WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

на правах рукописи КОРНИЛОВ Александр Витальевич

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ДИАГНОСТИКА НАСЛЕДСТВЕННОГО РАКА ТОЛСТОЙ КИШКИ

14.01.12- онкология 03.01.04- биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата медицинских наук

Санкт-Петербург 2012

Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования «Санкт-Петербургском государственном медицинском университете имени акад. И.П. Павлова» Министерства здравоохранения Российской Федерации, Федеральном государственном бюджетном учреждении «Научно-исследовательский институт онкологии имени Н.Н. Петрова» Министерства здравоохранения Российской Федерации Научные руководители:

доктор медицинских наук Семиглазов Владислав Владимирович доктор медицинских наук, профессор Имянитов Евгений Наумович

Официальные оппоненты:

доктор медицинских наук Анисимов Валентин Вадимович ФГБУ «НИИ онкологии им. Н.Н.Петрова» Минздрава России, ведущий научный сотрудник отделения общей онкологии и урологии доктор биологических наук, профессор Комов Вадим Петрович Санкт-Петербургская государственная химико-фармацевтическая академия, заведующий кафедрой биохимии Ведущее научное учреждение:

Федеральное государственное бюджетное учреждение «Российский научный центр радиологии и хирургических технологий» Министерства здравоохранения Российской Федерации

Защита диссертации состоится «11» декабря 2012 г. в 14.00 часов на заседании диссертационного совета Д 208.052.01 при Федеральном государственном бюджетном учреждении «НИИ онкологии им. Н.Н. Петрова» Министерства здравоохранения Российской Федерации (197758, г. СанктПетербург, пос. Песочный-2, ул. Ленинградская, 68).

С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ онкологии им. Н.Н. Петрова» Минздрава России по адресу: 197758, г. Санкт-Петербург, пос. Песочный-2, ул. Ленинградская, 68.

Автореферат разослан « __ » __________ 2012г.

Ученый секретарь диссертационного совета, доктор медицинских наук Бахидзе Елена Вилльевна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Колоректальный рак в настоящее время занимает одну из лидирующих позиций среди онкологических заболеваний. В структуре онкологической заболеваемости в мире рак толстой кишки у мужчин занимает 3-е место, у женщин - 2-ое [Jemal A. et al,2011]. В 2009 году в структуре заболеваемости злокачественными новообразованиями в России колоректальный рак занял второе место, а в структуре смертности рак ободочной занял третье место, рак прямой кишки – четвертое [Чиссов В.И. и др., 2011].

Развитие колоректального рака в большинстве случаев носит спорадический характер [Fearnhead N.S. et al., 2002]. На долю наследственных раков толстой кишки приходится от 5 до 15 % всех новообразований толстой кишки [Park J.G., 2005].

Наиболее известными формами наследственного поражения толстой кишки являются семейный аденоматозный полипоз толстой кишки (FAP, familial adenomatous polyposys), частота развития рака, на фоне которого составляет около 100% и наследственный неполипозный рак толстой кишки, известный также как синдром Линча, (HNPCC, hereditary non-polyposis colorectal cancer).

Встречаемость HNPCC в популяции составляет 1:500 – 1:1000 [Rahner N. et al, 2010], что делает этот синдром одним из самых частых наследственных заболеваний. Средний возраст развития колоректального рака при HNPCC составляет около 45 лет [Lynch H.T. et al.,2006]. В основе патогенеза наследственного неполипозного рака толстой кишки лежит нарушение системы репарации неспаренных оснований ДНК (mismatch-репарации). В опухолевых клетках дефект репарации проявляется в виде нестабильности длины микросателлитных повторов (микросателлитной нестабильности, MSI) [Vasen HF. et al., 2005].

К настоящему времени идентифицировано 7 основных генов, ассоциированных с развитием синдрома Линча: hMLH1, hMSH2, hMSH6, hPMS1, hPMS2, hMSH3 и EXO1. Основная доля мутаций (около 90%) приходится на гены hMLH1 и hMSH2, тогда как hMSH6 и PMSзатрагиваются нечасто и, как правило, ассоциированы с менее выраженным семейным анамнезом [Peltomki P. et al, 2004]. Кроме того, у некоторых пациентов, соответствующих критериям HNPCC, вообще не удается обнаружить мутации в известных MMR-генах [Muller A.

et al, 2004].

Диагностика наследственного неполипозного рака толстой кишки представляет собой непростую задачу, и складывается из тщательного анализа семейной истории с последующим проведением молекулярно-генетического тестирования.

Первым этапом молекулярно-генетической диагностики обычно является тест образца опухолевой ткани, полученной в ходе биопсии или операции, на микросателлитную нестабильность (MSI). Согласно данным литературы, тест на MSI оказывается положительным более чем в 90% случаев синдрома Линча [Vasen HF. et al., 2005].Примерно в 8-15% cпорадических случаев колоректального рака MSI-тест также может быть позитивным. Именно поэтому выявление микросателлитной нестабильности, хотя и указывает на возможное наличие наследственного неполипозного рака толстой кишки, тем не менее, не является абсолютным и достоверным признаком этой формы рака [Bubb V.J. et al., 1996].

Вместе с тем, наличие MSI является показанием к поиску герминогенных мутаций в генах репарации. Лишь выявление таких наследственных повреждений позволяет с уверенностью поставить диагноз наследственного неполипозного рака толстой кишки.

В западных странах, такой подход к диагностике HNPCC- синдрома активно воплощается в жизнь. В Российской Федерации, напротив, алгоритмов диагностики наследственного неполипозного рака толстой кишки до настоящего времени не существует. Данная проблема является особенно актуальной, ввиду того, что пациенты с синдромом Линча, в отличие от спорадического колоректального рака, имеют более благоприятный прогноз, небольшую частоту метастазирования, свои особенности чувствительности к различным группам химиопрепаратов. Поэтому ранняя диагностика у данной категории пациентов позволяет надеется на полное излечение от заболевания.

