WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Демина Анна Владимировна Генетическое разнообразие энтеровирусов, циркулирующих на территории Западной Сибири и Сахалинской области.

Молекулярно-биологический анализ геномов потенциально онколитических энтеровирусов Коксаки А7 и Коксаки В6 03.02.02 – вирусология

Автореферат диссертации на соискание ученой степени кандидата медицинских наук

Кольцово-2012 Раб на в Федеральн м учреждении дарственный бота выполнен ном бюджетном и науки «Госуд нау ирусологии и б и «Вектор»» М азвития учный центр ви биотехнологии Минздравсоцра Рос ссии Нау член-к т РАН, доктор их наук, учный корреспондент р биологически рук профе орович ководитель ессор Нетесов Сергей Викто Оф Бочар ктор медицинс фициальные ров Евгений Федорович - док ских наук, опп профе ГНЦ ВБ «Вект ик поненты: ессор, ФБУН Г тор», помощни генерального дирек ртно-аналитич ктора по экспер ческой и научн льной работе но-образовател Рябчи вановна - докт ских наук, икова Елена Ив тор биологичес профе М СО РАН, ста й сотрудник ессор, ИХБФМ арший научный Вед зация ждение россий и медицинских дущая организ Учреж йской академии х наук Инсти елита и вирусн тов имени итут полиомие ных энцефалит М.П. Чумакова РАМ МН Защ я « 25 » з сертационного щита состоится мая 2012 г. в 9.00 часов на заседании дисс о сов Д 208.020.01 при ФБУ «Государс чный в и вета УН ственный науч центр вирусологии и био « а 9, р.п. Кольцо рского района отехнологии «Вектор»» по адресу: 630559 ово, Новосибир а Новосибирской о 383)336-74-области, тел. (С д можно ознаком иотеке ФБУН Г тор» диссертацией м миться в библи ГНЦ ВБ «Вект Авт ослан «_____» _____2012 г.

тореферат разо »____________ Ученый секретар онного совета д.б.н. Г рь диссертацио Г.П. Трошкова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Энтеровирусы человека принадлежат к роду Enterovirus семейства Picornaviridae, порядок Picornavirales. В настоящее время известно более 100 различных генотипов энтеровирусов. В соответствии с современной классификацией, которая базируется на молекулярно-генетических характеристиках геномов вирусов, выделяют 4 вида энтеровирусов человека (A, B, C, D) (King, 2011).

Одними из наиболее изученных представителей рода Enterovirus являются полиовирусы, которые относятся к виду энтеровирусов человека С. Вирусы полиомиелита (I, II и III типов) в течение долгого времени являлись причиной высокой заболеваемости людей, приводящей к инвалидизации части заболевших и даже к смерти. По данным Всемирной организации здравоохранения (ВОЗ) в одном из 200 случаев инфицирования развивается необратимый паралич (обычно ног), 510% из числа таких парализованных людей умирают из-за наступающего паралича дыхательных мышц (http://www.who.int/mediacentre/factsheets/fs114/ru/index.html). В результате проведенных научных исследований вирусов полиомиелита и разработки вакцин в борьбе с данной инфекцией достигнут значительный успех, ведущий к возможному искоренению этой инфекции. Так, по данным ВОЗ за период с 1988 по 2011 гг. число случаев заболевания полиомиелитом уменьшилось более чем на 99% – с 350000 случаев до 1349. В первой половине 2011 года лишь четыре страны – Афганистан, Индия, Нигерия и Пакистан – оставались эндемичными по полиомиелиту, в то время как в 1988 году число таких стран превышало 1(http://www.who.int/mediacentre/factsheets/fs114/ru/index.html).

Таким образом, всемирная программа ликвидации полиомиелита постепенно реализуется и в недалеком будущем может быть успешно завершена.

Однако в последние годы значительно возросла роль неполиомиелитных энтеровирусов в возникновении инфекционных заболеваний, что подтверждается результатами научных исследований. Например, вирус Коксаки А7 был первым из числа неполиомиелитных энтеровирусов, который уже в 50-е годы стал известен как возбудитель полиомиелитоподобного паралитического заболевания. В 1952-1968 гг.

