие – в Pt(Р95=0,565; He=0,120; ne = 1,204).

2. Анализ генетической структуры популяций P. tremula показал, что на межпопуляционную компоненту приходится 55% генетического разнообразии (GST =0,550).

3. Генетические расстояния ( D ) между популяциями варьируют от 0,0(между Pt6 и Pt7) до 0,429 (между Pt1 и Pt6). Изученные растения P. tremula сформировали на дендрограмме семь кластеров в строгом соответствии с исследованными семью популяциями.

4. Подтверждена информативность 16 из 36 пар праймеров, используемых в исследованиях по сравнительной геномике тополей, для амплификации 14 генов P. tremula. Степень гомологии секвенированных последовательностей с аналогичными в базах данных 95-99%. В 5-ти генах P. tremula выявлено 29 SNPs, из которых только 4 (13,8%) приводят к замене кодируемой аминокислоты.

5. В среднем частота SNPs в геноме представителей P. tremula в Пермском крае по пяти изученным генам составила 1 SNPs на 92 нуклеотида, что на 13,0% выше чем в геноме P. trichocarpa и на 21,7% больше, чем в геноме P. nigra. Наибольшая частота SNPs в геноме P. tremula была выявлена в интронах (1 SNPs на 51 нуклеотид), в экзонах изученных пяти генов SNP не обнаружено.

6. С использованием предложенного нами подхода дана оценка состояния 7-ми изученных популяций и установлено, что в удовлетворительном состоянии находятся генофонды 6 из изученных в Пермском крае популяций P. tremula, а в одной популяции (Pt5) отмечены процессы обеднения популяционного генофонда.

7. На примере P. tremula разработана и предложена система молекулярно-генетической идентификации популяций древесных видов растений, в которой в молекулярно-генетическую формулу помимо традиционных идентификационных фрагментов ДНК (ISSR-PCR), вносятся позиции и частотные характеристики SNP-маркеров.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ Статьи в научных журналах, рекомендованных ВАК РФ 1. Боронникова С.В., Светлакова Т.Н., Бобошина И.В. Изучение генетического полиморфизма Populus tremula L. с использованием ISSR- и IRAP- маркеров // Аграрная Россия. 2009. №2. С. 20–22.

2. Светлакова Т.Н., Бобошина И.В., Нечаева Ю.С., Боронникова С.В.

Генетическая дифференциация популяций Populus tremula L. в Пермском крае на основании полиморфизма ISSR-маркеров// Аграрный вестник Урала. 2012.

Вып. 3(95) март. С. 11-13.

3. Светлакова Т.Н., Боронникова С.В. Бобошина И.В. Детекция однонуклеотидных замен (SNP) в геноме Populus tremula L. в Пермском крае // "Вестник биотехнологии и физико-химической биологии имени Ю.А.

Овчинникова". 2012. Т.8. №2. С. 42–46.

4. Светлакова Т.Н., Бобошина И.В., Боронникова С.В., Нечаева Ю.С.

Эколого-генетический анализ популяционной структуры Populus tremula L. в Пермском крае // Экологическая генетика. 2012. Вып. 3.

Публикации в других изданиях 1. Боронникова С.В., Тихомирова Н.Н., Светлакова Т.Н., Смирнова А.В., Кравченко О.С., Королева Ю.А., Рудина М.Н. Использование микросателлитов для анализа геномов редких видов растений // Нанотехнологии в сельском хозяйстве: Доклады Международной научно-практической конференции.– Москва, 2008. С. 107-108.

2. Светлакова Т.Н., Бобошина И.В., Королева Ю.А. Боронникова С.В.

Использование ДНК-технологий для оценки состояния популяций ресурсных видов растений // Нанотехнологии в сельском хозяйстве: Доклады Международной научно-практической конференции.–Москва, 2008.–С.109-110.

3. Светлакова Т.Н., Бобошина И.В., Боронникова С.В. ISSR-маркирование генома Populus tremula L. // Биотехнология начала III тысячелетия: Сборник тезисов Междунар. науч. конф. Саранск, 2010. С. 86.

4. Светлакова Т.Н. Сохранение генетического разнообразия Populus tremula L. посредством молекулярно-генетического анализа // Сборник тезисов III Всероссийского с международным участием конгресса студентов и аспирантов-биологов «Симбиоз-Россия 2010».Нижний Новгород, 2010. С. 110111.

5. Бобошина И.В., Боронникова С.В., Светлакова Т.Н. и др Молекулярногенетическая идентификация, штрихкодирование и паспортизация растений // Международная конференция с элементами научной школы для молодежи «ЕС – Россия: 7-я Рамочная программа в области биотехнологии, сельского, лесного, рыбного хозяйства и пищи» в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России».

Уфа, 2010. С. 65-67.