Отдельной проблемой является разработка программ мониторинга за родственниками пациентов с наследственным неполипозным раком толстой кишки. Известно, что кумулятивный (накопленный) риск развития рака у родственников из семьи с наследственным неполипозным раком толстой кишки в возрасте до 70 лет составляет 91% для мужчин и 69% для женщин. Риск заболеть раком толстой кишки у мужчин в 2 раза выше, чем у женщин (74% против 30%). У женщин из этих семей риск развития рака эндометрия составляет 42% [Гарькавцева Р.Ф. и соавт., 2001].

Следует отметить, что до настоящего времени, в доступной нам литературе, нет оценки спектра наследственных мутаций в генах MMR у пациентов, соответствующих клиническим критериям HNPCC, в популяции Российской Федерации.

Все вышеизложенное и послужило мотивом проведения настоящего исследования.

Цель исследования Выявить зародышевые мутации в генах, определяющие развитие наследственного рака толстой кишки, для разработки новых методов ранней диагностики и скрининга колоректального рака.

Задачи исследования:

1) Сформировать коллекцию архивных образцов, полученных от больных с опухолями толстой кишки молодого возраста 2) Провести предварительный отбор пациентов с подозрением на наследственный характер заболевания при помощи теста на микросателлитную нестабильность 3) В образцах РТК с микросателлитной нестабильностью произвести анализ «founder» мутаций в генах мисматч-репарации ДНК 4) Сформировать диагностическую панель для выявления случаев наследственного РТК 5) Провести скрининг родственников пациентов с наследственным неполипозным раком толстой кишки, с целью выявления у них герминогенных мутаций.

Научная новизна работы В работе впервые на большом материале было осуществлено выявление герминогенных мутаций, ответственных за возникновение наследственного неполипозного рака толстой кишки, в популяции Российской Федерации. Впервые выявлена зародышевая мутация в экзоне гена МSH2 - N139 fsX (c.415-416delAA),ранее не описанная в мировой литературе.

Научно- практическая значимость работы Разработаны алгоритмы диагностики наследственного неполипозного рака толстой кишки и программа мониторинга за родственниками пациентов с HNPCC-синдромом, что важно для своевременной диагностики и профилактики колоректального рака.

Основные положения, выносимые на защиту:

Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки основана на тщательном отборе пациентов для генетического анализа с проведением теста на микросателлитную нестабильность с последующим ДНК-секвенированием кодирующей последовательности генов mismatchрепарации ДНК (hMLH1, hMSH2) с целью выявления в них герминогенных мутаций у MSI-позитивных пациентов Генетическое консультирование кровных родственников пациентов с HNPCC- синдромом включает в себя поиск зародышевой мутации, выявленной у пациента, с последующим составлением индивидуальных рекомендаций по профилактическому обследованию и диспансерному наблюдению.

Апробация работы:

Результаты работы были представлены на 434-ом заседании научного общества онкологов Санкт-Петербурга и Ленинградской области (26 мая 2011 года), на 7-ой Российской конференции по фундаментальной онкологии (22 апреля 2011г), на объединенной научной конференции отделения абдоминальной онкологии, отделения торакальной онкологии, отделения урологии, отделения биотерапии и трансплантации костного мозга, отделения детской онкологии, химиотерапевтического отделения ФГБУ НИИ онкологии им. Н.Н. Петрова Минздравсоцразвития совместно с кафедрой онкологии Медицинской Академии Последипломного Образования (МАПО) (Санкт-Петербург, 2011г).

Структура и объём диссертации Диссертация написана на русском языке и состоит из введения, обзора литературы, результатов собственных исследований, обсуждения, выводов, практических рекомендаций и списка литературы.

Объём диссертационной работы составляет 107 страницы машинописного текста, таблицы и 7 рисунков. Библиографический указатель включает 134 источников, в том числе 6 отечественных и 128 зарубежных.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования Работа основана на ретроспективном анализе данных о 672 первичных больных раком ободочной кишки, подвергшихся хирургическому лечению в ФГБУ НИИ онкологии им.

Н.Н.Петрова Минздравсоцразвития в период с 1999 по 2009 год.

В исследуемой группе - 653 (97,2%) больных с солитарными формами и 19 пациентов с первично-множественными формами новообразований ободочной кишки (2,8%).

Распределение по возрасту составило от 19 до 85 лет. Отмечено, что подавляющее большинство больных находилось в возрастной группе старше 50 лет (88,4%), в то время, как доля больных, возраст, которых был менее 50 лет, составила лишь 11,6%.

В исследуемой группе количество мужчин было - 247 (37%), а женщин -425 (63%).

Все больные данной выборки, подвергались хирургическому лечению: правосторонняя гемиколэктомия-172(25,6%),левосторонняя гемиколэктомия- 81 (12%), резекция поперечной ободочной- 27(4%), внутрибрюшная резекция сигмовидной кишки-208(31%), операция Гартмана-12 (1,8%), субтотальная колэктомия -4(0,8%), эндоскопическая полипэктомия -15(2,2), эксплоративные и симптоматические операции- 153 (22,8%).

Распределение больных в зависимости от гистологического строения опухолей производилось в соответствии с Международной гистологической классификацией опухолей кишечника [Morson B.C., 1981]. У всех пациентов при гистологическом исследовании опухоли были представлены аденокарциномами различной степени дифференцировки, при этом, большинство злокачественных новообразований имело умеренную и низкую степень дифференцировки: высокодифференцированная аденокарцинома- 100 (15%), умереннодифференцированная - 370 (55%), низкодифференцированная аденокарцинома - 1(25%), недифференцированный рак - 34 (5%).

Стадия опухолевого процесса определялась согласно Международной классификации злокачественных опухолей по системе TNM (издание шестое, дополненное, исправленное, 2003). Стадия I (T1-2N0M0) - 80 (12%), II (T3-4N0M0) - 215 (32%), III (любая TN1-2M0) - 1(26%), IV (любая T,любая N, M1) - 202 (30%).

Для формирования группы пациентов, нуждающейся в проведении молекулярно-генетической диагностики наследственного неполипозного рака толстой кишки, нами была использована информация, содержащаяся в историях болезни.

