WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Корниенко Владимир Юрьевич

ГЕТЕРОГЕННОСТЬ ПОЛИМОРФИЗМОВ В ГЕНЕ NPHS2 У ДЕТЕЙ С НЕФРОТИЧЕСКИМ СИНДРОМОМ.

03.02.07 генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва 2012

Работа выполнена в лаборатории мембранологии с группой генетических исследований ФГБУ “Научный Центр Здоровья Детей” РАМН.

Научный руководители:

доктор медицинских наук, профессор, заведующий лабораторией Пинелис Всеволод клеточных и молекулярных технологий (Федеральное Григорьевич государственное бюджетное учреждение «Научный центр здоровья детей» Российской академии медицинских наук) доктор медицинских наук, профессор, заведующий отделением Цыгин Алексей нефрологии (Федеральное государственное бюджетное учреждение Николаевич «Научный центр здоровья детей» Российской академии медицинских наук)

Официальные оппоненты:

доктор медицинских наук, профессор заведующий лабораторией Журков Вячеслав генетического мониторинга (Федеральное государственное Серафимович бюджетное учреждение «Научно - исследовательский институт экологии человека и гигиены окружающей среды» имени А.Н.

Сысина Российской академии медицинских наук) доктор медицинских наук, профессор, главный научный сотрудник Сергеева Тамара (Федеральное государственное бюджетное учреждение «Научный Васильевна центр здоровья детей» Российской академии медицинских наук)

Ведущая организация: Государственное бюджетное образовательное учреждение высшего профессионального образования «Московский государственный медикостоматологический университет» Министерства здравоохранения и социального развития Российской Федерации (МГМСУ).

Защита состоится «28» ноября 2012 г. в 1500 часов на заседании Диссертационного совета Д 212.203.05 при Российском университете дружбы народов по адресу: 117198, ул.

Миклухо-Маклая, д. 8.

С диссертацией можно ознакомиться в научной библиотеке Федерального государственного образовательного учреждения высшего профессионального образования «Российского университета дружбы народов» по адресу: 117198, г. Москва, ул. МиклухоМаклая, дом 6.

Автореферат разослан « » 2012.г.

Ученый секретарь Диссертационного совета, кандидат биологических наук, доцент Гигани О.Б.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность темы Нефротический синдром (НС) объединяет гетерогенную группу гломерулярных заболеваний и является одной из актуальных проблем детской нефрологии.

Заболеваемость первичным НС составляет 2-13 случаев на 100 000 детей в возрасте до 10 лет (Tryggvason K. et al, 2006). Постоянное увеличение числа больных с НС, прогрессирующих до стадии терминальной почечной недостаточности и нуждающихся в заместительной терапии (хронический или перитониальный диализ, трансплантация почки), показывает необходимость включения этого заболевания в список приоритетных исследований в нефрологии (Цыгин А.Н., и др., 2010, Becker-Cohen et al., 2007, Caridi et al., 2010).

Для понимания этиологии и патогенеза нефротического синдрома научные исследования последних лет были сосредоточены на оценке вклада генетических факторов в механизмы повреждения и фиброгенеза почек.

В общей сложности, по данным крупных европейских медицинских центров, наследственные гломерулопатии занимают от 6,5 до 15% среди патологий, ведущей к хронической почечной недостаточности (ХПН). В то же время, около 20% от общего числа детей с диагнозом нефротический синдром составляет группа пациентов со стероидрезистентным нефротическим синдромом в этиологии и патогенезе которых, генетические факторы играют важную роль (Цыгин А.Н., и др. 2010, Ulinski T. et al., 2010).

В настоящее время для изучения роли генетических факторов в этиологии и патогенезе мультифакториальные заболеваний, к которым относится и НС, часто используется подход, основанный на исследовании полиморфных маркеров геновкандидатов. Таким геном-кандидатом, нарушения в последовательности которого могут приводить к возникновению резистентности к глюкокортикоидам при терапии НС, является ген подоцина (NPHS2) (Pereira A.C. et al., 2004, Tsukaguchi et al., 2000, BeckerCohen et al., 2007, Caridi et al., 2003). Подоцин - это трансмембранный белок, играющий важную роль в процессах клубочковой фильтрации, экспресируется в специализированных клетках почек – подоцитах (Рис. 1).

Этот ген расположен на 1 хромосоме в положении 1q25-q31. Ранее было показано, что причиной резистентности к стероидной терапии, у больных стероидрезистентным нефротическим синдромом, могут быть нарушения различного рода в гене подоцина. Он состоит из 8 экзонов, интронных и промоторной области, их расположение представлено на рис 2.

В настоящее время известно множество различных мутаций в гене NPHS2: мисенсмутации, нонсенс-мутации, делеции. Так, Di Duca M. et al. (2005), после обследования итальянских пациентов обнаружили три мутации в промоторном регионе NPHS2, которые сильно снижали экспрессию гена. Hinkes B. et al. (2008), показали, что при НС 69% мутаций в гене NPHS2- это нонсенс-мутации, сдвиг рамки считывания или мутация R138Q. Furue T. et al. (2008), после определения нуклеотидной последовательности NPHSу 11 японских больных выявили наличие полиморфизма в 318 положении у 7 из 11 детей.

Berdeli A. et al. (2007), при исследовании 295 детей в турецкой популяции больных нефротическим синдромом обнаружили 37 новых мутаций в гене NPHS2. В ряде случаев Рис. 1 Структура и распределение аминокислотных замен в белке подоцина.

подоцин всё же может выявляться в подоцитах, но при этом подоцин теряет способность удерживать нефрин в липидных мостиках. В российской выборке больных со стероидрезистентным нефротическим синдромом (СРНС), исследований нуклеотидной последовательности гена NPHS2 и оценки влияния тех или иных нуклеотидных замен на развитие стероидрезистентного нефротического синдрома, практически не проводилось, за исключением единичных работ (Приходина Л.С. и др., 2005, Полтавец, Н.М и др., 2007, Tikhomirov E, 2007).

Рис. 2 Расположение гена NPHS2 на 1 хромосоме Таким образом, актуальным является определение вклада полиморфных маркеров и мутаций гена NPHS2 в развитие резистентности к терапии глюкортикоидними препаратами у российских детей с СРНС, т.к. от его молекулярно-генетической диагностики может зависеть терапия НС и её эффективность.