6. Светлакова Т.Н., Боронникова С.В., Бельтюкова Н.Н., Бобошина И.В.

Анализ генетического разнообразия популяций Populus tremula L. в Пермском крае // Международная конференция с элементами научной школы для молодежи «ЕС – Россия: 7-я Рамочная программа в области биотехнологии, сельского, лесного, рыбного хозяйства и пищи» в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России».

Уфа, 2010.С. 272-273.

7. Бельтюкова Н.Н., Боронникова С.В., Светлакова Т.Н., Бобошина И.В.

Технология оценки популяционных систем и генетических ресурсов редких и практически значимых видов растений // Антропогенная трансформация природной среды: материалы междунар. конференции.Пермь, 2010. Т. 3. С. 276282.

8. Боронникова С.В., Мандрица С.А., Кокаева З.Г., Суслонов А.В., Михеева О.В., Тихомирова (Бельюкова) Н.Н., Дрибноходова О.П., Светлакова Т.Н., Козьминых Т.В. Динамика генетического разнообразия и структуры популяционных систем ресурсных растений Пермского края при антропогенных воздействиях // Региональный конкурс РФФИ-Урал: Результаты научных исследований, полученные за 2007-2009 гг. Сборник статей Ч.2.

Пермь, Екатеринбург, 2010. С. 63-66.

9. Светлакова Т.Н., Бобошина И.В., Боронникова С.В. Молекулярногенетический анализ Populus tremula L. в Пермском крае // Симбиоз Россия 2011: материалы IV Всероссийского с международным участием конгресса студентов и аспирантов-биологов, Всероссийская биологическая ассоциация «Симбиоз Россия». Воронеж, 2011. С. 212-215.

10. Светлакова Т.Н., Боронникова С.В., Бобошина И.В. Генетическая структура популяций Populus tremula L. в Пермском крае // Материалы Третьего международного совещания по сохранению лесных генетических ресурсов Сибири. Красноярск, 2011. С. 126.

11. Светлакова Т.Н., Бобошина И.В., Бельтюкова Н.Н., Горохова Т.В., Боронникова С.В. Применение ISSR-маркирования в современных ботанических исследованиях // Материалы международной конференции молодых ученых «Актуальные проблемы ботаники и экологии». Киев, 2011. С.

201-202.

12. Боронникова С.В., Бельтюкова Н.Н., Светлакова Т.Н., Бобошина И.В.

Анализ полиморфизма ДНК на основе тандемных повторов геномов растений // Актуальные проблемы биологии, нанотехнологий и медицины: Мат-лы IV Междунар. науч.-практ. конф. Ростов-на-Дону, 2011. С. 44-45.

13. Боронникова С.В., Бельтюкова Н.Н., Светлакова Т.Н., Бобошина И.В., Нечаева Ю. С., Кольцов С.А. Анализ полиморфизма ДНК геномных маркеров растений с целью изучения биоразнообразия // Материалы международной научной конференции «Синтез знаний в естественных науках. Рудник будущего: проекты, технологии, оборудование». Пермь, 2011. С. 288-292.

14. Гринчук Н.В., Светлакова Т.Н., Рогозин М.В., Боронникова С.В. Оценка состояния осинников Пермского края // Вестник молодых ученых ПГНИУ: сб.

науч. тр.: в 2 т. / отв. ред. Е.Н. Батурин. Пермь, 2011. Т. 1. С. 206-213.

15. Светлакова Т.Н., Боронникова С.В., Бобошина И.В., Рогозин М.В.

Изучение генетического разнообразия популяций тополя дрожащего в Пермском крае // Материалы IV Всероссийской научно-практической конференции с международным участием «Биологические системы:

устойчивость, принципы и механизмы функционирования». Нижний Тагил, 2012. С. 161-163.

16. Светлакова Т.Н., Боронникова С.В., Бобошина И.В. Детекция однонуклеотидных замен (SNP) в генах биосинтеза лигнина РОPULUS TREMULA L. как модельная система молекулярной идентификации и отбора перспективных для плантационного выращивания древесных растений // Материалы международной конференции "Биология – наука ХХI века".

Москва, 2012.

СПИСОК ИСПОЛЬЗОВАННЫХ СОКРАЩЕНИЙ BLAST – Basic Local Alignment Search Tool C4H – trans-cinnamate 4-monooxygenase CAM – cell adhesion molecules F5H – flavonoid 3'-hydroxylase GH3-5 – GH3 family protein ISSR – Inter-Simple Sequence Repeats NCBI –National Center for Biotechnology Information Ptr4CL – P. trichocarpa 4-Coumarate:CoA ligase, SNPs – Single Nucleotide Polymorphisms UPGMA – unweighed pair-grup method using arithmetic average






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.