Отбор группы больных для проведения углубленной генетической диагностики, с целью выявления случаев HNPCC-синдрома, осуществлялся на основании наличия у них основных клинических факторов риска развития наследственного синдрома (Амстердамские критерии, критерии Бетезды) [Vasen H.F. et al., 1999; Umar A. Et al., 2004]:

1. Молодой возраст возникновения заболевания (до 50 лет) 2. Наличие трёх или более родственников с HNPCC- ассоциированными опухолями (рак толстой кишки, рак эндометрия, рак тонкого кишечника, желудка, яичников, уретры, почечной лоханки, синдром Тюрко или синдром Мюирр–Торре) 3. Заболевание должно встречаться более, чем в одном поколении, не меньше чем один из заболевших, должен быть родственником первой степени родства по отношению к остальным двум.

4. Первично- множественный характер злокачественных новообразований 5. Семейный аденоматозный полипоз должен быть исключен.

Таким образом, из 672 больных, нами были сформированы группы: 1) пациенты с одним из клинических критериев (молодой возраст до 50 лет)- 78 (11,6%), 2) группа больных с двумя критериями – 25 (3,7%), 3) группа пациентов с тремя и более критериями - 16 (2,4%).

Руководствуясь опытом предыдущих исследований, которые показали, что ни один из клинических критериев в отдельности не является абсолютным и направление на генетическую консультацию целесообразно только при наличии не менее трех клинических факторов [Егоренков В.В. и соавтр.,2008], нами для проведения генетической диагностики была использована последняя группа пациентов.

Материалом для исследования послужили парафиновые блоки опухолевой ткани, хранящиеся в архиве патоморфологии ФГБУ НИИ онкологии им. Н.Н. Петрова Минздравсоцразвития.

Первым этапом молекулярно-генетической диагностики HNPCC-синдрома являлся лабораторный тест на микросаттелитную нестабильность с использованием панели мононуклеотидных маркеров BAT25, BAT26 и BAT40. Согласно данным литературы, тест на MSI оказывается положительным более чем в 90 % случаев при наследственном неполипозном раке толстой кишки [Muller A. et al., 2004].

Вторым этапом, MSI- положительные случаи были подвергнуты углубленной генетической диагностике на наличие герминогенных мутаций. Нами исследованы 2 гена из группы генов репарации ДНК- MLH1 (19 экзонов) и MSH2 (16 экзонов). На основании статистических данных, 70% герминогенных мутации приходятся на долю генов MLH1 и MSH2 [Munoz J.C. et al., 2009].

Молекулярно - генетические методики исследования.

Выделение ДНК Выделение тотальной ДНК из парафиновых срезов проводилось посредством оптимизированного экспресс-протокола, разработанного в НИИ онкологии им.Н.Н. Петрова [Imyanitov et al., 2001], с использованием протеиназы К (AMRESCO, USA). Срезы опухолевой ткани депарафинизировались в двух сменах ксилола по 5 минут. Затем образцы промывались в двух сменах 96% этанола по 2 минуты. После тщательного удаления этанола к тканям добавлялся лизирующий буфер (10 ммоль Tris-HCl (pH=8.0), 0.1 ммоль ЭДТА; pH=8.0, 2% натрия додецилсульфат) и протеиназа К (20мг/мл). Инкубация образцов проводилась при t=60С в течение 8-16 часов до полного лизиса тканей. Далее проводилась фенол-хлороформная экстракция. К лизату добавлялся однократный объем нейтрального фенола и 0,3 объема смеси хлороформ-изоамиловый спирт (24:1). После интенсивного встряхивания пробирки в течение 10 минут пробы центрифугировались при 15000g в течение 20 минут. Затем надосадочная жидкость (супернатант) отбиралась в чистые пробирки, в которые добавляли 0,1 объема 3М ацетата Na (pH=4.0), 0,3 объема хлороформа. После интенсивного встряхивания образцы центрифугировались при 15000g в течение 20 минут. Cупернатант отбирался в чистые эппендорфы. К пробам добавлялся раствор гликогена (20 мг/мл) в качестве коосадителя и объем холодного изопропанола. Пробы оставлялись не менее чем на 3 часа при -20С. Затем пробирки центрифугировались при 15000g в течение 30 минут. Изопропанол удалялся, а полученный осадок однократно промывался в 70% этаноле в течение 10 минут. После тщательного удаления этанола осадок подсушивался в термостате при 40С, а затем растворялся в 30 мкл стерильной воды при 65С в течение 10 минут. Раствор ДНК хранился при -20С до использования в ПЦР.

Детекция микросателлитной нестабильности Феномен микросателлитной нестабильности детектировался с использованием панели квазимономорфных мононуклеотидных маркеров BAT25, BAT26 и BAT40.

Последовательности праймеров, использованных для детекции MSI приведены ниже:

BAT25-F-5’-TCGCCTCCAAGAATGTAAGT-3’;

BAT25-R-5’- TCTGCATTTTAACTATGGCTC-3’;

BAT26-F-5’-TGACTACTTTTGACTTCAGCC-3’;

BAT26-R-AACCATTCAACATTTTTAACCC-3’;

BAT40-F-5’-ATTAACTTCCTACACCACAAC-3’;

BAT40-R-GTAGAGCAAGACCACCTTGTCTC-3’.

ПЦР проводилась в конечном объеме 10 мкл. Каждая реакция содержала 1 мкл раствора ДНК, 0.5 ед. ДНК-полимеразы, 1Х ПЦР-буфер (pH 8.3), 2.5 мМ MgCl2, 200 мкМ каждого из четырех нуклеотидтрифосфатов, 0,3 мкМ прямого и обратного праймеров. Использовались следующие условия реакции: стартовая 10-минутная активация Taq-полимеразы при 950C; 45 циклов амплификации (денатурация: 15 сек при 950C; отжиг: 30 сек при 600C; элонгация 30 сек при 720C). Полученный продукт разделяли методом электрофореза в 10% полиакриламидном геле.

Электрофоретическое разделение в полиакриламидном геле Для анализа результатов ПЦР, полученный амплификат (весь объем) подвергали электрофоретическому разделению в 10% полиакриламидном геле (ПААГ). В качестве электрофоретического буфера использовался 1хТрис-боратный ЭДТА буфер (ТВЕ). Чтобы предотвратить всплывание проб при нанесении на гель, в них добавляли по 3-5 мкл наслаивающего буфера. Разделение фрагментов осуществлялось в электрофоретических камерах размером 20х15 см, при силе тока 160-210 мА.

