WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

ТИМОФЕЕВА НАДЕЖДА АЛЕКСАНДРОВНА

КИНЕТИЧЕСКИЙ МЕХАНИЗМ ДЕЙСТВИЯ АПУРИНОВОЙ/АПИРИМИДИНОВОЙ ЭНДОНУКЛЕАЗЫ ЧЕЛОВЕКА APE1 В ПРОЦЕССЕ ИНЦИЗИОННОЙ РЕПАРАЦИИ НУКЛЕОТИДОВ

03.01.04 – биохимия

Автореферат диссертации на соискание учёной степени кандидата химических наук

Новосибирск – 2012

Работа выполнена в Институте химической биологии и фундаментальной медицины СО РАН

Научный консультант:

д.х.н., профессор Федорова Ольга Семеновна

Официальные оппоненты:

Малыгин Эрнст Георгиевич, д.х.н., профессор Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора, г.н.с.

Белоусова Екатерина Анатольевна, к.х.н.

Институт химической биологии и фундаментальной медицины СО РАН, м.н.с.

Ведущая организация:

Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН

Защита состоится « 15 » июня 2012 г. в 10:00 часов на заседании диссертационного совета Д 003.045.01 на базе Института химической биологии и фундаментальной медицины СО РАН по адресу: 630090, Новосибирск, пр-кт академика Лаврентьева,

С диссертацией можно ознакомиться в библиотеке Института химической биологии и фундаментальной медицины СО РАН Автореферат разослан « ___ » мая 2012 г.

Учёный секретарь диссертационного совета к.х.н., доцент Коваль В.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Большое число эндогенных и экзогенных факторов вызывают химические повреждения клеточной ДНК. Под действием ионизирующего излучения в отсутствие кислорода основными модифицированными основаниями являются 5,6-дигидропиримидины.

Образование 5,6-дигидроуридина (DHU) из цитидина может вызывать превращение G/C-пары ДНК в A/T-пару. В процессе эксцизионной репарации оснований (BER) репарация DHU начинается с действия ДНК-гликозилаз с образованием апуринового/апиримидинового сайта (AP-сайта). В организме человека ДНК разрезается с 5'-стороны от AP-сайта с помощью апуриновой/апиримидиновой эндонуклеазы APE1. Кроме того, APEспособна участвовать в процессе инцизионной репарации нуклеотидов (NIR), разрезая ДНК с 5'-стороны от DHU по эндонуклеазному механизму, независимо от присутствия ДНК-гликозилаз. Из анализа кристаллической структуры комплекса APE1 с AP-ДНК ясно, что AP-сайт упакован в активном центре фермента очень плотно. Кристаллическая структура APE1 в комплексе с ДНК, содержащей повреждённое азотистое основание, репарируемое в процессе NIR, до сих пор не получена. Остаётся невыясненным вопрос о том, как фермент узнаёт и связывает объёмные повреждённые нуклеотиды и каков детальный кинетический механизм процесса NIR.

Цель настоящей работы состояла в установлении детального кинетического механизма действия AP-эндонуклеазы человека (APE1) в процессе инцизионной репарации нуклеотидов и его сравнении с кинетическим механизмом действия APE1 в процессе эксцизионной репарации оснований.

Задачи настоящего исследования состояли в том, чтобы:

• исследовать динамику конформационных превращений фермента APE1 и ДНК-субстратов в предстационарных и стационарных условиях по регистрации изменений интенсивности флуоресценции остатков триптофана в ферменте и остатков 2-аминопурина, введённых в ДНК-субстраты;

• установить детальные кинетические механизмы взаимодействия APE1 с неповреждённой ДНК и ДНК, содержащей DHU или AP-сайт, и выяснить механизм связывания ферментом таких структурно различных повреждений, как AP-сайт и DHU;

• изучить влияние делеции 61-ой аминокислоты на N-конце APE1 и замены лизина-98 белка на аланин на кинетические параметры действия фермента в процессах NIR и BER.

Научная новизна и практическая ценность работы. Настоящая работа представляет собой первое комплексное исследование кинетического механизма действия фермента APE1 и его мутантных форм APE1K98A и N61APE1 в процессе NIR. Предложены кинетические схемы взаимодействия APE1 с неповреждённой ДНК и ДНК, содержащей DHU или AP-сайт. Определены количественные параметры этих процессов.

Результаты, полученные в настоящей работе, важны для понимания механизма действия APE1 в процессе NIR и биологической роли такого пути репарации.

Публикации и апробация работы. По материалам диссертации опубликовано 4 печатные работы. Результаты работы были представлены на конференциях: «Chemical and Biological Problems of Proteomics», Новосибирск, 2004; «Физико-химическая биология», Новосибирск, 2006;

«IV съезд Российского общества биохимиков и молекулярных биологов», Новосибирск, 2008; «X International Conference on Environmental Mutagens», Флоренция, Италия, 2009; «Медицинская геномика и протеомика», Новосибирск, 2009; «Supramolecular Chemistry for Materials and Life Sciences», Новосибирск, 2010; «8th International Meeting on Recognition Studies in Nucleic Acids», Шеффилд, Великобритания, 2010; «Физико-химическая биология», Новосибирск, 2011; «Annual Meeting of European Environmental Mutagen Society», Барселона, Испания, 2011.

Структура и объём работы. Диссертация состоит из введения, обзора литературы, экспериментальной части, результатов и их обсуждения, выводов и списка литературы. Работа изложена на 186 страницах, содержит 49 рисунков, 10 схем и 35 таблиц. Библиография включает 182 литературных источника.

СОДЕРЖАНИЕ РАБОТЫ

Фермент APE1 в процессе BER разрезает ДНК с 5'-стороны от AP-сайта (Рис. 1). В процессе NIR APE1 разрезает фосфодиэфирную связь с 5'-стороны от некоторых повреждённых дезоксинуклеотидов с образованием на 3'-конце разрыва гидроксильной группы, на 5'-конце – фосфатной (Рис. 1). Разрезание фосфодиэфирной связи AP-ДНК ферментом APE1 происходит по кислотноосновному SN2(P) каталитическому механизму, с участием двух ионов Mg2+.

Один из этих ионов находится в так называемом сайте связывания металла А, второй ион расположен в сайте связывания металла Б.