вирус Коксаки А7 вызвал вспышки полиомиелитоподобной инфекции среди детского населения в Казахстане, Шотландии, Швеции, Швейцарии. В 80-х годах выявили новое заболевание глаз, которое вызвали вирулентные варианты вирусов ECHO19 и ECHO11, в результате оно получило название «острый энтеровирусный увеит». В России в 1980-1989 гг. зарегистрировано пять вспышек энтеровирусной инфекции, осложненной увеитом, в трех крупных городах Сибири (Красноярск и край 1980-1981;

1982, 1986; Омск 1987-1988; Иркутск 1988-1989).

Современные научные исследования показали возможную роль энтеровирусов в возникновении заболеваний, которые, как считалось ранее, не имели отношения к вирусам. Например, острые и хронические миокардиты могут быть вызваны вирусами Коксаки В. При первично диагностированном инсулинзависимом сахарном диабете у пациентов в три раза чаще обнаруживают антитела IgM к вирусам Коксаки А9, В1, В2, В3 и В5, чем у контрольных лиц; кроме того, у таких больных, нередко выявляют энтеровирусы молекулярными методами.

В настоящее время наиболее важным широко наблюдаемым проявлением энтеровирусной инфекции является серозный менингит. Первый подъем заболеваемости серозным менингитом энтеровирусной этиологии был зарегистрирован в мире в конце 40-х годов XX века. После периода относительного благополучия, на фоне снижения и отсутствия эпидемического полиомиелита, с начала 70-х годов во всем мире начался второй эпидемический подъем заболеваемости энтеровирусным серозным менингитом.

В Новосибирске и Новосибирской области за период с 1993 по 2004 гг.

зафиксировано три значительных вспышки серозного менингита энтеровирусной этиологии, в которые были вовлечены 365 человек (http://54.rospotrebnadzor.ru).

Анализ архивных материалов санитарно-эпидемиологической службы показал, что энтеровирусные заболевания начали эпизодически регистрироваться в России в составе острых кишечных инфекций неясной этиологии только с 1960-х годов. При этом не было надежных и дешевых средств диагностики, и поэтому сведения об их встречаемости в России носили отрывочный характер. Элементы эпидемиологического надзора за энтеровирусными (неполио) инфекциями на территории Российской Федерации введены лишь с 2006 г., и поэтому исследования, посвященные выявлению эпидемиологического значения неполиомиелитных энтеровирусов, немногочисленны.

Таким образом, роль неполиомиелитных энтеровирусов в возникновении инфекционных заболеваний велика, что требует углубления научных исследований и совершенствования практической медицины в этой области.

В настоящее время самыми информативными являются молекулярноэпидемиологические исследования энтеровирусных инфекций, поскольку их результаты позволят уточнить источники и пути передачи этих патогенов, предсказать возможные вспышки этих инфекций, а также наметить наиболее важные пути разработки вакцин против этих патогенов.

Цели исследования: изучение генетического разнообразия энтеровирусов человека в Западной Сибири и на Дальнем Востоке, а также молекулярногенетический анализ геномов штаммов энтеровирусов Коксаки А7 и Коксаки В6 с потенциальными онколитическими свойствами.

Задачи исследования:

1. Сбор и создание коллекции образцов ликвора и фекалий от пациентов с подозрением на энтеровирусную инфекцию для вирусологического и молекулярно-биологического исследования.

2. Исследование указанных образцов на наличие РНК энтеровирусов.

3. Изучение возможности культивирования изолятов энтеровирусов на культурах клеток.

4. Генотипирование изолятов энтеровирусов человека, встречающихся в Западной Сибири и на Дальнем Востоке.

5. Выявление возможных связей между генотипами изолятов энтеровирусов человека и клиническими синдромами, которые они вызывают.

6. Определение и молекулярно-генетический анализ полных нуклеотидных последовательностей геномов потенциальных онколитических штаммов энтеровирусов Коксаки А7 и Коксаки В6.

7. Исследование инфекционных (цитолитических) свойств штаммов потенциально онколитических энтеровирусов Коксаки А7 и Коксаки В6.

Научно-практическая значимость. Впервые проведено исследование заболеваемости энтеровирусными инфекциями, в том числе одной из наиболее социально значимых ее форм – серозным менингитом – в Новосибирске и Новосибирской области, а также исследование вспышки желудочно-кишечной инфекции в 2010 году в Сахалинской области.

Впервые установлены генотипы энтеровирусов, циркулирующих на территории Новосибирска, Новосибирской области и Сахалинской области.