Окрашивание полиакриламидных гелей Гели окрашивали раствором бромистого этидия (0,5 мкг/мл) в течение 7-10 минут, а затем промывали гели в 1х ТВЕ буфере в течение 15-20 минут. В результате этой процедуры фрагменты ДНК в геле становились видимыми в ультрафиолетовом свете (=300 нм). Для просмотра в ультрафиолетовом свете и фотографирования использовался трансиллюминатор (Vilber Lourmat, France). Позитивным считался образец, демонстрирующий изменение длины одной или нескольких микросателлитных последовательностей.

Высокоразрешающее плавление Высокоразрешающее плавление (HRM) проводилось с помощью прибора CFX96 (Bio-Rad, USA), а также RotorGene6000 (Corbett Research, Australia) непосредственно после проведения реакции ПЦР со специфическими праймерами с целью скрининга MSI позитивных образцов на наличие мутаций в генах MLH1 и MSH2 ПЦР проводилась в конечном объеме 20 мкл. Каждая реакция содержала 1 мкл раствора ДНК, 0.5 ед. ДНК-полимеразы, 1Х ПЦР-буфер (pH 8.3), 2.мМ MgCl2, 200 мкМ каждого из четырех нуклеотидтрифосфатов, 0,3 мкМ прямого и обратного праймеров, 20X краситель Eva Green. Использовались следующие условия реакции: стартовая 10-минутная активация Taq-полимеразы при 950C; 45 циклов амплификации (денатурация: сек при 950C; отжиг: 30 сек при 600C; элонгация 30 сек при 720C). Продукт ПЦР подвергался высокоразрешающему плавлению. Оценка формы кривой плавления проводилась при помощи программного обеспечения прибора RotorGene6000 и CFX96 (Precision Melting Analysis). При выявлении деформации кривой плавления, пиков плавления, выраженных отличий от контрольных образцов дикого типа продукт реакции подвергался секвенированию.

Секвенирование ДНК Секвенирование проводилось с помощью набора GenomeLab DTCS Quick Start Kit (Beckman Coulter, USA) согласно рекомендациям производителя.

Продукт реакции секвенирования после преципитации этанолом разбавлялся в 40 мл SLS (Sample Loading Solution, Beckman Coulter, USA) и подвергался капиллярному электрофорезу в системе генетического анализа CEQ 8000 (Beckman Coulter, USA).

Детекция замены V600E в гене BRAF Детекция замены V600E в гене BRAF проводилась методом аллель-специфической ПЦР в режиме реального времени с использованием следующих праймеров:

B-RAF-wt GGTGATTTTGGTCTAGCTACAGT (аллель дикого типа);

B-RAF-mut GGTGATTTTGGTCTAGCTACAGA (мутантный аллель);

B-RAF-R ATAGCCTCAATTCTTACCATCC (общий праймер).

ПЦР в режиме реального времени проводилась на оборудовании iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, USA) и состояла из 50 циклов (денатурация: сек при 950C; отжиг: 30 сек при 630C; синтез: 30 сек при 720C). Каждая ПЦР-реакция (суммарный объем 20 мкл) содержала 1 мкл раствора ДНК, 1,0 ед. ДНК-полимеразы, 1кратный ПЦР-буфер (pH 8.3), 2.5 мМ MgCl2, 200 мкМ каждого из нуклеотидтрифосфатов, 0,мкМ каждого праймера, SYBR green I в концентрации 0,2х (исходный раствор 10 000x;

Molecular Probes, USA).

Генетическое консультирование Во второй части нашего исследования было произведено генетическое консультирование кровных родственников пациентов с найденными у них герминогенными мутациями.

Материалом для генетического исследования являлась венозная кровь родственников пациентов.

Методика выделения ДНК из периферической крови Выделение ДНК из периферических лейкоцитов крови проводилось при помощи модифицированного соль-хлороформного метода. Для гипоосмотического лизиса эритроцитов препараты крови разводились в 3 раза водой. Затем осуществляли осаждение лейкоцитов посредством центрифугирования. Лейкоциты ресуспендировали в 1 мл Трис-HCl (pH = 8.3), mM ЭДТА. Для разрушения плазматической мембраны клеток к суспензии добавляли Тритон Х-100 до концентрации 1%. Ядра осаждали центрифугированием, ресуспендировали в 1 мл Трис-HCl (pH = 8.3), 1 mM ЭДТА и лизировали посредством добавления додецилсульфата натрия до концентрации 0.5%. Частичный протеолиз белков осуществлялся в присутствии протеиназы K (100 мкг/мл) при температуре 65оС в течение 12 часов. Затем к препарату добавляли раствор NaCl до конечной концентрации 1.5 М и равный объём хлороформа.

Экстракция органическим растворителем проводилась в течение 30 мин. при медленном покачивании, и приводила к удалению нерастворимых компонентов клеток, белков и липидов.

После центрифугирования ДНК, содержащуюся в водной фазе, переосаждали 2 объёмами 96% этанола; осадок промывали 70% этанолом и растворяли в растворе ТЕ до концентрации мкг/мкл.

Всем исследуемым выполнялось ДНК-секвенирование кодирующей последовательности генов mismatch-репарации (hMLH1, hMSH2), результаты сообщались при проведении повторной консультации, давались подробные рекомендации по обследованию и диспансерному наблюдению.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ В исследуемую группу были включены пациенты с наличием у них трёх и более клинических критериев наследственного неполипозного рака толстой кишки. Данная выборка состояла из пациентов, с отягощенным наследственным анамнезом, что составило, 2,4 % от общей группы проанализированных больных.

Первым этапом молекулярно-генетической диагностики наследственного неполипозного рака толстой кишки являлся лабораторный тест на микросаттелитную нестабильность.

Из 16 исследуемых случаев, тест на микросателлитную нестабильность оказался положительным в 10 (62,5%). Нами оценивался MSI- статус на основании исследования трёх мононуклеотидных маркеров BAT25, BAT26 и BAT40: один нестабильный маркер, расценивался как MSI-L (MSI-low), более одного- MSI-H (MSI-high) и отрицательный тест с использованием всех трёх маркеров, как MSI-S (MSI-stable).MSI-H - у 7 пациентов (43,75%), MSI- L - у 3 (18,75%) больных, MSI-S- у 6 (37,5%) больных.