Цель исследования Изучить роль полиморфных маркеров гена NPHS2 в развитии резистентности к глюкокортикоидной терапии у детей с нефротическим синдромом в российской выборке.

Для достижения этих целей были поставлены следующие задачи:

Задачи исследования 1. Сформировать репрезентативную выборку пациентов с признаками стероидрезистентного и стероидчувствительного нефротического синдрома для проведения молекулярно-генетического анализа гена NPHS2.

2. Провести полное секвенирование гена NPHS2 у детей с признаками стероидрезистентного и стероидчувствительного нефротического синдрома.

3. Изучить распределение полиморфных маркеров гена NPHS2 у детей с нефротическим синдромом (стероидчувствительная и стероидрезистентная формы) в зависимости от клинической формы заболевания.

4. Определить нуклеотидную последовательность гена NPHS2 у детей с нефротическим синдромом в зависимости от морфологических изменений в почках.

5. Разработать мультиплексную панель на наиболее значимые нуклеотидные замены гена NPHS2 у больных нефротическим синдромом, основанную на реакции удлинения олигонуклеотидов (SNaPshot).

Научная новизна работы Впервые у детей с нефротическим синдромом проведен комплексный молекулярногенетический анализ полиморфизмов гена NPHS2, основанный на изучении нуклеотидных последовательностей гена NPHS2 в группах стероидрезистентных, стероидчуствительных больных. Показано, что наиболее перспективным для целей диагностики СРНС в российской выборке детей является полиморфный маркер R229Q. Представленный в европейской популяции полиморфный маркер R138Q, описанный в работе Hinkes B., (2008), среди больных в российской выборки со стероидрезистентным нефротическим синдромом выявлен не был.

Впервые выявлена и описана новая мутация W256X, которая может приводить к образованию терминирующего кодона, прерывавающего синтез белка.

Впервые разработана мультиплексная панель, включающая в себя основные полиморфизмы гена NPHS2. Разработанная панель основана на реакции удлинения олигонуклеотида (SNaPshot). Предложенная панель позволила в 5 раз ускорить диагностику основных мутаций, описанных в гене NPHS2.

В случае семейного стреоидрезистентного нефротического синдрома была обнаружена ранее описанная мутация в гене NPHS2, приводящая к формированию терминирующего кодона Glu87Term, обрывающая синтез белка (Tikhomirov, (2007)).

Практическая значимость работы Выявление значимых аллельных вариантов полиморфных маркеров гена NPHSсвидетельствует о повышенном генетическом риске возникновения повреждения щелевой диафрагмы и как следствие развитие стероидрезистентной формы нефротического синдрома, что создает практическую и теоретическую базу для разработки диагностических методов прогнозирования терапии этого заболевания.

Разработанная мультиплексная панель (SNaPshot) позволяет проводить диагностику наиболее частых полиморфных маркеров, расположенных в гене NPHS2 в 5 раз быстрее, чем с помощью секвенирования методом Сэнгера.

Основные положения, выносимые на защиту 1. Разработаны последовательности олигонуклеотидов для амплификации и секвенирования всех экзонных областей гена NPHS2 с захватом промоторной и частичным захватом интронных областей.

2. Основные полиморфные маркеры, для которых показана ассоциация с стероидрезистентным нефротическим синдромом не выявлялись у здоровых детей и у больных со стероидчувствительным нефротическим синдром.

3. Наиболее распространённым, ассоциированным с резистентностью к стероидной терапии нефротического синдрома, в российской выборке больных детей является нуклеотидная замена G755A (R229Q). Полиморфный маркер R138Q, характерный для европейской популяции больных со СРНС в российской выборке не обнаружен.

4. В гене NPHS2 обнаружена новая, ранее не описанная нуклеотидная замена с.768G>A (W256X), приводящая к образованию терминирующего кодона, обрывающего синтез белка.

5. При семейной форме СРНС выявлена значимая нуклеотидная замена с.259G>T (Glu87Term).

6. Разработана мультиплексная SNaPShot панель, значительно ускоряющая проведения исследования 7 основных нуклеотидных замен в гене NPHS2, в том числе, в положениях соответствующим R138Q и R229Q.

Внедрение результатов работы в клиническую практику Результаты работы внедрены в клиническую практику нефрологического отделения НЦЗД РАМН, используются при медико-генетическом консультировании пациентов НЦЗД РАМН, в клинике нефрологии, внутренних и профессиональных болезней им. Е.М. Тареева и в учебном процессе кафедры медицинской генетики первого МГМУ им. И.М. Сеченова.

Апробация и публикации Материалы диссертации были представлены на XV Конгрессе педиатров России (Москва, 2010); Европейском конгрессе по генетике человека (Амстердам, 2010), V Европейском конгрессе педиатров (Вена, 2011), IV международной школе по молекулярной генетике (Звенигород, 2010); научных конференциях лаборатории мембранологии с группой генетических исследований НЦЗД РАМН.

По материалам диссертации опубликовано 7 печатных работ, включая 3 статьи в журналах входящих в список ВАК, а также тезисы докладов и сообщений на конференциях.

Структура и объём диссертации.

Диссертационная работа состоит из введения, обзора литературы, описания использованных материалов и методов, результатов собственных исследований, обсуждения, заключения, выводов и списка литературы. Материалы диссертации изложены на 115 страницах машинописного текста и иллюстрированы 11 таблицами и 15 рисунками.





Библиографический список включает в себя 131 источник из них 122 в зарубежных изданиях.

Материал исследования.

В исследование было включено 87 детей: 72 ребенка находились на стационарном лечении в нефрологическом отделении ФГБУ НЦЗД РАМН в период с 2008 по 2012 г., из них 57 с диагнозом СРНС, 15 со стероидчувствительным НС и 15 здоровых детей. Среди пациентов со стероидрезистентным нефротическим синдромом было 34 девочки, мальчика, в возрасте от 1 года до 17 лет, с длительностью болезни – от 5 мес. до 15 лет. У детей выявлен инфантильный нефротический синдром, 49 детей – с первичным стероидрезистентным нефротическим синдромом. В активной стадии находились ребенка, в стадии частичной ремиссии – 9 детей, в стадии полной ремиссии – 4 детей. Из 13 детей со cтероидрезистентным нефротическим синдромом, достигшими полной (n = 4) и частичной ремиссии (n = 9), 10 детей оказались чувствительны к терапии сандиммуном, 3 – к комбинированной терапии (сандиммун + селлсепт). Среди 15 детей со стероидчувствительным нефротическим синдромом (5 девочек, 10 мальчиков), в возрасте от 3 лет до 17 лет и с длительностью болезни от 2 лет до 9 лет, в активной стадии болезни находился 1 ребенок, остальные - в стадии полной ремиссии.