К началу выполнения данной работы уже были известны кристаллические структуры APE1 в свободном состоянии (Gorman M.A. et al., 1997; Beernink P.T. et al., 2001) и в комплексах с субстратом и продуктом эндонуклеазной реакции, содержащими аналог AP-сайта (Mol D.C. et al., 2000). Данных, свидетельствующих об изменении конформации фермента при взаимодействии с субстратом и в ходе ферментативной реакции, не было.

Напротив, из рентгеноструктурного анализа был сделан вывод, что APEимеет жёсткую заранее сформированную структуру для узнавания ДНК, содержащей AP-сайт. AP-сайт упакован в активном центре фермента очень плотно. Эта плотная упаковка исключает связывание нуклеотидов ДНК и специфична для -аномера природного AP-сайта. Кристаллической структуры APE1 в комплексе с ДНК, содержащей повреждённое азотистое основание, репарируемое в процессе NIR, до сих пор не получено. Оставался невыясненным вопрос о том, как фермент узнаёт и связывает объёмные повреждённые нуклеотиды. Поэтому представляло интерес провести детальное кинетическое исследование механизма взаимодействия фермента c ДНК-субстратами, специфическими для NIR, и сравнить кинетические механизмы взаимодействия APE1 с субстратами, специфическими для NIR- и BER-путей.

' ' 5 O O P O O - Рис. 1. Схема реакций, O O P O B O O катализируемых APE1 в B O процессах BER (X – OH) или OH O NIR (X – 5,6-дигидроурацил OO P O (DHU), 5,6-дигидротимин, O P O O APEO 5-гидроксиурацил, O X O X 5-гидроксицитозин, dA, dC, O - 3,N4-бензэтено-dC, O O P O O P O O 1,N6-бензэтено-dA, B O O B O 1,N2-бензэтено-dG.

O 2,6-диамино-4-гидрокси-5-NO O P O метилформамидопиримидин).

O P O O ' O ' Используя регистрацию флуоресценции остатков триптофана (Trp) белков и 2-аминопурина (2-аPu), введённых в субстраты, в настоящей работе была проанализирована конформационная динамика и изучен кинетический механизм действия APE1 дикого типа и его мутантных форм APE1K98A и N61APE1. Домен Ref-1 (61-на аминокислота на N-конце APE1) является регулятором транскрипции. По-видимому, для проявления активности BER этот домен не важен. В то же время предполагается, что этот домен может быть необходимым для проявления активности NIR. Lys98, вероятно, принимает опосредованное участие в координации иона Mg2+ в активном центре фермента, поскольку он образует водородные связи с карбоксильной группой Asp70, который вовлечён в связывание иона Mg2+ в сайте связывания металла А.

1. Методы исследования В работе использовали как метод «остановленной струи» для изучения предстационарной кинетики ферментативных реакций, так и различные методы для исследования реакций, протекающих в стационарных условиях.

Ферментативные реакции проводили в буферах следующего состава: 20 мМ HEPES/KOH pH 7,5, 50 мМ KCl, 5 мМ MgCl2 (буфер, оптимальный для BER или буфер BER); 20 мМ HEPES/KOH pH 6,8, 50 мМ KCl, 0,01 мМ MgCl(буфер, оптимальный для NIR или буфер NIR). Использовали набор ДНК-лигандов, содержащих или не содержащих специфические сайты узнавания (Таблица 1, Рис. 2).

Таблица 1. Олигодезоксирибонуклеотиды, использованные в работе.

d(TGACTGCATACGCATGTAGACGATGTGCAT) С d(TGACTGCATAFGCATGTAGACGATGTGCAT) F d(TGACTGCATA(AP)GCATGTAGACGATGTGCAT) AP d(TGACTGCATA(DHU)GCATGTAGACGATGTGCAT) DHU d(ATGCACATCGTCTACATGCGTATGCAGTCA) G d(TGACTGCAT(2-aPu)CGCATGTAGACGATGTGCAT) (2-aPu)C d(TGACTGCAT(2-aPu)(DHU)GCATGTAGACGATGTGCAT) (2-aPu)DHU d(TGACTGCATA(DHU)(2-aPu)CATGTAGACGATGTGCAT) DHU(2-aPu) d(TGACTGCATA) pd(FGCATGTAGACGATGTGCAT) pd((DHU)GCATGTAGACGATGTGCAT) O N NH Рис. 2. Структуры N O O O N O N O модифицированных O O O O N OH NHнуклеозидов, O O O O использованных в работе.

AP F DHU 2-aPu В качестве специфического субстрата для изучения процесса NIR использовали 30-звенный олигодезоксирибонуклеотидный дуплекс (ODN), содержащий остаток DHU в одной из цепей напротив гуанозина (DHU/G).

Кроме того, для регистрации конформационной динамики ДНК при взаимодействии с ферментом в этот двуцепочечный ODN вводили остаток 2аPu с 5'- ((2-aPu)DHU/G), либо 3'-стороны (DHU(2-aPu)/G) от DHU. В качестве специфических субстратов для изучения процесса BER использовали 30-звенные двуцепочечные ODN, содержащие природный AP-сайт (AP/G), либо его синтетический аналог 2-гидроксиметил-3-гидрокситетрагидрофуран (тетрагидрофуран, F) (F/G) в одной из цепей дуплекса напротив гуанозина. В качестве неспецифического субстрата как для NIR-, так и для BER- процессов использовали 30-звенный полностью комплементарный двуцепочечный ODN, несодержащий повреждений (C/G).

Кроме того, в этот неспецифический субстрат вводили остаток 2-аPu ((2-aPu)C/G). Для определения сродства исследованных форм фермента к продуктам реакций использовали двуцепочечные ODN с разрывом в одной цепи, моделирующие продукты ферментативного разрезания субстратов F/G или DHU/G. Количественную обработку кинетических кривых проводили с помощью метода нелинейной регрессии, включающего численное интегрирование дифференциальных уравнений, описывающих кинетическую схему процесса. Для этого использовали программный пакет DynaFit (BioKin, США). Кинетические схемы, описывающие взаимодействие ферментов с субстратами или лигандами, представляли собой последовательности обратимых и необратимых стадий. Первая стадия соответствовала связыванию фермента с субстратом/лигандом. Завершающая стадия соответствовала диссоциации фермента из комплекса с продуктом ферментативной реакции или с лигандом. Кинетическая схема подбиралась таким образом, чтобы минимально возможное количество стадий описывало весь набор кинетических данных, полученных для исследуемого процесса.