Национальный институт изучения рака (National Cancer Institute) в 1998 году предложил использовать в диагностике наследственного неполипозного рака толстой кишки панель из маркеров (2 мононуклеотидных: ВАТ-26 и ВАТ-25 и 3 динуклеотидных маркера- D2S123, D5S346 и D17S250) [Boland et al., 1998], однако ряд исследователей говорят о возможности использования в диагностике лишь одного мононуклеотидного маркера: ВАТ 26 [Brennetot C.

et al, 2005; Laghi L. et al, 2004].

Результаты теста на микросаттелитную нестабильность представлены в таблице 1.

Частота встречаемости феномена микросаттелитной нестабильности в исследуемой группе Таблица № образца Маркер Маркер Маркер MSI ВАТ 26 ВАТ 25 ВАТ 40 Статус 1 SHIFT N N MSI-L 2 N N N MSI-S 3 SHIFT N N MSI-L 4 N N N MSI-S 5 SHIFT N SHIFT MSI-H 6 N N N MSI-S 7 SHIFT SHIFT SHIFT MSI-H 8 SHIFT N SHIFT MSI-H 9 SHIFT N SHIFT MSI-H 10 N N N MSI-S 11 SHIFT SHIFT SHIFT MSI-H 12 N N N MSI-S 13 SHIFT SHIFT SHIFT MSI-H 14 N N N MSI-S 15 N N SHIFT MSI-L 16 SHIFT SHIFT N MSI-H N - нет укорочения маркера; SHIFT - укорочение маркера.

В общей сложности, с целью детекции уровня MSI, проведено 48 ПЦР-реакций.

Проанализирована частота положительных уровней различных мононуклетидных маркеров в исследуемой группе пациентов (таблица 2).

Частота положительных реакций при использовании различных мононуклеотидных маркеров Таблица Мононуклеотидный маркер Количество положительных ответов ВАТ 26 9 (56,25%) ВАТ 25 4 (25%) ВАТ 40 7 (43,75%) Из представленной таблицы видно, что максимальное количество положительных ответов было при использовании мононуклеотидного маркера ВАТ 26. Это может служить подтверждением возможности использования в определении уровня микросателлитной нестабильности одного маркера.

Пример положительного теста на микросаттелитную нестабильность представлен на рисунке 1.

Рисунок Микросателлитная нестабильность по маркеру BAT-1 – маркер молекулярного веса; 2-4 – образцы без микросателлитной нестабильности; 5 – образец с микросателлитной нестабильностью (пациент 16); - – негативный контроль.

Следующим этапом молекулярно-генетической диагностики наследственного неполипозного рака толстой кишки являлся поиск герминогенных мутаций в генах mismatch-репарации ДНК (hMLH1, hMSH2).

Для второго этапа были использованы только MSI- позитивные случаи (10 пациентов). В начале, производилось высокоразрешающее плавление, непосредственно после проведения реакции ПЦР со специфическими праймерами, с целью детекции герминальных мутаций в генах hMLH1 и hMSH2. При выявлении деформации кривой плавления, пиков плавления, выраженных отличий от контрольных образцов дикого типа продукт реакции подвергался секвенированию.

В завершении, проводилось секвенирование кодирующей последовательности ДНК, с целью выявления зародышевых мутаций.

Нами исследованы два основных гена mismatch-репарации ДНК: MLH1 (c 1ого по 19ый экзон) и МSH2 (c 1ого по 16ый экзон), а также участки интронов, содержащие сайты сплайсинга. По данным литературы, 70% герминогенных мутаций приходится именно на эти гены [Munoz J.C.,2009].

С целью подтверждения наследственного характера мутаций, кроме опухолевой ткани, нами были исследованы здоровые ткани пациентов (лимфатические узлы, жировая ткань). В случае обнаружения мутаций, как в опухолевой, так и здоровой ткани, подтверждался наследственный характер, выявленной мутации.

Ген hMLH1.

Ген представлен 19 экзонами, 757 кодонами (57358 нуклеотидных пар, кодирует белок из 7аминокислот). Хромосомная локализация: 3р22.3.

В результате секвенирования кодирующей последовательности гена hMLH1,нами обнаружено 2 герминогенных мутации: 1) мутация в экзоне 8 -R226L (с.677 G>T) в случае №и 2) мутация в экзоне 17 - R659X (c.1975 C>T) в случае № 5.

Кроме этого, выявлена одна соматическая мутация в экзоне 8 - R226Q в случае № 9.

В ряде случаев обнаружены полиморфизмы: экзон 1 - M1k в случаях № 5 и №11; в экзоне 8 - I219V в случаях №5, №8 и №11; экзон 11 - I321I в случае №13.

В 4 случаях выявлен SNP (Single nukleotid polymorphism) - экзон 6 в случае №7, экзон 15 в случаях №1,7,8.

Выявленные SNP и полиморфизмы в ходе секвенирования гена MLH1 не несут какого-либо функционального значения.

Ген hMSH2.

Ген MSH2 включает 16 экзонов, 935 кодонов (171925 нуклеотидных пар) и кодирует белок, состоящий из 934 аминокислотных остатков. Хромосомная локализация 2p22. На долю данного гена приходится наибольшее количество герминогенных мутаций (45-50%).

В ходе проведенного ДНК-секвенирования кодирующей последовательности гена MSHнами были обнаружены 3 герминогенные мутации:

1) мутация 3 экзона - N139 fsX (c.415_416 del AA) в случае №2) мутация 12 экзона - A636P (с.1906 G>C) в случае №3) мутация 15 экзона - E878fsX3 (с.2633_2634 delAG) в случае №Кроме того, в одном случае в экзоне 1 был обнаружен полиморфизм К29К (№8) и в трех случаях выявлены SNP - 10 экзон (случаи №1, №8 и №15).

Подводя итог, надо сказать, что из 10 MSI- положительных образцов в 5 случаях (50%), были обнаружены герминогенные мутации.

Пример результата высокоразрешающего плавления (HRMA) представлен на рисунке 2.