Методы исследования Морфологические методы исследования. Нами было исследовано 57 детей со стероидрезистентным нефротическим синдром, из них, биопсия почки проведена 55 детям, а также 8 детям со стероидчувствительным нефротическим синдромом. Чрескожная пункционная нефробиопсия проводилась в нефрологическом отделении НЦЗД РАМН заведующим клиникой, д.м.н., профессором Цыгиным А.Н. с использованием ультразвуковой визуализации и биопсийного пистолета с иглами типа Quick-Core диаметром 16-18 гейджей. Морфологическое исследование биоптата почки методом световой иммунофлуоресцентной микроскопии (окраски гематоксилин-эозин, трихром по Масону, ШИК-реакция) выполнялось в лаборатории патоморфологии на базе Детской городской клинической больницы №1 г. Москвы, д.м.н., профессором Леоновой Л.В.

(руководитель – профессор Талалаев А.Г.). Морфологическое исследование биоптата почки методом электронной микроскопии проводилось на базе ЭМ – ГУЗ Патологоанатомического бюро Ростовской области, к.м.н. Повилайтите П.Э. По данным световой и электронной микроскопии, у пациентов со стероидрезистентным нефротическим синдромом, фокально-сегментарный гломерулосклероз (ФСГС) был выявлен в 25 биопсийных образцах (45% случаев), болезнь минимальных изменений (БМИ) – в 22 (40%), мезангиопролиферативный гломерулонефрит (МезПГН) – 4 (7,2%), IgA-нефропатия – в 1 (2%), мембранопролиферативный гломерулонефрит – в 2 (4%), мембранозная нефропатия – в 1 (2%). У пациентов со стероидчувствительным нефротическим синдромом БМИ выявлялась в 6 биопсийных образцах, ФСГС – в 1, МезПГН – в 1, что значительно меньше, чем у больных с СРНС. Функциональнокомпенсированная стадия болезни определена у 51 ребенка со стероидрезистентным нефротическим синдромом и у всех детей со стероидчувствительным нефротическим синдромом. Хроническая болезнь почек III-V стадии выявлена у 6 детей со стероидрезистентным нефротическим синдромом: III стадия – у 4 детей, IV стадия – у 1, V стадия – у 1 ребенка.

Молекулярно-генетические методы. Молекулярно-генетические исследования проводились в лаборатории мембранологии с группой генетических исследований ФГБУ Таблица 1.

Последовательности олигонуклеотидов и особенности амплификации экзонных областей гена NPHSПоследовательность Длинна Название Экзон праймеров фрагмента NPHS2-ex 1_vne-F tgcgatgagcttctgtatctccgtcag (внешние) 1 9NPHS2-ex 1_vne-R cttcgtccccaacctgtaccacactc (внешние) NPHS2- ex 1_vnuF agacacagctgtcggggttcc (внутренние) 1 6NPHS2- ex 1_vnuF cttacgcccttccgttcctg (внутренние) NPHS2-ex2-F ggaccaacagatgctagtcagtg 2 2NPHS2-ex2-R agaaaacagaagtgagaatgggcatg NPHS2-ex3-F ggccttttgaagactttttctttctgggag 3 1NPHS2-ex3-R ggttgaagaaattggcaagtcaggag NPHS2-ex4-F cagaaaggtgaaacccaaacagcc 4 2NPHS2-ex4-R gagtataaataatcattttgtccacggtagg NPHS2-ex5-F ccacataggaaaggagcccaaga 5 3NPHS2-ex5-R ttaataaatgtccaatgaacaaatgaataaaag NPHS2-ex6-F gggtttaggcatgctctcctc 6 1NPHS2-ex6-R aaaccagaatattttcctttatcatacag NPHS2-ex7-Fnew agaggcttgcaagtctgtgtgaa 7 2NPHS2-ex7-R cccagtgcctaatgaatggacag NPHS2-ex8-F aacgcattccaccttaaattgtgatta 8 6NPHS2-ex8-R ctgtcattacatcatttcaccgtcttc “НЦЗД” РАМН (заведующий – проф. Пинелис В. Г.). Использовались следующие молекулярно-генетические методы: выделение ДНК, полимеразная цепная реакция (ПЦР), прямое автоматическое секвенирование, SNApShot. Для выделения геномной ДНК из лейкоцитов венозной крови использовали набор реактивов «Wizard Genomic DNA Purification Kit» фирмы «Promega» (США) в соответствии с протоколом производителя.

Хранение выделенной ДНК осуществляли при – 20°С. Амплификацию всех исследуемых фрагментов ДНК проводили методом ПЦР на программируемом термоциклере “DNA Engine thermal cyclers” (Bio-Rad). Дизайн праймеров для амплификации и секвенирования осуществлялся на основании данных GeneBank c использованием программ «Vector NTI Suite 8» и «Oligo 6.31» (Табл. 1). Состав реакционной смеси для амплификации фрагментов был стандартным: Taq Буфера х10 (pH=8.6) - 2,5 мкл; Taq полимеразы 5ед/мкл - 1 мкл;

магния хлорида 25 mМ р-ра - 1,5 мкл; cмеси дНТФ (5mМ) - 0,5 мкл; геномной ДНК - 1нг; стерильная деионизированная вода до конечного объема 25 мкл. Разделение и детекцию продуктов амплификации и ферментативного гидролиза проводили с помощью горизонтального электрофореза в 2,0% и 3,0% агарозном геле в зависимости от величины получаемых фрагментов. В качестве интерколирующего красителя использовали раствор бромистого этидия. Визуализацию результатов электрофореза проводили в УФ-свете на приборе гель-документации Gel Doc XR (Bio-Rad). Определение нуклеотидной последовательности гена подоцина (NPHS2) проводили на генетическом анализаторе Рис.3 Результат выравнивания сиквенсов гена NPHS2 между собой.