Часть кинетических кривых, зарегистрированных в работе, полностью описывалась предложенной для соответствующего процесса схемой. В то же время большинство кинетических кривых описывались отдельными стадиями полной схемы. В этом случае полная схема ферментативного процесса составлялась путём объединения данных, полученных из разных кинетических кривых. В процессе количественной обработки кинетическая кривая разбивалась на временные диапазоны таким образом, чтобы каждый следующий диапазон включал предыдущий. Начальный диапазон обрабатывали в соответствии со схемой, содержащей начальные кинетические стадии. Обрабатывая следующий диапазон, к начальным стадиям добавляли ещё одну равновесную или неравновесную стадию.

2. Сродство APE1 к DHU-субстрату и продуктам ферментативного разрезания субстратов DHU/G и F/G Для определения сродства фермента дикого типа к субстрату DHU/G, а также сродства всех исследованных форм фермента к продуктам разрезания субстратов DHU/G и F/G проводили титрование ферментов в стационарных условиях соответствующими ДНК (данные не представлены). При этом регистрировали зависимости интенсивности флуоресценции остатков Trp от концентрации лигандов.

Значение равновесной константы диссоциации Kd комплекса APE1 с DHU-субстратом в буфере NIR составило (1,3±0,1)10-6 М. Значения равновесных констант диссоциации (KP) комплексов ферментов с продуктами представлены в Таблице 2. Значение Kd комплекса APE1 с DHU-субстратом (1,3 мкМ) практически совпадало с величиной KP для комплекса фермента с DHU-содержащим продуктом (1,4 мкМ). Таким образом, продукт разрезания субстрата, содержащего DHU, может являться конкурентным ингибитором APE1. Из Таблицы 2 видно, что фермент дикого типа и APE1K98A проявляют практически одинаковое сродство к продуктам реакций. Сродство N61APE1 к продуктам немного понижено.

KP, мкМ Буфер DHU-продукт F-продукт Таблица 2. Равновесные BER 2,2±0,3 0,48±0,APEконстанты диссоциации NIR 1,4±0,3 2,1±0,комплексов APE1, BER не определено 0,44±0,APE1K98A APE1K98A и N61APE1 с NIR 1,9±0,2 не определено продуктами разрезания BER не определено 0,83±0,N61APEсубстратов DHU/G и F/G.

NIR 2,3±0,4 не определено 3. Ферментативное разрезание [32P]-меченых субстратов Для определения скоростей накопления продуктов ферментативной реакции в процессе NIR были проведены эксперименты по ферментативному разрезанию 5'-[32P]-меченых субстратов DHU/G (Рис. 3) и (2-aPu)DHU/G (данные не представлены). Обнаружено, что за 35 часов фермент дикого типа расщепляет > 60% субстрата, содержащего остаток DHU, как в буфере NIR, так и BER (Рис 3А, Б). Тот же результат был получен и для субстрата, содержащего остаток 2-aPu ((2-aPu)DHU/G), в буфере NIR. Это показывает, что остаток 2-aPu не влияет на скорость разрезания ферментом субстрата, содержащего DHU, поэтому в этих условиях его можно использовать как нейтральную флуоресцентную группу. Видно (Рис. 3В, Г), что мутантные формы APE1K98A и N61APE1 работают медленнее фермента дикого типа.

На всех полученных кинетических кривых накопления продуктов (Рис. 3) можно выделить три фазы. В случае фермента дикого типа в первой фазе на временах < 20 с как в BER-, так и в NIR-буферах наблюдался скачок в накоплении продуктов. В следующих двух фазах продукты накапливались более медленно.

Рис. 3. Разрезание субстрата А Б DHU/G ферментами (1 мкМ) APE1 (А, Б), APE1K98A (В) и N61APE1 (Г) в буферах BER (А) и NIR (Б, В, Г).

Концентрации субстрата приведены на правой оси.

А, Б - На левых врезках изображены начальные участки кинетических В Г кривых, соответствующие окончанию фазы 1. На правых врезках – участки кинетических кривых, соответствующие фазе 2. В, Г - На врезках изображены начальные участки кинетических кривых, соответствующие фазе 1.

В случае мутантных форм фермента в первой фазе наблюдалось быстрое накопление продуктов с выходом на промежуточное плато на временах < 100 с в случае APE1K98A и на временах < 200 с в случае N61APE1. В следующих двух фазах продукты накапливались более медленно, как и в случае APE1. Вторая фаза накопления продукта наблюдалась на временах 20 < t < 2000 с для APE1, 100 < t < 20000 с для APE1K98A и 200 < t < 5000 с для N61APE1. Третья фаза соответствовала крайне медленному накоплению продукта и протекала на временах > 2000 с для APE1, > 20000 с для APE1K98A и > 5000 с для N61APE1. Медленное двухфазное накопление продукта может свидетельствовать о реакции с менее активной формой фермента и о существовании стабильного комплекса фермента с продуктом.

Особенностью всех описанных кинетических серий (Рис. 3) было то, что концентрация продуктов, образовавшихся в первой фазе процесса, была меньше соответствующей начальной концентрации фермента. Во всех случаях амплитуда первой фазы составляла ~15% от концентрации исходного DHU-субстрата.

4. Определение активности APEМетодом задержки в геле было показано, что с ДНК-лигандом, содержащим DHU, связывалось не менее 64%, 48% и 44% молекул APE1, APE1K98A и N61APE1, соответственно (данные не представлены).

Известно, что такой метод недооценивает количество связанной ДНК. Для точного определения доли активного фермента было проведено титрование APE1 неповреждённым лигандом (2-aPu)C/G, содержащим 2-aPu (Рис. 4).

Рис. 4. Флуоресцентное титрование APE1 (25 мкМ) неповреждённым 30-звенным ДНК-дуплексом (2-aPu)C/G в буфере NIR. Экспериментальные точки приведены после коррекции базовой линии.