Рисунок 2.

Высокоразрешающее плавление (HRMA) ПЦР-продукта экзона 12 гена hMSH2 пациента №mut – кривая плавления образца с мутацией; wt – кривая плавления контрольных образцов без мутации.

Пример ДНК-секвенирования кодирующей последовательности гена hMSH2 (пациент №16) представлен на рисунке 3.

Рисунок Нуклеотидная замена с.1906 G>C (A636P) в гене hMSHВ. Нуклеотидная замена с.1906 G>C (A636P) в гене hMSH2. C. Образец ДНК здорового донора.

Результаты генетической диагностики представлены в таблице 3.

Обнаруженные герминогенные мутации в генах MLH1 и MSHТаблица № Наследственный анамнез MSI-статус Мутации Мутации в гене MLH1 в гене MSH1 У бабушки рак толстой кишки, у MSI-L Нет Нет тети рак молочной Железы 2 У матери множественные полипы MSI-S Нет Нет толстой кишки, у бабушки по материнской линии - рак прямой кишки 3 У бабушки по материнской линии- MSI-L 8 экзон Нет рак яичников, у прабабушки- рак R226L молочной железе (с.677 G>T) 4 У отца- рак толстой кишки, MSI-S нет Нет у бабушки рак поджелудочной железы 5 У мамы- метахронный рак толстой MSI-H 17 экзон Нет кишки, у бабушки - рак толстой R659X кишки и рак эндометрия, у сестры (c.1975 C>T) бабушки- рак толстой кишки, у брата- рак толстой кишки 6 У мамы рак прямой кишки, MSI-S нет Нет у дяди рак печени 7 У отца- рак прямой кишки, MSI-H нет 15 экзон у тети- рак почки E878fsX (с.2633_26delAG) 8 У тети по материнской MSI-H нет Нет линии- рак желудка, у бабушки рак прямой кишки 9 У матери- рак MSI-H нет Нет прямой кишки, у прабабушки- рак пищевода 10 У отца- рак печени, у MSI-S нет Нет матери- рак желудка и рак молочной железы, у бабушки рак кожи 11 У матери- MSI-H нет 3 экзон рак прямой кишки, у бабушки рак N139 fsX поджелудочной железы (c.415_416 del AA) 12 У отца–рак желудка MSI-S нет Нет У матери– рак молочной железы, у дедушки рак мозга 13 У отца кардиоэзофагеальный рак, у MSI-H нет Нет деда- рак прямой кишки 14 У тети- рак желудка MSI-S нет Нет 15 У бабушки - рак тела матки MSI-L нет Нет 16 У отца рак желудка, у деда отца- MSI-H нет 12 экзон рак толстой кишки, у сестры отца - A636P рак толстой кишки и рак матки, у (с.1906 G>C) двоюродной сестры- рак шейки матки Второй частью нашего исследования являлось генетическое консультирование родственников пациентов с подтвержденным у них диагнозом наследственного неполипозного рака толстой кишки.

Для проведения генетического тестирования нами были приглашены родственники из четырех семей, информация о родственниках пятого пациента, с диагностированным диагнозом синдрома Линча, отсутствовала.

Первым этапом, произведено информирование о высоком риске развития наследственного неполипозного рака толстой кишки, в случае наследования герминогенной мутации. Получено добровольное информированное согласие на проведение генетической диагностики.

Вторым этапом, произведен углубленный сбор анамнеза с акцентированием факта наличия злокачественных новообразований у кровных родственников в нескольких поколения.

Материалом для исследования послужила периферическая кровь обследуемых.

Результаты генетической диагностики членов семей пациентов с наследственным неполипозным раком толстой кишки представлены в таблице 4.

Таблица Результаты генетической диагностики родственников пациентов с HNPCC- синдромом.

Пациент Родственники Результат генетического тестирования №5 Мать (73 года) MLH1 17 экзон R659X Мутация (c.1975 C>T) MLH1 Дочь (14 лет) MLH1 17 экзон R659X 17 экзон (c.1975 C>T) R659X (c.1975 C>T) №7 Брат (43 года) MSH 2 15 экзон MSH2 15 экзон E878fsX3 (с.2633_2634 delAG) E878fsXСын брата (15 лет) Wild type (с.2633_26Мутация не обнаружена delAG) №11 Брат отца (75 лет) Wild type MSH2 Мутация не обнаружена 3 экзон N139 fsX Сын брата отца (38 лет) Wild type (c.415_416 del Мутация не обнаружена AA) №16 Дочь (22 года) Wild type MSH 2 12 экзон Мутация не обнаружена A636P Тетя по отцовской линии MSH 2 12 экзонA636P (с.1906 G>C) (59 лет) (с.1906 G>C) Двоюродная сестра (38 лет) MSH 2 12 экзонA636P (с.1906 G>C) Полученные результаты генетического риска были сообщены исследуемым родственникам, с каждым проведена индивидуальная беседа, даны подробные рекомендации о динамическом наблюдении и сроках необходимого обследования. Данные о пациентах и их родственниках занесены в созданный реестр семей с наследственным неполипозным раком толстой кишки.

Функциональная значимость обнаруживаемых мутаций не всегда очевидна, особенно в случае мутаций, не ведущих к появлению стоп-кодонов. Для выяснения этого вопроса помимо анализа литературы использовалась информация, специализированных баз данных: InSiGHT (International Society for Gastrointestinal Hereditary Tumors) http://www.insightgroup.org/mutations/ и Mismatch Repair Genes Variant Database http://www.med.mun.ca/mmrvariants/.

Мутация А636P является известным «founder»-вариантом, возникшим около 200-500 лет назад в популяции евреев Ашкенази [Sun S. et al., 2005]. Замена аланина на пролин в АТФазном домене нарушает связывание белка с неспаренными основаниями. Это повреждение имеет популяционную частоту 0,4-0,7% [Mukherjee B. Et al.,2011] и встречается более чем у 1% неселектированных больных раком эндометрия [Barak F. et al., 2010] и в 7% случаев раннего рака толстой кишки [Guillem J.G. et al.,2004]. Данная мутация многократно увеличивает риск развития колоректального рака и рака эндометрия в течение жизни, поэтому в группе евреев восточно-европейского происхождения целесообразен скрининг с целью выявления носителей.