Applied Biosystems 3130. Секвенирование проводили в двух направлениях, как с прямого, так и с обратного праймеров. Для проведения сиквенсовой реакции использовали те же праймеры, что и для постановки ПЦР. Сиквенсовую реакцию проводили с использованием наборов BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), длина капилляров, в которых происходило разделение продуктов сиквенсовой реакции, составляла 36 см. Для разделения продуктов сиквенсовой реакции использовали полимер POP7 (Applied Biosystems). Полученные нуклеотидные последовательности гена NPHSвыравнивали с известной нуклеотидной последовательностью с помощью утилиты SeqMan из пакета программ Lasergene (Рис. 3). Для анализа результатов сиквенирования использовали программу Chromas. Олигонуклеотиды для мультиплексной панели SNaPshot были разработаны нами. Панель SNaPshot использовалась в 2 вариантах, в 1 варианте все семь олигонуклеотидов участвовали непосредственно в одной реакции (Рис. 4),во втором варианте производили 2 реакции. В первой реакции участвовали олигонуклеотиды под номерами 1, 2, 3, 6. Во второй реакции участвовали олигонуклеотиды под номерами 4, 5, 7.

Рис. 4. Результат разгонки мультиплексной SNaPshot реакции на генетическом анализаторе ABI 3130 у здорового ребёнка при исследовании гена подоцина.

Статистические методы. Статистическую обработку полученных данных проводили с использованием параметрической и непараметрической статистики. Расчеты осуществляли с использованием пакета «Statistica 6.0». Анализ признаков проводили с использованием критериев Стьюдента, отношения шансов, 2, двустороннего теста Фишера, непараметрического критерия Манн-Уитни. Использовали мультипликативную, общую и аддитивную модель наследования. Выводы о результатах использования моделей зависят от равновесия выборки по тесту Харди-Вайнберга. Уровень значимости p < 0,05 был принят достаточным для признания различий достоверными.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ СОБСТВЕННЫХ ИССЛЕДОВАНИЙ Настоящая работа посвящена анализу роли мутаций и полиморфных маркеров в гене подоцина и их генетической гетерогенности в развитии стероидрезистентного нефротического синдрома, что позволило разработать систему индивидуального прогнозирования течения заболевания и с учетом генетических особенностей использовать более рациональную терапию.

Молекулярно-генетические исследования были проведены у 87 детей. Из них, детей были исследованы методом прямого секвенирования методом Сэнгера.

Распределение аллелей соответствовало закону Харди-Вайнберга. При этом у 38 больных со СРНС были обнаружены различного рода нуклеотидные замены в экзонных, интронных областях, а также в промоторной части гена NPHS2, и только у одного больного в исследуемой нуклеотидной последовательности, не было обнаружено отклонений. У больных было обнаружено 11 различных нуклеотидных замен (Табл. 2), из них 5 (S96S Таблица Нуклеотидные замены обнаруженные методом прямого секвенирования у больных с нефротическим синдромом (мультипликативная модель наследования) Частота мутантного аллеля в группах, % Аминокислотные № Больные Больные 2* p замены db SNP Контрольной с СЧНС с СРНС (n=15) (n=15) (n=39) Промоторная область IVS1-31G>A rs1079291 6,7 6,7 11,5% 0.56 0.c.35 G>T rs12406197 3,3 3,3 11,5% — 0.Интронная область IVS3+1507C>T (новая) 0 0 15% — 0.IVS7+7A>G - 0 0 3% — 0.IVS7+54G>A rs11808359 0 3% 5% — 0.IVS7+1078G>C rs2274624 3,3% 3% 7% — 0.Экзонная область R229Q rs61747728 0 0 11% — 0.W256X (новая) 0 0 2,6% — 0.S96S rs3738423 3,3% 16% 7% — 0.A318A rs1410592 63,3% 36% 46% 0.79 0.L346L rs3818587 3,3%. 10% 6% — 0.* значения 2 приведены только для групп (СРНС и контрольной) с минимальной численностью каждого класса больше 4.

(rs3738423), A318A (rs1410592), L346L (rs3818587), W256X, R229Q (rs61747728)) находились в кодирующей области, 4 в интронной области (IVS3+1507C>T, IVS7+7A>G, IVS7+54G>A, IVS7+1078G>C), 2 в промоторной (IVS1-31G>A (rs1079291), rs1240619). У 24 больных были выявлены по 2 и более полиморфных маркеров в гене NPHS2.

Аминокислотная замена R229Q была выявлена в 20,5% случаев. Среди описанных полиморфизмов обнаружены 2 новые нуклеотидные замены: первая из них (IVS3+1507C>T) была выявлена в интронной области и вторая (W256X), - в кодирующей.

Аминокислотную замену R229Q (rs61747728) в гомозиготном состоянии имел 1 больной, нуклеотидные замены R229Q (rs61747728) и IVS3+1507C>T в гетерозиготном состоянии имели 2 больных. У остальных 5 больных аминокислотная замена R229Q (rs61747728) была представлена в различных комбинациях с другими полиморфизмами или в единственном числе. Одна аминокислотная замена (W256X) ранее не была описана (базы данных NCBI и HGMD). Анализ данных, полученных с помощью прямого секвенирования гена NPHS2, показал наличие значимых мутаций R229Q и W256X, только у больных со СРНС (Табл 3, Рис. 5). Кроме того, только у этих больных в сочетании с R229Q выявлен полиморфизмы IVS3+1507С>T и IVS7+7A>G (Рис.6). Нуклеотидные замены S96S, A318A, L346L, обнаруженные в экзонных областях гена NPHS2, встречаются с примерно равной частотой во всех исследованных выборках детей, что позволяет рассматривать их в качестве полиморфизмов, не влияющих на синтез подоцина. Полученные результаты хорошо согласуются с данными других авторов.

На рисунке 6 представлены нуклеотидные замены, выявленные в интронной области.

Нуклеотидные замены IVS3+1507С>T и IVS7+7A>G встречались только в группе стероидрезистентных и не встречались в других группах. Нуклеотидная замена IVS7+54G>A была представлена как в группе стероидрезистентных, так и в группе стероидчувствительных. Нуклеотидная замена IVS7+1078G>A была представлена во всех группах. Таким образом, анализ результатов проведенных исследований показал, что в российской выборке больных перспективной для целей диагностики является нуклеотидная замена G755A (rs61747728), соответствующая аминокислотной замене R229Q (Рис. 7). Полученные нами данные показывают, что у больных СРНС нуклеотидная замена G755A (R229Q) встречается достоверно чаще (2=3,78, p=0.05) по сравнению с группами стероидчуствительных и здоровых детей. Ранее было показано, что эта замена ассоциирована с протеинурией и микроальбуминурией (Pereira A.C. et al, (2004)). Однако Weber S. et al. (2004), исследовали 319 пациентов из Франции и североафриканских стран, и пришли к заключению, что G755A (R229Q) является лишь полиморфизмом, вероятно не приводящим к развитию протеинурии. В тоже время Karle S. M. et al. (2002), провели исследование 53 пациентов из 27 семей, а также 25 спорадических случаев нефротического % Стероидрезистентные Стероидчуствительные Группа сравнения (здоровые) R229Q W256X S96S A318A L346L Рис. 5. Частота полиморфных маркеров гена NPHS2, расположенных в экзонной области, у стероидрезистентных, стероидчуствительных больных и у детей в группе сравнения.