При этом регистрировали изменение интенсивности флуоресценции 2-aPu, возникающее при связывании лиганда с ферментом. Возрастание интенсивности флуоресценции 2-aPu за счёт увеличения концентрации лиганда с 2-aPu исключали путём коррекции базовой линии. Концентрация APE1 составляла 25 мкМ и была намного больше константы диссоциации комплекса фермента с неповреждённым лигандом (Kd = 2,1 мкМ), определённой методом флуоресцентного титрования. В этих условиях весь лиганд образовывал комплекс с ферментом до тех пор, пока концентрация лиганда не превосходила концентрацию активных связывающих центров фермента (Рис. 4). На кривой возрастания интенсивности флуоресценции (Рис. 4) можно выделить один чётко выраженный излом в точке, соответствующей соотношению концентрации фермента и лиганда 1:1.

Исходя из этого, было сделано заключение, что около 100% молекул APEактивно для связывания. Таким образом, пониженная амплитуда первой фазы накопления продуктов на Рис. 3 не может быть вызвана снижением концентрации активного APE1 относительно общей концентрации белка.

Наиболее вероятно, что мутантные формы APE1K98A и N61APE1 ведут себя в отношении связывания субстрата так же, как и фермент дикого типа.

Одно из возможных объяснений снижения амплитуды первоначального скачка на кинетических кривых накопления DHU-продуктов (Рис. 3) может состоять в том, что фермент существует в двух конформациях. В начальный момент времени часть фермента существует в конформации (E1), энергетически менее выгодной, но более активной для разрезания DHU-субстрата; другая часть фермента существует в конформации (E2), энергетически более выгодной, но намного менее активной для разрезания данного субстрата. Менее активная форма фермента может либо непосредственно участвовать в формировании начального ферментсубстратного комплекса, либо находиться в равновесии с более активной формой. Поэтому как процесс формирования комплекса E2 с субстратом, так и конформационный переход E2 в E1 сильно смещены в обратную сторону.

Таким образом, в начальный момент времени (Рис. 3, фаза 1) при использованных концентрациях субстратов ~15% фермента APE1 и его мутантных форм находятся в каталитически активном фермент-субстратном комплексе, и процесс накопления продукта лимитируется скоростью химического разрезания DHU-субстрата ферментом, существующим в более активной конформации E1. В течение второй фазы (Рис. 3) накопление продукта лимитируется либо скоростью формирования комплекса менее активной формы E2 с DHU-субстратом, либо конформационным переходом формы E2 в форму E1. В течение третьей фазы (Рис. 3) накопление продукта лимитируется скоростью распада комплекса фермента с продуктом.

По-видимому, диссоциация фермента из комплекса с продуктом является лимитирующей стадией всего ферментативного процесса.

5. Изменение интенсивности флуоресценции 2-аминопурина, введённого в DHU-субстраты, в ходе взаимодействия APE1 с этими субстратами Была исследована динамика конформационных превращений в ДНК-субстрате, содержащем остаток DHU, в ходе ферментативного процесса путем регистрации изменения интенсивности флуоресценции остатка 2-aPu, располагавшегося в субстрате либо с 5'-, либо с 3'-стороны от DHU.

При связывании APE1 с неповреждённой ДНК ((2-aPu)C/G) не было обнаружено никаких изменений интенсивности флуоресценции 2-aPu во времени (данные не представлены). В то же время, при взаимодействии ферментов с субстратом (2-aPu)DHU/G на кинетических кривых можно выделить три фазы изменения интенсивности флуоресценции остатка 2-aPu (Рис. 5). В начальной быстрой фазе (для APE1 в буфере NIR < 0,2 с; для APEв буфере BER < 1 с; для APE1K98A < 20 с; для N61APE1 < 30 с) интенсивность флуоресценции остатков 2-aPu увеличивалась и выходила на промежуточное плато. Эти начальные отрезки возрастания интенсивности флуоресценции остатков 2-aPu по времени соответствовали отрезкам на Рис. 3 (Фаза 1), на которых происходило первоначальное накопление продуктов разрезания [32P]-меченого субстрата, содержащего DHU, то есть соответствовали химическому разрезанию DHU-субстрата ферментом, находящимся в более активной конформации. Вторая фаза увеличения интенсивности флуоресценции наблюдалась до ~1000 с для APE1, до ~4000 с для APE1K98A и до ~2000 с для N61APE1 (Рис. 5) и соответствовала изменению конформации продукта в комплексе с ферментом. Далее протекала третья фаза, которая соответствовала третьей фазе медленного накопления продуктов разрезания [32P]-меченого DHU-субстрата на Рис. 3, то есть диссоциации фермента из стабильного комплекса с продуктом.

А Б Рис. 5. Изменение интенсивности флуоресценции остатков 2-aPu при взаимодействии APE1 (А, Б), APE1K98A (В) и N61APE1 (Г) с субстратом (2-aPu)DHU/G В Г (1 мкМ) в буферах BER (А) и NIR (Б, В, Г) от времени.

Гладкие кривые – теоретическая подгонка.

Концентрации ферментов приведены на правой оси.

В случае взаимодействия APE1 c субстратом DHU(2-aPu)/G (Рис. 6А, Б), у которого остаток 2-aPu находится с 3'-стороны от DHU, увеличение интенсивности флуоресценции остатков 2-aPu в первой фазе (< 0,2 с) (Рис. 6Б) соответствует быстрому участку (Фаза 1) на Рис. 3Б, на котором происходит первоначальный скачок в накоплении продуктов разрезания [32P]-меченого DHU-субстрата, то есть быстрой стадии разрезания субстрата ферментом. Во второй фазе (< 10 с) (Рис. 6А) происходит изменение конформации продукта разрезания в комплексе с APE1. В третьей фазе (< 1000 с) (Рис. 6А), где наблюдается медленное увеличение интенсивности флуоресценции с выходом на плато, происходит ещё одно изменение конформации продукта в комплексе с APE1. При этом образуется стабильный комплекс фермента с продуктом, концентрация которого достигает равновесия на отрезке времени до 1000 с. Третья фаза на Рис. 6А соответствует второй фазе на Рис. 5Б.

Рис. 6. Изменение интенсивности А Б флуоресценции остатков 2-aPu при взаимодействии APE1 с субстратом DHU(2-aPu)/G (1 мкМ) в буфере NIR от времени. Гладкие кривые – теоретическая подгонка.

А – Полная кинетическая кривая;

Б – начальный участок кинетической кривой, представленный в увеличенном масштабе.