Мутация hMLH1 R226L - описана впервые в 1996 году, обнаружена в ряде европейских стран, в частности встречается в польской, итальянской популяциях и в популяции Словакии.

Результаты функциональных тестов и оценки in silico предполагают, что данная мутация может дестабилизировать конформацию белка [Takahashi M. et al., 2007].

Патогенность остальных трех обнаруженных мутаций (hMLH1 R659X, hMSH2 E878fsX3, hMSH2 N139fsX) не вызывает сомнений, т.к. их последствием является преждевременная терминация синтеза белка.

Мутация экзона 17 гена MLH1- R659X - первое описание приходится на 1996 год, описаны случаи в популяциях Финляндии, Великобритании, США и Индии; мутация экзона 15 гена МSH2- E878fsX3 - впервые описана в 1995 году, данная мутация наиболее часто встречается в популяции Японии.

При этом мутация в 3 экзоне гена МSH2 - N139 fsX (c.415-416delAA) ранее в литературе не описана.

Таким образом, мутации, ответственные за развитие наследственного опухолевого синдрома, выявлены в половине MSI-позитивных случаев. У остальных пациентов заболевание могло быть связано с повреждением других генов системы репарации (hMSH6, PMS2 и др.).

Кроме того, нельзя исключить наличие более масштабных повреждений hMLH1 и hMSH(делеции и дупликации одного или нескольких экзонов), которые не могут быть детектированы секвенированием. Для проверки такой возможности необходимо применение таких методов диагностики как MLPA (Multiple Ligation-dependent Probe Amplification).

Учитывая большие размеры России и разнообразие народностей, которые ее населяют, любопытным фактом является наличие в нашей стране выраженного «эффекта основателя». В частности, анализ BRCA мутаций у женщин c признаками наследственного рака молочной железы и яичников, показал, что в различных, удаленных друг от друга регионах России преобладает одна и та же мутация - 5382insC в гене BRCA1 [Sokolenko A.P. et al.,2007 Suspitsin E.N. et al.,2009]. Ожидалось, что и для пациентов с HNPCC удастся обнаружить повторяющиеся варианты, однако в нашем исследовании все обнаруженные мутации уникальны, что можно объяснить небольшим числом наблюдений.

Конечной целью медико-генетического консультирования пациентов с HNPCC является выявление мутации, ответственной за развитие заболевания в данной семье и разъяснение риска развития новообразований взрослым членам семьи. Если генетическое повреждение выявлено у больного, становится возможным пресимптоматическое тестирование ближайших родственников на предмет наследования этой мутации. При обнаружении мутации можно говорить о чрезвычайно высокой вероятности развития опухолевого синдрома (не менее 80%) в течение жизни [Strate L.L. et al., 2005]. Поэтому таким лицам необходимо рекомендовать комплекс мероприятий, направленных на максимально раннюю диагностику опухолей HNPCCспектра.

Кроме того, при лечении пациентов с HNPCC следует учитывать некоторые особенности течения заболевания, такие как относительно благоприятный прогноз, небольшая вероятность метастазирования, низкая чувствительность к терапии фторпиримидинами и хороший ответ на лечение иринотеканом [Gryfe R. et al, 2000; Fallik D. еt al., 2003].

Генетическая диагностика наследственного неполипозного рака толстой кишки в настоящее время представляет собой непростую задачу. Сложности связаны с целым рядом факторов (большое количество генов, ассоциированных с развитием синдрома; необходимость анализа всей последовательности этих генов; отсутствие выраженного «эффекта родоначальника»).

Использование методики высокоразрешающего плавления ПЦР-продуктов (HRMA) является перспективным подходом к поиску наследственных мутации в генах репарации ДНК у пациентов с клиническими признаками HNPCC и наличием микросателлитной нестабильности.

Полученные данные совместно с литературными данными позволяют предложить алгоритм диагностики наследственного неполипозного рака толстой кишки (Рисунок 4):

Рисунок Алгоритм диагностики наследственного неполипозного рака толстой кишки Рак ободочной кишки Амстердамские критерии I, II; критерии Бетезды Наличие трёх и Отсутствие критериев более критериев Спорадический колоректальный рак Тест на микросателлитную нестабильность (MSI) MSI (-) MSI (+) Высокоразрешающее плавление (HRMA) ДНК- секвенирование кодирующей последовательности MMR генов (hMLH1, hMLH2, hMSH6 и hPMS2) Отсутствие герминогенной мутации Наличие герминогенной мутации HNPCC- синдром Основываясь на данных Американской медицинской ассоциации, нами предложена программа мониторинга за родственниками пациентов, с установленным у них диагнозом синдрома Линча (табл.5).

Таблица Рекомендации по наблюдению за родственниками пациентов с синдромом Линча Возраст Вид исследования Интервал 20-25 лет, или на 5 лет раньше, Фиброколоноскопия 1-2 года чем возраст постановки диагноза онкологического заболевания в семье, если он был поставлен ранее С 30 лет (MSH6) 30- 35 лет Гинекологический осмотр, 1-2 года трансвагинальное УЗИ, анализ на онкомаркер СА-130-35 лет Фиброгастродуоденоскопия 1-2 года 30-35 лет УЗИ брюшной полости, анализ 1-2 года мочи с цитологическим исследованием ВЫВОДЫ 1. Генетическое тестирование выявило, что у лиц с тремя и более клиническими критериями наследственного неполипозного рака толстой кишки, частота герминогенных мутаций составляет 31,25% (у 5 из 16), что позволяет рекомендовать проведение молекулярно-генетической диагностики именно у данной категории пациентов.

2. В популяции Российской Федерации встречается следующий спектр герминогенных мутаций у пациентов с HNPCC-синдромом: ген hMLH1- 1) мутация в экзоне 8 -R226L (с.677 G>T) 2) мутация в экзоне 17 - R659X (c.1975 C>T); ген hMSH2 - 1) мутация экзона - N139 fsX (c.415_416 del AA), 2) мутация 12 экзона - A636P (с.1906 G>C), 3) мутация 15 экзона - E878fsX3 (с.2633_2634 delAG), при этом мутация 3 экзона в гене hMSH2- N139 fsX (c.415_416 del AA) выявлена впервые.