синдрома и отметили, что G755A (R229Q) встречался в 3 из 4 семей, имеющих одну мутацию в гене NPHS2. При этом авторы, правда, отмечают, что функция аминокислотной замены R229Q неизвестна и относят данную замену к значимым полиморфизмам. С другой стороны, Bakr A. et al. (2008), исследовав 16 египетских пациентов со стероидрезистентным нефротическим синдромом, не обнаружили замены R229Q, также % Группа сравнения (здоровые) Стероидчуствительные Стероидрезистентные Рис.6. Частота полиморфных маркеров гена NPHS2, расположенных в интронной области у стероидрезистентных, стероидчуствительных больных и у детей в группе сравнения.

Рис. 7. Прямое секвенирование гена подоцина у больного со СРНС, полиморфный маркер R229Q эти авторы не обнаружили и другой известной замены R138Q. Niaudet P. et al. (2004), указывают на то, что в 10-30% случаев при спорадическом стероидрезистентном нефротическом синдроме обнаруживается мутация R229Q в гене NPHS2. Hinkes B. et al.

T C >A >G C> G> A 4G 7+ 7+ VS 3+ I 7+ VS I VS VS I I (2008), показали, что при семейном нефротическом синдроме замена R229Q присутствует в 27,7% случаев. В нашем исследовании замена R229Q обнаруживалась у 20,5% больных со СРНС (частота мутантного аллеля R229Q составила 11%). Это согласуется с ранее опубликованными данными, полученными на европейских и американских выборках (Niaudet P. et al, 2004). Нами так же показано, что замена R229Q достоверно чаще выше встречается в группе больных со стероидрезистентным синдромом в сравнении со здоровыми и больными со СРНС. Хотя, многие авторы указывают замену R229Q как популяционный полиморфизм (Weber S. et al, 2004), другие показывают его ассоциацию с протеинурией, липидемией, микроальбуминурией (Hinkes B. et al, 2008).

Среди больных с обнаруженной заменой R229Q (rs61747728) у троих больных после проведённой терапии метилпреднизолоном и циклоспорином, болезнь перешла в стадию ремиссии, а у 5 больных ремиссия не была достигнута. Тот факт, что у большинства больных, имеющих R229Q в группе со стероидрезистентным нефротическим синдромом, не проявилась стадия ремиссии согласуется с современными представлениями о взаимосвязи R229Q с резистентностью к глюкокортикоидной терапии.

Многие авторы в своих работах отмечают, что наиболее распространённой мутацией характерной для западноевропейской популяции является замена R138Q. Hinkes B. et al.

(2008), при исследовании 430 пациентов с семейным стероидрезистентным нефротическим синдромом из европейской популяции отметил, что замена R138Q встречается в 57,5% случаев. В нашем исследовании аминокислотная замена R138Q в исследуемой выборке не была обнаружена. Возможно, это связано с особенностями выборки больных стероидрезистентным нефротическим синдромом. Полтавец и др. (2006), исследовали ген NPHS2 у 21 ребёнка и также не выявили никаких полиморфизмов этого гена.

Особый интерес вызывает, новая, обнаруженная нами, и ранее не описанная нуклеотидная замена, соответствующая W256X, ведущая к образованию терминирующего кодона, в результате может быть нарушение синтеза подоцина. Мы не обнаружили упоминания о ней в литературных источниках, также этой замены нет в интернет базах данных. У 2 больных с семейным СРНС, нами была обнаружена описанная ранее замена в кодоне Glu87Term (Tikhomirov, 2007).

В нашей выборке были обнаружены 2 нуклеотидных замены, расположенные в 5’- нетранслируемой области гена NPHS2. Одна из них находилась в промоторной области в положении IVS1-31G>A, а другая, в 5’ - нетранслируемой области в положении c.35G>T.

Ранее были предприняты попытки исследования промотора гена NPHS2. Duca M. Di. et al, (2006) с соавторами исследовал промоторную область гена NPHS2 на наличие cis- и trans- регуляторных элементов. В его работе приняли участие 542 пациента с различными нефропатиями. В результате было выявлено, что сочетание двух полиморфных маркеров в положениях -116С / -51С среди больных с IgA нефропатией ассоциируется с протеинурией и повышенным уровнем креатинина. В наших исследованиях положения -116С / -51С не были изучены, вследствие их удалённости от кодирующей области. Однако было показано, что нуклеотидная замена IVS1-31G>A (rs1079291), расположенная в промоторной области, встречается достоверно чаще в группе больных с болезнью минимальных изменений, по сравнению, с контрольной группой. Caridi G. et al., (2005), рассматривая промоторную область гена NPHS2, указывают на то, что наличие нуклеотидных замен в промоторной области этого гена, вероятно, могут приводить к снижению экспрессии гена, и следовательно, к уменьшению синтеза подоцина.

Во многих работах описываются нуклеотидные замены, не изменяющие аминокислотную последовательность белка. В гене NPHS2 к таким заменам относятся:

G34G, S96S, A318A, L346L. В исследованиях, проводимых другими авторами, обнаруживаются данные замены в различных комбинациях, однако, их относят к полиморфным маркерам, не оказывающим влияния на повреждение щелевой диафрагмы.

Так, например, McKenzie LM et al. (2007) обнаружили различные синонимичные нуклеотидные замены в гене NPHS2. Авторы считают, что синонимичные замены, также как и нуклеотидные замены в интронной области гена NPHS2, не ассоциированы с фокальносегментарным гломерулосклерозом. Karle S.M. et al. (2002), др. в своей работе указывают на полиморфные маркеры A318A, G34G, S96S, L346L в гене NPHS2, которые не связаны с нарушениями синтеза подоцина. В настоящей работе также были обнаружены полиморфные маркеры, характерные для гена NPHS2: A318A, G34G, S96S, L346L.