6. Изменение интенсивности флуоресценции остатков триптофана в ходе взаимодействия APE1 с неповреждённым лигандом Была исследована динамика конформационных превращений в ферментах путем регистрации изменения интенсивности флуоресценции Trp на временах, не превышающих 10 с, что исключает выгорание белка.

При исследовании неспецифического связывания трёх форм APE1 с ДНК использовали неповреждённый 30-звенный ДНК-лиганд (C/G) (Рис. 7).

А В Д Б Г Е Рис. 7. Изменение интенсивности флуоресценции остатков Trp при взаимодействии ферментов (1 мкМ) APE1 (А, Б), APE1K98A (В, Г) и N61APE1 (Д, Е) с C/G-лигандом в буферах BER (А, В, Д) и NIR (Б, Г, Е) от времени. Гладкие кривые – теоретическая подгонка.

По-видимому, начальное падение интенсивности флуоресценции на кинетических кривых (Рис. 7) отражало образование начального неспецифического фермент-субстратного комплекса. Дальнейшее изменение интенсивности флуоресценции соответствовало изомеризации начального комплекса. Такое двухстадийное связывание описывалось кинетической Схемой 1, содержащей две обратимые стадии. Таким образом, полученные экспериментальные данные ES1 isom свидетельствуют о том, что при kbind kon on E+S (ES)1 (ES)взаимодействии APE1 с неповреждённым kbind kES1 isom ДНК-лигандом после образования off off начального комплекса (ES1) фермент Схема изменяет свою конформацию. В результате обработки кинетических кривых в соответствии со Схемой 1 были получены значения кинетических параметров процессов взаимодействия APE1, APE1K98A и N61APE1 с C/G-лигандом (Таблица 3). В ряде случаев значения соответствующих констант скорости различны в разных буферах. Этот факт указывает на влияние pH и концентрации ионов Mg2+ на активность фермента.

Таблица 3. Константы скорости реакций, входящих в кинетическую Схему 1, для процессов взаимодействия APE1, APE1K98A и N61APE1 с C/G-лигандом.

bind bind ES1isom ES1isom Буфер (M–1с–1) 10–6 (с–1) kon koff kon (с–1) koff (с–1) APE1 11±1 200±10 16±0,1 80±BER APE1K98A 2,0±0,1 78±2 8,3±0,1 59±N61APE1 6,2±0,1 50±1 4,3±0,1 55± APE1 0,44±0,01 12±1 0,82±0,01 1,5±0,NIR APE1K98A 3,8±0,1 71±1 0,23±0,01 28±0,N61APE1 6,6±0,1 10±1 0,28±0,01 0,10±0,7. Изменение интенсивности флуоресценции остатков триптофана в ходе взаимодействия APE1 с субстратом, содержащим DHU Была исследована динамика конформационных превращений в ферментах APE1, APE1K98A и N61APE1 путём регистрации изменения интенсивности флуоресценции Trp в ходе взаимодействия с DHU-содержащим субстратом (DHU/G).

На кинетических кривых в случае APE1 в буфере BER (Рис. 8А) и мутантных форм фермента в буфере NIR (Рис. 8В, Г) наблюдалось сначала резкое падение интенсивности флуоресценции Trp (в случае APE1 до 50 мс; в случае APE1K98A для концентраций субстрата 0,75 мкМ, 1 мкМ до 0,1 с, для концентраций 1,25 мкМ, 1,5 мкМ, 2 мкМ до 1 с; в случае N61APE1 до 1 с), что, вероятно, соответствовало образованию комплексов ферментов в более активной конформации E1 с субстратом и изомеризации этих комплексов.

Затем в случае APE1 в буфере BER происходило небольшое возрастание интенсивности флуоресценции белка с выходом на плато, а в случае мутантных форм фермента наблюдалось более медленное снижение интенсивности флуоресценции. Это изменение интенсивности флуоресценции совпадало по времени с начальным увеличением интенсивности флуоресценции (2-aPu)DHU/G (Рис. 5, фаза 1), то есть соответствовало 1-ой быстрой фазе разрезания субстрата. На кинетических кривых в буфере NIR интенсивность флуоресценции Trp двухфазно снижалась (Рис. 8Б). Сравнение кинетических кривых, представленных на Рис. 8Б, с кинетическими кривыми, представленными на Рис. 5Б, 6, позволило сделать вывод о том, что первая стадия процесса взаимодействия APE1 с субстратом DHU/G в буфере NIR (Рис. 8Б) соответствует образованию комплекса фермента (E1) с субстратом, вторая стадия - изменению конформации белка в комплексе с продуктом ферментативной реакции, происходящему уже после каталитической стадии. Константы скорости прямой и обратной реакций стадии образования ферментbind bind субстратного комплекса ( *, *) представлены в Таблице 5. Константы kon koff скорости прямой и обратной реакций стадии изомеризации фермента в EP EP комплексе с продуктом составляют = 1,1 с-1, = 1,3 с-1, kon isom * koff isom * соответственно.

А Б Рис. 8. Изменение интенсивности флуоресценции остатков Trp при взаимодействии ферментов (1 мкМ) APE(А, Б), APE1K98A (В) и В Г N61APE1 (Г) с субстратом DHU/G в буферах BER (А) и NIR (Б, В, Г) от времени.

Гладкие кривые – теоретическая подгонка.

8. Кинетический механизм APE1 в процессе инцизионной репарации нуклеотидов На основании полученных данных была предложена кинетическая схема ферментативного процесса, описывающая механизм превращения субстрата, содержащего остаток DHU, ферментом APE1 в процессе инцизионной репарации нуклеотидов (Схема 2). В начальный момент времени часть фермента находится в более активной для разрезания DHU-субстрата конформации E1, тогда как другая часть фермента существует в менее активной конформации E2. Менее активная форма фермента E2 может либо непосредственно участвовать в формировании начального ферментсубстратного комплекса (ES)1, либо находиться в медленном равновесии с более активной формой E1. Фермент в более активной конформации Eбыстро образует начальный фермент-субстратный комплекс (ES)1, который подвергается двум конформационным переходам в (ES)2 и (ES)3. Затем протекает быстрый гидролиз 5'-фосфодиэфирной связи субстрата, вслед за которым происходят две стадии конформационых превращений комплекса фермента с продуктом ферментативной реакции. После этого следует лимитирующая стадия диссоциации фермента из стабильного комплекса с продуктом. Поэтому регистрируемые кинетические кривые представляют собой суперпозицию превращений двух форм фермента E1 и E2.