3. Все обнаруженные мутации оказались уникальны, повторяющихся вариантов не выявлено, что обусловлено, выраженным разнообразием генетических дефектов при синдроме Линча (повреждение других генов системы репарации (hMSH6, PMS2 и др.), а также ограниченными возможностями секвенирования ДНК, не позволяющими выявлять более масштабные повреждения генов hMLH1 и hMSH2 - делеции и дупликации одного или нескольких экзонов.

4. При выполнении теста на микросателлитную нестабильность значимо частым позитивным маркером оказался ВАТ 26 (в 9 из 10 случаев), что доказывает возможность использования данного маркера в качестве основного в тесте на MSI.

5. Генетическое тестирование родственников пациентов с HNPCC- синдромом выявило герминогенные мутации у кровных родственников первой и второй степени родства, что показывает исключительную важность обследования данной категории лиц с целью оценки риска развития у них HNPCC-ассоциированных опухолей. Генетическое консультирование позволяет подобрать им комплекс диагностических мероприятий с целью максимально раннего выявления злокачественных новообразований.

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ У пациентов с наличием клинических критериев наследственного неполипозного рака толстой кишки целесообразно выполнение теста на микросателлитную нестабильность с последующим ДНК-секвенированием кодирующей последовательности генов mismatchрепарации ДНК (hMLH1, hMSH2) у MSI-позитивных пациентов с целью выявления в них герминогенных мутаций. Только в случае выявления зародышевой мутации может быть поставлен диагноз синдрома Линча.

Кровные родственники пациента с HNPCC- синдромом должны быть подвергнуты генетической диагностике с целью детекции герминогенных мутаций. Учитывая чрезвычайно высокую вероятность развития злокачественных опухолей (не менее 80%) в течение жизни при выявлении мутаций, таким лицам необходимо рекомендовать комплекс мероприятий, направленных на максимально раннюю диагностику опухолей HNPCC-спектра и диспансерное наблюдение.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Беляева А.В, Суспитцын Е.Н, Имянитов Е.Н, Ивлева А.Е, Гуляев А.В, Моисеенко А.Б, Корнилов А.В. Значение мутации в гене KRAS в клиническом течении колоректального рака // Материалы II съезда колопроктологов стран СНГ, III съезда колопроктологов Украины с участием стран центральной и восточной Европы- 18-20 мая 2011г, г. Одесса.

С.82-83.

2. Беляева А.В., Имянитов Е.Н., Гуляев А.В., Моисеенко А.Б., Корнилов А.В. Роль мутации в гене K-Ras в патогенезе и клиническом течении колоректального рака // Материалы конференции посвященной памяти профессора В.И. Кныша «Современные принципы диагностики и лечения колоректального рак» -26-27 мая 2011,г. Москва. С.3. Корнилов А.В., Правосудов И.В., Гуляев А.В., Суспитцын Е.Н., Имянитов Е.Н., Беляева А.В. Молекулярно-генетические аспекты наследственного неполипозного рака толстой кишки // Материалы II съезда колопроктологов стран СНГ, III съезда колопроктологов Украины с участием стран центральной и восточной Европы- 18-20 мая 2011г, г. Одесса.

С.135-136.

4. Корнилов А.В., Правосудов И.В., Гуляев А.В., Суспитцын Е.Н., Имянитов Е.Н., Семиглазов В.В. Наследственный неполипозный рак толстой кишки: опыт генетической диагностики // Колопроктология.- 2011.- Т.37, №3- Приложение: Материалы III Всероссийского съезда колопроктологов. С. 74.

5. Корнилов А.В., Суспитцын Е.Н., Янус Г.А., Имянитов Е.Н. Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки // Вопросы онкологии - 2011- Т.57,№2 -Приложение: Тезисы 7-й Российской конференции по фундаментальной онкологии. С.40.

6. Корнилов А.В., Правосудов И.В. Наследственный неполипозный рак толстой кишки:

современное состояние проблемы. //Онкологическая Колопроктология.- 2011.-№3- С.7-С.11.

7. Правосудов И.В., Корнилов А.В., Семиглазов В.В. Наследственный неполипозный колоректальный рак. // Ученые записки Санкт-Петербургского Государственного Медицинского Университета им. акад. И.П. Павлова- 2011.-Т.XVIII, №3-C. 14-8. Корнилов А.В., Имянитов Е.Н., Правосудов И.В., Гуляев А.В., Суспитцын Е.Н., Янус Г.А., Семиглазов В.В. Клинико-молекулярные аспекты диагностики наследственного неполипозного рака толстой кишки.//Вопросы онкологии - 2012.-Т.58.-№3- С.434-435.

9. Янус Г.А., Корнилов А.В., Суспитцын Е.Н., Зайцева О.А., Яцук О.С., Стрекалов Д.Л, Поляков И.С, Бреништер С.И, Правосудов И.В., Гуляев А.В., Семиглазов В.В., Имянитов Е.Н. Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки.// Сибирский онкологический журнал.- 2012.- №2- С.29- 38.

БЛАГОДАРНОСТИ Выражаю сердечную признательность научным руководителям диссертационной работы профессору Евгению Наумовичу Имянитову и д.м.н. Владиславу Владимировичу Семиглазову за постоянное внимание и ценные рекомендации.

От всей души благодарю сотрудников лаборатории молекулярной онкологии к.м.н.

Суспитцына Е.Н, к.м.н. Иевлеву А.Г, к.б.н. Того А.В, Януса Г.А, за неустанную поддержку, помощь и теплое отношение.

Приношу глубокую благодарность всем сотрудникам лаборатории патоморфологии за помощь в подготовке материала.

Выражаю искреннюю признательность всем сотрудникам отделения абдоминальной онкологии и популяционного ракового регистра за помощь в работе и поддержку.

Подписано в печать 08.11.12 Формат 60х841/16 Цифровая Печ. л. 1.Тираж 100 Заказ 06/11 печать Отпечатано в типографии «Фалкон Принт» (197101, г. Санкт-Петербург, ул. Большая Пушкарская, д. 54, офис 2)




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.