Статистический анализ подтвердил отсутствие ассоциации с резистентностью к терапии нефротического синдрома (p>0,05).

Для гена NPHS2 также известны различные нуклеотидные замены в интронной области. Наиболее интересной из часто встречающихся является нуклеотидная замена IVS7+7A>G. Полтавец и др. (2006), обнаружили данную нуклеотидную замену у больных со стероидрезистентным нефротическим синдромом в российской выборке. Caridi G. и др.

(2001), также обнаружил вышеуказанную замену. Однако, ассоциация с развитием резистентности к терапии или возникновение патологических состояний, в этих работах выявлена не была. Как показали наши исследования, этот полиморфизм чаще встречался в группе больных СРНС, по сравнению с другими группами (p>0,05). Такая ситуация может быть объяснена его близким расположением к экзонной области 7 экзона, а значит, и возможным участием в формировании сайта сплайсинга между экзонной и интронной областями 7 экзона, однако данные оказались не достоверными из-за небольшой выборки.

В настоящее время известно, что клиническая значимость нуклеотидных замен в сайте сплайсинга неравнозначна. Как правило, считают, что сайт сплайсинга состоит из восьми нуклеотидов в интронную и экзонную сторону, наиболее критичными из них являются мутации в первом и втором положениях, далее клиническая значимость нуклеотидных замен может снижаться и к восьмому нуклеотиду она сводится к минимуму. В наших исследованиях показано, что нуклеотидная замена IVS7+7A>G в седьмом положении интрона, встречалась чаще в группе больных с стероидрезистентным нефротическим синдромом (p>0,05). Отсюда мы предположили возможный механизм патологического воздействия нуклеотидной замены IVS7+7A>G, когда данная замена может приводить к нарушению сплайсинга после чего образуется дефектная молекула белка.

В интронной области гена подоцина были обнаружены нуклеотидные замены в следующих положениях: IVS3+1507C>T, IVS7+54G>A, IVS7+1078G>C. Нуклеотидная замена IVS7+1078G>C присутствовала только в группе, где ремиссия не была достигнута.

Замена IVS3+1507C>T описана нами впервые. Нуклеотидная замена IVS3+1507C>T в группе больных с последующей ремиссией встречалась 3 раза, а в группе больных без ремиссии 6 раз. Однако механизмы влияния нуклеотидных замен, находящихся в интронной области, остаются не ясными и требуют дополнительные исследований, включающие анализ мРНК гена подоцина. Также у одного пациента из группы больных, где ремиссия не была достигнута, были обнаружены обе нуклеотидные замены rs617477(R229Q) и IVS7+1078G>C.

В настоящей работе были обследованы дети с семейной формой СРНС (2 случая из одной семьи). У обоих больных обнаружена нуклеотидная замена с.259G>T (Glu87Term), о которой ранее в своей работе сообщил Tikhomirov Е. (2007).

Группа из 39 больных со СРНС, исследованная методом прямого секвенирования, была разбита согласно морфологическому анализу биоптата почек на 3 подгруппы:

больные с болезнью минимальных изменений (14 человек), больные с фокальносегментарным гломерулосклерозом (16 человек) и мезангиопролиферативным гломерулонефритом (4 человека). А также по возрасту: первая группа дети до двух лет (человек), вторая группа дети старше двух лет (23 человека). Каждую группу больных с одним морфологическим признаком или возрастом больных сравнивали соответственно с так называемой «контрольной» группой отличающиейся другими морфологическими проявлениями или по возрасту.

В группе больных с болезнью минимальных изменений обращают на себя внимание нуклеотидная замена в промоторной области: IVS1-31G>A (rs1079291). В этой группе больных состоящей из 14 человек эта нуклеотидная замена встречалась у 5 человек, а в контрольной группе (стероидрезистентные больные без данной морфологической парадигмы), состоящей из 25 человек, - только у 2 детей (Рис. 8). Частота мутантного аллеля в контрольной группе была 5,6%, а в группе больных - 21%, ассоциация этой нуклеотидной замены с болезнью минимальных изменений оказалась статистически достоверной (2 =4.75 и p=0.03).

Другая нуклеотидная замена (c.35G>T (rs12406197)), так же расположенная в промоторной области встречается с одинаковой частотой, как в «контрольной группе», так и в группе больных с болезнью минимальных изменений. Также в этой группе, для нуклеотидной замены rs61747728 (R229Q) не было существенных различий между группой больных и контрольной группой. Описанная выше замена встречалась в 21,4% и 20% соответственно. Нуклеотидные замены IVS3+1507C>T, IVS7+1078G>C (rs2274624), A318A (rs1410592), L346L (rs3818587) встречались примерно одинаково в обеих группах.

Необходимо отметить, что только у одного больного со СРНС (болезнь минимальных изменений) встретилась, как уже отмечалась выше, впервые описанная в настоящей работе новая мутация W256X.

Группа больных со СРНС, для которых был определён фокальносегментарный гломерулосклероз (Рис 8) состояла из 16 детей, а «контрольная» группа из 23 человек. В этой группе, также обращает на себя внимание нуклеотидная замена IVS1-31G>A (rs1079291). При этом частота встречаемости мутантного аллеля в контрольной группе была 17,4% (6 больных), а в группе больных 3,1% (1 больной) (2=3.76, p=0.05). Остальные нуклеотидные замены представлены в равной степени в группе больных и в соответствующей “контрольной” группе.

В группе с мезангиопролиферативным гломерулонефритом (Рис 8), а также в группах, сформированных по показателю возраста больных (2 группы, первая до 2 лет, вторая старше 2 лет) значимые полиморфизмы в гене NPHS2 встречались с одинаковой частотой по сравнению с контрольной группой.

% Больные с болезнью минимальных изменений (A) БМИ Контрольной % Больные с фокальносегментарным гломерулосклерозом (Б) ФСГС Контрольной % Больные с мезангиопролиферативным гломерулонефритом (C) Больных Контрольной Рис.8 Нуклеотидные замены в группе стероидрезистентных больных с больные с болезнью минимальных изменений (А), больные с фокальносегментарным гломерулосклерозом (Б) и мезангиопролиферативным гломерулонефритом (С).

L S T T X A Q > >G C G> G>C G>A A S LA +R W -c.