Схема Каждая кинетическая кривая, полученная для процессов взаимодействия ферментов с DHU-содержащими субстратами (Рис. 3, 5, 6, 8), была количественно обработана в соответствии со Схемой 2 и с тем числом кинетических стадий, которое удалось зафиксировать на данной кривой.

Полученные кинетические параметры представлены в Таблицах 4, 5 для фермента дикого типа и в Таблице 6, для мутантных форм APE1N61 и APE1K98A, соответственно.

Таблица 4. Константы скорости реакций, входящих в кинетическую Схему 2, для процесса взаимодействия APE1 с субстратами, содержащими DHU, в буфере BER.

DHU/G (Рис. 8А) [32P]-DHU/G1 (Рис. 3А) (2-aPu)DHU/G1 (Рис. 5А) bind (38±0,1)1kon (M–1с–1) bind koff (с–1) 131±0,ES1isom (с–1) 145±0,kon ES (с–1) koff isom 36±0,bind (32±3)10-kinact (с–1) kcut (с–1) 20±0,1 15±0,EP (с–1) (16±0,6)10-k2 isom kEP diss (с–1)2 (22±2)10-6 (18±0,2)10-При расчётах полагали, что концентрация фермента, участвовавшего в расщеплении субстрата, составляла 15% от его исходной концентрации.

В значения константы kEP diss вносит дополнительную ошибку частичная инактивация фермента при длительной инкубации.

Таблица 5. Константы скорости реакций, входящих в кинетическую Схему 2, для процесса взаимодействия APE1 с субстратами, содержащими DHU, в буфере NIR.

DHU/G [32P]-DHU/G1 (Рис.3Б) (2-аPu)DHU/G1 DHU(2-аPu)/G(Рис. 8Б) {[32P]-(2-аPu)DHU/G}1 (Рис. 5Б) (Рис. 6) bind (2,9±0,1)1kon *(M–1с–1) bind koff * (с–1) 18±(160±20)10-bind kinact (с–1) {(250±20)10-4} kcut (с–1) 49±10 53±EP (с–1) k1 isom 0,56±0,EP (с–1) k2 isom (37±0,3)10-4 (27±1)10-(13±3)10-kEP diss (с–1)2 (15±0,1)10-{(22±3)10-6} 1, См. Таблицу 4.

Таблица 6. Константы скорости реакций, входящих в кинетическую Схему 2, для процессов взаимодействия N61APE1 и APE1K98A с субстратами, содержащими DHU, в буфере NIR.

N61APE1 APE1K98A (2-aPu)DHU/G DHU/G [32P]-DHU/G1 (2-aPu)DHU/G1 DHU/G [32P]-DHU/G(Рис. 5В) (Рис. 8Г) (Рис. 3Г) (Рис. 5Г) (Рис. 8В) (Рис. 3В) bind (9,2±0,1)1kon (M–1с–1) (4,3±0,01)1bind 81±koff (с–1) 13±0,ES1isom 4,1±0,kon (с–1) 1,6±0,ES13±0,koff isom (с–1) 1,6±0,ES1,7±0,kon isom (с–1) ES2,2±0,koff isom (с–1) bind (1,9±0,6)10-(11±2,1)10-kinact (с–1) 0,20±0,01 0,22±0,03 0,30±0,kcut(с–1) 0,11±0,01 0,10±0,01 0,10±0,EP (4,4±0,7)10-k2 isom (с–1) (7,9±0,41)10-(12±5)10-kEP diss(с-1)2 (9,4±1,1)10-6 (9,5±1,7)10-1, См. Таблицу 4.

9. Изменения интенсивности флуоресценции остатков триптофана в ходе взаимодействия APE1 с F- и AP-субстратами Для определения кинетического механизма взаимодействия APE1 с субстратом в процессе BER в настоящей работе была исследована динамика конформационных превращений в APE1 (Рис. 9), APE1K98A (Рис. 10А, Б) и N61APE1 (Рис. 10В, Г) при их взаимодействии с субстратами F/G и AP/G.

При этом регистрировались изменения интенсивности флуоресценции остатков триптофана белков.

А Б В Рис. 9. Изменение интенсивности флуоресценции остатков Trp при взаимодействии APE1 (1мкМ) с субстратами F/G (А, В) и AP/G (Б) в буферах BER (А, Б) и NIR (В) от времени. Гладкие кривые – теоретическая подгонка. Концентрации субстратов приведены на правой оси.

А Б Рис. 10. Изменение интенсивности флуоресценции остатков Trp при взаимодействии APE1K98A (А, Б) и N61APE1 (В, Г) с В Г субстратами F/G (А, В) и AP/G (Б, Г) в буфере BER от времени. Концентрация ферментов составляла 1 мкМ (А, Б, Г) и 1,5 мкМ (В).

Начальное падение интенсивности флуоресценции на кинетических кривых (Рис. 9, 10) отражает стадии образования начального ферментсубстратного комплекса и изомеризации этого комплекса. Таким образом, можно заключить, что при связывании с субстратом, содержащим природный AP-сайт или его аналог, APE1 подвергается индуцированной конформационной подгонке. Небольшое возрастание интенсивности флуоресценции с выходом на плато в случае фермента дикого типа и N61APE1, а также перегиб на кинетических кривых в случае APE1K98A были отнесены нами к стадии гидролиза 5'-фосфодиэфирной связи субстрата.

Дальнейшее медленное падение интенсивности флуоресценции, зарегистрированное на кинетических кривых в случае APE1K98A, по-видимому, соответствовало стадии изомеризации фермента в комплексе с продуктом реакции. На основании полученных данных предложена кинетическая схема, описывающая механизм действия фермента APE1 в процессе BER (Схема 3). Данная схема включает в себя две обратимые стадии (стадию образования начального фермент-субстратного комплекса и стадию его изомеризации), необратимую стадию гидролиза 5'-фосфодиэфирной связи субстрата, обратимую стадию изомеризации фермента в комплексе с продуктом реакции и обратимую стадию диссоциации фермента из комплекса с продуктом.