S S ++V I V I S S V V I I L S C A Q >T > C G>T G>C G G>A S L AR+c.S +S +V V I I S S V V I I A A Q >C >G A G> 4G A R 7+ 17+ VS I VS VS I I Метод реакции элонгации олигонуклеотида (SNaPshot) в ряде случаев позволяет отказаться от прямого секвенирования всей последовательности того или иного гена, что существенно ускоряет молекулярно-генетическую диагностику по выбранным “точкам” в последовательности ДНК. По этому, для исследования больных стероидрезистентным нефротическим синдром нами была разработана мультиплексная панель, основанная на реакции элонгации олигонуклеотида (SNaPshot). Ранее, различными авторами, в том числе Berdeli A. et al. (2007), было показано, что в гене NPHS2 существуют несколько позиций, в которых нуклеотидные замены, приводящие к стероидрезистентной форме нефротического синдрома, встречаются особенно часто. Выборочное исследование этих “горячих точек” позволило бы избежать трудоёмкого исследования методом прямого автоматического секвенирования экзонной части гена NPHS2 и существенно ускорить и удешевить диагностику стероидрезистентного нефротического синдрома оставив значения чувствительности и специфичности метода на уровне равном секвенированию.

Основной проблемой при разработке мультиплексной панели является сложность предсказания всех взаимодействия между олигонуклеотидами, которые возможно будут происходить во время проведения реакции элонгации.

Основываясь на ранее опубликованных данных Stephen T. et al. (2008), мы разработали мультиплексную SNaPshot панель для диагностики замен в следующих положениях: R138Q, Q215X, R229Q, T232I, E237Q, A242V, c.396A>T. Разработанная панель была отлажена на генетическом анализаторе ABI 3130. В процессе проверки панели были исследованы три человека с нуклеотидной заменой R229Q в трёх аллельных вариантах, полученных методом прямого сиквенирования.

Результаты, полученные с помощью SNaPshot панели, подтвердили аллельные варианты, определённые ранее методом прямого секвенирования. На следующем этапе с помощью представленной мультиплексной панели была исследована группа из 18 человек.

Среди исследуемых пациентов у 1 была обнаружена замена G755A (R229Q) в гомозиготном состоянии. Проверка полученных результатов методом прямого секвенирования подтвердила их достоверность. Согласно нашим данным на секвенирование гена NPHS2 c помощью автоматического секвенатора методом Сэнгера требовалось до 14 дней, на анализ ампликонов с помощью реакции удлинения нуклеотида необходимо только 3 дня. Таким образом, использование SNaPshot позволило в 5 раз ускорить исследование.

ЗАКЛЮЧЕНИЕ Таким образом, в настоящей работе нами были разработаны последовательности олигонуклеотидов для амплификации экзонных, промоторной и интронных областей гена NPHS2. Проведено исследование кодирующей области гена NPHS2 у больных российской выборки в группах со стероидрезистентным нефротическим синдромом, стероидчувствительным нефротическим синдромом и группой условно здоровых. Впервые для российской выборки больных проведено генетическое сравнение групп стероидрезистентных и стероидчувствительных больных. Были обнаружены характерные для российской выборки детей полиморфные маркеры и мутации (IVS1-31G>A, c.35G>T, IVS3+1507C>T, IVS7+7A>G, IVS7+54G>A, IVS7+1078G>C, R229Q, W256X, S96S, A318A, L346L). Показана диагностическая значимость нуклеотидной замены G755A (R229Q) для изученной выборки российских больных СРНС. Выявлена новая ранее не описанная нуклеотидная замена с.768G>A (W256X) приводящая к образованию терминирующего кодона и, таким образом, обрывающая синтез полипептидной цепи. Нами были исследованы 2 случая семейного стероидрезистентного нефротического синдрома, при которых была подтверждена обнаруженная ранее замена Glu87Term в гомозиготном состоянии (Tikhomirov 2007). Разработана мультиплексная панель SNaPshot для определения частых мутаций в гене подоцина (NPHS2), которая может быть применена для более быстрой диагностики основных мутаций в гене подоцина. Полученные данные важны для проведения диагностики и обследования больных с нефротическим синдромом, что позволит использовать адекватные методы терапии.

ВЫВОДЫ:

1. Разработаны и использованы оригинальные последовательности олигонуклеотидов для амплификации и секвенирования экзонных областей гена NPHS2 с захватом промоторной области и частичным захватом интронных областей.

2. Установлено, что основные полиморфные маркеры, для которых выявлена ассоциация с стероидрезистентным нефротическим синдромом, слабо представлены в группе больных со стероидчуствительным нефротическим синдромом.

3. Нуклеотидная замена G755A (R229Q) в гене NPHS2 является наиболее распространённым полиморфизмом, ассоциированным со стероидрезистентным нефротическим синдромом в российской выборке больных детей. Этот полиморфизм был выявлен у 20,5% больных со СРНС (частота мутантного аллеля составила 11%).

Полиморфный маркер R138Q, который наиболее часто встречается в европейской популяции больных со стероидрезистентным нефротическим синдромом, не был выявлен в исследованной выборке детей.

4. У детей со стероидрезистентным нефротическим синдромом была выявлена нуклеотидная замена в сайте сплайсинга IVS7+7A>G, которая не встречается в группе здоровых и больных со стероидчуствительным нефротическим синдромом. Установлена значимая ассоциация нуклеотидной замены в промоторной области гена подоцина (IVS131G>A) у больных со СРНС и болезнью минимальных изменений.

5. У одного больного с стероидрезистентным нефротическим синдромом выявлена новая, ранее не описанная нуклеотидная замена с.768G>A (W256X) в гене NPHS2, приводящая к образованию терминирующего кодона, что предполагает нарушение синтеза подоцина.

6. При семейной форме стероидрезистентного нефротического синдрома была выявлена гомозиготная мутация Glu87Term.

7. Разработанная мультиплексная SNaPShot панель отдельных SNP позволила в 5 раз ускорить выявление 7 основных нуклеотидных замен в гене NPHS2, в том числе и R229Q, может быть использована при скрининге больных с нефротическим синдромом.

Благодарности:

д.б.н., профессору Носикову В.В. за внимание и поддержку при выполнении работы.

д.м.н., профессору Асанову А.Ю. за консультации при написании работы.

СПИСОК ОПУБЛИКОВАННЫХ РАБОТ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Корниенко В.Ю., Алябьева Н..М., Вашурина Т.В., Цыгин А.Н., Пинелис В.Г., Асанов А.Ю “ Изучение гетерогенности гена NPHS2 у детей со стероидрезистентным нефротическим синдромом ” Молодой учёный. 2012 (1) т.2 с.131-135.