ES1 isom EP isom kbind kon kon KP on E + S (ES)1 (ES)2 (EР)1 (EР)2 E + P ES1 isom EP isom kbind koff koff off Схема Каждая кинетическая кривая (Рис. 9, 10) была количественно обработана в соответствии с предложенной кинетической схемой и с тем числом кинетических стадий, которое удалось зафиксировать на данной кривой.

Полученные значения констант скорости для процессов взаимодействия ферментов с субстратами F/G и AP/G представлены в Таблицах 8 и 9.

Из полученных для AP- и F- субстратов экспериментальных данных невозможно выяснить, сколько конформаций имеет APE1 в начальный момент времени. Можно лишь предположить, что если фермент находится в двух конформационных формах, то конформационный переход сильно смещён в сторону формы, активной для разрезания этих субстратов.

Таблица 8. Константы Буфер NIR Буфер BER скорости реакций, F/G F/G AP/G входящих в bind (0,23±0,01)108 (3,8±0,1)108 (1,8±0,1)1kon (M–1с–1) кинетическую Схему 3, bind koff (с–1) 4,9±0,1 79±1 120±для процесса ESвзаимодействия APE1 с (с–1) 24±1 59±1 18±kon isom субстратами, ES (с–1) koff isom 68±1 18±1 32±содержащими F и kcut (с–1) 1,0±0,1 68±1 97±AP-сайт.

Таблица 9. Константы скорости реакций, входящих в кинетическую Схему 3, для процессов взаимодействия APE1K98A и N61APE1 с субстратами, содержащими F и AP-сайт, в буфере BER.

APE1K98A N61APEF/G AP/G F/G AP/G bind (3,7±0,1)108 (2,0±0,1)108 (1,6±0,1)108 (2,6±0,1)1kon (M–1с–1) bind koff (с–1) 38±1 492±2 7,3±0,5 34±ES (с–1) 30±1 289±1 15±1 38±kon isom ES (с–1) koff isom 310±1 355±2 58±1 4,2±0,kcut (с–1) 5,5±0,1 58±EP (с–1) kon isom 2,7±0,EP (с–1) koff isom 1,5±0,10. Особенности взаимодействия APE1 с субстратами, содержащими DHU и AP-сайт В соответствии с моделью «конформационной селекции» (Ma B. et al., 2002; Ma B. et al., 2010) все белки изначально существуют в динамическом равновесии между различными конформационными формами, связывающими различные лиганды. Результаты, полученные в настоящей работе, выявили тот факт, что «конформационная селекция» присутствует в процессе связывания APE1 с DHU-субстратом. Получено, что APEсуществует по меньшей мере в двух конформациях, находящихся в равновесии. Показано, что фермент в комплексах с субстратами, содержащими DHU, AP-сайт и F, подвергается дальнейшим изменениям конформации. Эти данные указывают на существование «индуцированной конформационной подгонки фермента и субстрата» при образовании комплексов APE1 с ДНК. Согласно модели «индуцированного соответствия» (Koshland D.E. Jr., 1960), после образования начального комплекса с субстратом фермент подвергается конформационным изменениям перед каталитической стадией. Исходя из данных рентгеноструктурного анализа, AP-ДНК, связанная с APE1, изогнута на ~35°, AP-сайт при этом вывернут из спирали. Можно предположить, что наблюдаемые в настоящей работе изменения конформации фермента после образования начального ферментсубстратного комплекса приводят к изгибанию ДНК и выворачиванию AP-сайта или DHU из спирали. При этом образуются каталитически активные фермент-субстратные комплексы, в которых происходит гидролиз 5'-фосфодиэфирной связи субстратов. В то же время, в работе показано, что после образования комплекса с неповреждённой ДНК APE1 также меняет свою конформацию. Можно предположить, что, двигаясь по ДНК, APEменяет свою конформацию, непрерывно пытаясь образовать каталитически активный комплекс. Такой комплекс ферменту удаётся образовать лишь при взаимодействии с сайтами ДНК, которые содержат повреждения, являющиеся субстратами для APE1. Таким образом, механизм образования комплекса APE1 с ДНК-субстратом, вероятно, представляет собой комбинацию моделей «конформационной селекции» и «индуцированного соответствия». Активный центр фермента достаточно пластичен для того, чтобы связывать такие различные субстраты, как AP-сайт и DHU.

Полученные в работе данные указывают на то, что комплексы APE1 с продуктами разрезания субстратов, содержащих DHU, AP-сайт и F, стабильны. Ранее (Mol D.C. et al., 2000) было показано, что фермент APEструктурно оптимизирован для того, чтобы удерживать расщеплённую ДНК, содержащую AP-сайт. Результаты, полученные в настоящей работе, позволяют предположить, что структура данного фермента также оптимизирована для того, чтобы удерживать расщеплённую ДНК, содержащую остаток DHU. По-видимому, существование прочного комплекса между APE1 и продуктами разрезания субстратов обеспечивает координированное присоединение других белков, участвующих в репарации, к субстратам и передачу субстратов от одного фермента к другому.

Кроме того, данная работа показала, что скорость гидролитического разрезания ДНК-субстрата, содержащего DHU, ферментом APE1 в процессе NIR сопоставима по величине со скоростью разрезания ДНК-субстрата, содержащего AP-сайт, в процессе BER (Таблицы 5, 8). Это свидетельствует о том, что NIR может являться биологически значимым процессом.

11. Влияние замены K98A на кинетические характеристики APEПолученные данные показывают, что при образовании начального неспецифического фермент-субстратного комплекса мутация K98A практически устраняет наблюдавшиеся для APE1 большие различия между bind bind значениями соответствующих констант и, определёнными в двух kon koff разных буферах. Более того, замена Lys98 на Ala затрудняет индуцированную подгонку фермента в комплексе с неповреждённой ДНК.

Кроме того, мутация K98A значительно затрудняет индуцированную подгонку структуры фермента в комплексе с F-содержащим субстратом. Эта мутация в 12 раз понижает скорость гидролиза 5'-фосфодиэфирной связи субстрата, содержащего F. В случае взаимодействия фермента с ДНК, содержащей природный AP-сайт, замена K98A существенно понижает стабильность начального комплекса (ES)1 и ускоряет конформационные переходы в комплексе фермента с AP-субстратом. Таким образом, APE1 поразному взаимодействует с AP-сайтом и остатком тетрагидрофурана, который широко используется в качестве стабильного аналога AP-сайта.