2. Корниенко В.Ю., Алябьева Н..М., Вашурина Т.В., Цыгин А.Н., Пинелис В.Г., Асанов А.Ю.

“Результаты секвенирования гена NPHS2 у детей со стероидрезистентным синдромом” Вопросы диагностики в педиатрии 2011 т.3 №5 с.26-3. Корниенко В.Ю., Алябьева Н..М., Вашурина Т.В., Цыгин А.Н., Пинелис В.Г., Асанов А.Ю.

“Результаты секвенирования гена NPHS2 у детей со стероидрезистентным синдромом” Инновационные технологии в генетитике и детской эпилептологии. 2011 с.163-14. Корниенко В.Ю. “Результаты секвенирования гена NPHS2 у детей со стероидрезистентным синдромом” Инновационные технологии в генетитике и детской эпилептологии. 2011 с.163168.

5. Kornienko V.U. “Mutation analysis of the NPHS2 gene with the direct DNA sequencing method in Russian children with steroid-resistant nephritic syndrome” European Human Genetics Conference 2011, abstract book, P02.16. Корниенко В.Ю. “Генетическая гетерогенность гена NPHS2 у детей со стероидрезистентным нефротическим синдром” XV Конгресс педиатров, сборник тезисов, с.7. Корниенко В.Ю. “Секвенирование гена NPHS2 у больных стероидрезистентным нефротическим синдром” IV международная школа молодых ученых по молекулярной генетике «Геномика и биология клетки», сборник тезисов, c. Корниенко Владимир Юрьевич ГЕТЕРОГЕННОСТЬ ПОЛИМОРФИЗМОВ В ГЕНЕ NPHS2 У ДЕТЕЙ С НЕФРОТИЧЕСКИМ СИНДРОМОМ Нефротический синдром объединяет гетерогенную группу гломерулярных болезней и является одной из актуальных проблем детской нефрологии. Известно, что мутации в гене NPHS2, кодирующем ключевой белок в щелевой диафрагме, могут быть ответственны за развитие стероидрезистентной формы нефротического синдрома. Чтобы изучить роль полиморфизмов гена NPHS2 в этиологии и патогенезе нефротического синдрома мы исследовали 72 подтверждённых биопсией больных со стероидрезистентной и стероичувствительной формами нефротического синдрома и 15 условно здоровых. В случаях для исследования мы применяли метод элонгации олигонуклеотида (SNaPShot).

Было установлено, что основные полиморфные маркеры, для которых выявлена ассоциация с стероидрезистентным нефротическим синдромом (СРНС), слабо представлены в группе больных со стероидчуствительным нефротическим синдромом.

Нуклеотидная замена G755A (R229Q) в гене NPHS2 является наиболее распространённым полиморфизмом, ассоциированным со стероидрезистентным нефротическим синдромом в российской выборке больных детей. Этот полиморфизм был выявлен у 20,5% больных со СРНС (частота мутантного аллеля составила 11%). Полиморфный маркер R138Q, который наиболее часто встречается в европейской популяции больных со стероидрезистентным нефротическим синдромом, не был выявлен в исследованной выборке детей. У детей со стероидрезистентным нефротическим синдромом была выявлена нуклеотидная замена в сайте сплайсинга IVS7+7A>G, которая не встречается в группе здоровых и больных со стероидчуствительным нефротическим синдромом. Установлена значимая ассоциация нуклеотидной замены в промоторной области гена подоцина (IVS1-31G>A) у больных со СРНС и болезнью минимальных изменений. У одного больного с стероидрезистентным нефротическим синдромом выявлена новая, ранее не описанная нуклеотидная замена с.768G>A (W256X) в гене NPHS2, приводящая к образованию терминирующего кодона, что предполагает нарушение синтеза подоцина. При семейной форме стероидрезистентного нефротического синдрома была выявлена гомозиготная мутация Glu87Term. Разработанная мультиплексная SNaPShot панель отдельных SNP позволила ускорить примерно в 5 раз выявление 7 основных нуклеотидных замен в гене NPHS2, в том числе и R229Q и поэтому может быть использована при скрининге таких больных.

Kornienko Vladimir Yuryevich HETEROGENEITY OF POLYMORPHISMS IN THE GENE NPHS2 IN CHILDREN WITH NEPHROTIC SYNDROME.

Nephrotic syndrome combines a heterogeneous group of glomerular diseases and is one of the urgent problems of Pediatric Nephrology. It is known that mutations in NPHS2, the gene that encoded podocin, a key protein of podocyte slit diaphragm, may be responsible for the development of steroid-resistant forms of nephrotic syndrome. To investigate the role of NPHS polymorphisms in etiology and pathogenesis of nephrotic syndrome, we studied 72 biopsyconfirmed cases and 15 controls. The method of direct sequencing by Singer was used in patients with steroid-resistant and steroid-sensitive nephritic syndrome and 15 controls; in cases we employed genotyping by single-base extension of oligonucleotides (SNaPshot). It was established that the main polymorphic markers, which depicted an association with steroidresistant nephrotic syndrome (SRNS), were poorly exhibited in the group of patients with steroidsensitive nephrotic syndrome. Nucleotide substitution G755A (R229Q) in the NPHS2gene is the most frequent polymorphism associated with steroid-resistant form of nephrotic syndrome in Russian children. R229Q polymorphism was detected in 20.5% of patients with SRNS (mutant allele frequency was 11%). Polymorphic marker R138Q, which is most common in the European population of patients with steroid-resistant nephrotic syndrome, was not found in our patients.

Nucleotide substitution in the splice site IVS7+7A>G was detected only in children with steroidresistant nephrotic syndrome, this substitution was not found in steroid-sensitive and healthy children. At first we identified new nucleotide substitution 768G>A (W256X) in the gene NPHSthat was detected in one patient. This substitution probably leads to the formation of a stop codon, which decreases synthesis of podocin. In family form of steroid-resistat nephrotic syndrome was found homozygous mutation Glu87Term. The significant association of nucleotide substitution in the promoter region of the gene podocin (IVS1-31G>A) was established in patients with SRNS and with minimal change disease. We have developed a multiplicative SNaPShot panel to diagnose the main nucleotide polymorphisms associated with steroid-resistant nephrotic syndrome. This method was at 5 times faster than direct sequencing.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.