Получено, что в процессе NIR замена лизина-98 на аланин значительно bind замедляет активацию менее активной формы фермента E2 ( ) и в 200 раз kinact снижает скорость гидролиза 5'-фосфодиэфирной связи DHU-субстрата. Более того, эта аминокислотная замена замедляет конформационную перестройку комплекса фермента с продуктом разрезания DHU-субстрата.

На основании того, что мутация K98A оказывает влияние на разрезание и DHU-субстрата, и F-субстрата, был сделан вывод, что двухвалентный ион металла, координированный в сайте А, для разрезания DHU-субстрата необходим так же, как и для разрезания AP-субстрата. Вероятно, APEиспользует один и тот же активный центр для катализа разрезания субстратов, содержащих DHU и AP-сайт.

12. Влияние домена Ref-1 на кинетические характеристики APEПолученные данные свидетельствуют о том, что отсутствие домена Ref-1 в APE1 приводит к увеличению стабильности начальных комплексов фермента как с неповреждённой ДНК, так и с ДНК, содержащей AP-сайт и F.

При образовании начального неспецифического фермент-субстратного комплекса, как и в случае замены K98A, мутация N61 устраняет наблюдавшиеся для APE1 большие различия между значениями константы bind, полученными в двух разных буферах. Следовательно, структура APEkon оптимизирована таким образом, что скорость начального связывания APE1 с неповреждённой ДНК сильно зависит от концентрации ионов Mg2+ и pH.

Более того, как и замена K98A, мутация N61 замедляет индуцированную подгонку фермента в комплексе с неповреждённой ДНК.

В процессе BER домен Ref-1 влияет на скорость изомеризации начального комплекса и стабильность второго каталитически активного фермент-субстратного комплекса, причём это влияние не одинаково в случае F- и AP- субстратов. В процессе NIR домен Ref-1 участвует в специфическом узнавании повреждённой ДНК, содержащей DHU, ускоряет активацию менее bind активной формы фермента E2 ( ), гидролиз 5'-фосфодиэфирной связи kinact DHU-субстрата и конформационную перестройку комплекса фермента с продуктом разрезания DHU-субстрата. Домен Ref-1 немного повышает сродство APE1 к продуктам разрезания DHU-субстрата и F-субстрата.

Опираясь на эти данные можно предположить, что этот домен делает передачу расщеплённого продукта последующим ферментам, участвующим в репарации, более эффективной.

Присутствие домена Ref-1 в APE1 приводит к ускорению гидролиза 5'-фосфодиэфирной связи DHU-субстрата в 500 раз, в то время как значительного влияния на скорость гидролиза F-субстрата не оказывает.

Исходя из этого, можно заключить, что в процессе эволюции APE1 вместе с доменом Ref-1 приобрёл способность осуществлять эффективную инцизионную репарацию нуклеотидов.

ВЫВОДЫ 1. Впервые установлен детальный кинетический механизм ферментативной реакции, катализируемой апуриновой/апиримидиновой эндонуклеазой человека APE1 в процессе инцизионной репарации нуклеотидов (NIR).

• Показано, что APE1 в свободном состоянии существует по меньшей мере в двух конформациях, находящихся в равновесии и обладающих разной способностью связывать ДНК. При этом связывание ДНК-субстрата ферментом происходит по механизму «конформационной селекции».

• Лимитирующей стадией процесса NIR является диссоциация фермента из комплекса с продуктом. Продукт разрезания DHU-субстрата может выступать конкурентным ингибитором APE1.

• Скорость гидролитического разрезания ДНК-субстрата, содержащего 5,6-дигидроуридин, ферментом APE1 в процессе NIR сопоставима по величине со скоростью разрезания ДНК-субстрата, содержащего AP-сайт, в процессе BER, что свидетельствует о NIR, как о биологически значимом процессе.

2. Показано, что APE1 изменяет свою конформацию при образовании комплексов со специфическими и неспецифическими ДНК, а в комплексах с субстратами, содержащими DHU, AP-сайт или тетрагидрофуран, подвергается изменениям конформации перед стадией гидролиза 5'-фосфодиэфирной связи, что свидетельствует об «индуцированной конформационной подгонке» молекулы фермента.

3. Установлено, что замена остатка Lys98 на аланин и удаление домена Ref-1 (61 аминокислота с N-конца) влияют на кинетические характеристики ферментативных процессов с участием APE1.

• Мутация Lys98Ala оказывает более сильное влияние на катализ в процессе NIR, чем в процессе BER.

• Присутствие домена Ref-1 в APE1 приводит к уменьшению стабильности начальных комплексов APE1 как с неповреждённой ДНК, так и с ДНК, содержащей F или AP-сайт; специфическому узнаванию повреждённой ДНК, содержащей DHU; ускорению каталитической стадии в процессе NIR и увеличению стабильности комплекса фермента с продуктом, что может способствовать эффективной передаче расщеплённого продукта последующим ферментам, участвующим в процессах репарации NIR и BER.

Основные результаты диссертации опубликованы в следующих работах:

1. Тимофеева, Н.А., Коваль, В.В., Федорова, О.С. Кинетический механизм действия фермента APE1 в эксцизионной репарации оснований // Вестник НГУ. – 2008. – Т. 6. – С. 90-95.

2. Timofeyeva, N.A., Koval, V.V., Knorre, D.G., Zharkov, D.O, Saparbaev, M.K., Ishchenko, A.A., Fedorova, O.S. Conformational dynamics of human AP endonuclease in base excision and nucleotide incision repair pathways // J. Biomol. Struct. Dyn. – 2009. – V. 26. – P. 637-652.

3. Тимофеева, Н.А., Коваль, В.В., Ищенко, А.А., Сапарбаев, М.К., Федорова, О.С. Кинетический механизм действия апуриновойапиримидиновой эндонуклеазы человека в процессе инцизионной репарации нуклеотидов // Биохимия. – 2011. – Т. 76. – С. 333–344.

4. Timofeyeva, N.A., Koval, V.V., Ishchenko, A.A., Saparbaev, M.K., Fedorova, O.S. Lys98 substitution in human AP endonuclease 1 affects the kinetic mechanism of enzyme action in base excision and nucleotide incision repair pathways // PLoS ONE. – 2011. – V. 6. – e24063.







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.