Собрана коллекция биопроб от больных с энтеровирусной инфекцией, а также от больных с серозными менингитами различной этиологии: энтеровирусной, герпесвирусной и др.

Впервые проведен молекулярно-генетический анализ и исследование инфекционных (цитолитических) свойств геномов штаммов потенциально онколитических энтеровирусов Коксаки А7 и Коксаки В6.

Результаты проведенных исследований показывают несомненную необходимость молекулярно-эпидемиологического контроля над энтеровирусной инфекцией, в частности за серозным менингитом энтеровирусной этиологии и кишечными инфекциями.

Использованные в работе методики могут быть применены в практической медицине, в работе эпидемиологических служб при диагностике энтеровирусных инфекций.

Положения, выносимые на защиту:

1. Основным типом энтеровирусов, циркулирующих на территории Новосибирска и Новосибирской области и определяющим заболеваемость серозными менингитами в 2008 г., был ECHO30 (72%).

2. Случай энтеровирусной экзантемы полости рта и конечностей в г. Новосибирске, вызван вирусом Coxsackie A6.

3. Во время вспышки острой кишечной инфекции в августе 2010 г. в Сахалинской области основными возбудителями были энтеровирусы Cox A(45%) и Cox A4 (34%). Выделенные в Сахалинской обл. изоляты имеют наиболее высокую гомологию по нуклеотидной последовательности с энтеровирусами, выявленными в Восточной Азии: Японии (P2346/CB1/Kanagawa/2003 (AB162750), 1095-LPS1 (AB550333)), Китае (SSMCVB3 (GU109481)), Корее (2000/CSF/KOR (AY875692)) в 2000-2010 гг.

Вклад автора:

Сбор клинических образцов, анализ историй болезни пациентов с подозрением на энтеровирусную инфекцию на базе ГИКБ №1 г. Новосибирска, создание коллекции образцов РНК энтеровирусов, выделенных из различных биологических проб, собранных в Новосибирской и Сахалинской областях, тестирование олигонуклеотидных праймеров для генодиагностики и генотипирования РНК энтеровирусов выполнено лично автором. Выявление РНК энтеровирусов в поступивших образцах и определение нуклеотидных последовательностей выявленных вариантов, филогенетический анализ фрагментов геномов энтеровирусов, выявленных в Новосибирской и Сахалинской областях выполнено лично автором при участии В.А.Тернового. Определение полных нуклеотидных последовательностей и молекулярно-генетический анализ геномов штаммов LEV8 и LEV15 – совместно с В.А.Терновым, В.А.Святченко и А.Ю.Тикуновым.

Структура и объем работы. Диссертация изложена на 177 страницах машинописного текста и состоит из введения, обзора литературы, главы «Материалы и методы», главы «Результаты и обсуждение», выводов, списка литературы и приложения. Библиография включает 222 работы: 32 – отечественных авторов, 174 – зарубежных и 16 ссылок на электронный ресурс.

Работа иллюстрирована рисунками, 3 фотографиями и включает 19 таблиц.

Апробация результатов диссертации и публикации. По материалам диссертации опубликовано 5 статей в журналах, рекомендованных ВАК для кандидатских диссертаций; а также подана заявка на патент РФ №2011125215, дата приоритета 17.06.2011 г. (решение о выдаче патента от 05.03.2012 г.).

Полученные результаты исследований были доложены на Российских и Международных конференциях: на XV Научно-практической конференции врачей (г. Новосибирск, 2005); на XI Международном Симпозиуме по респираторным вирусным инфекциям (г. Бангкок, Таиланд, 2009); на I Всероссийском конгрессе по инфекционным болезням (г. Москва, 2009); на 20-ом Европейском конгрессе по клинической микробиологии и инфекционным заболеваниям (г. Вена, Австрия, 2010);

на VII Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика-2010» (г. Москва, 2010); на 21-ом Европейском конгрессе по клинической микробиологии и инфекционным заболеваниям (г. Милан, Италия, 2011); на 2-ой Международной конференции «Астана Биотех 2011» (г. Астана, Казахстан, 2011); на IV Всероссийском конгрессе по инфекционным болезням (г. Москва, 2012); на 22-ом Европейском конгрессе по клинической микробиологии и инфекционным заболеваниям (г. Лондон, Великобритания, 2012); на заседаниях Новосибирского областного общества эпидемиологов и инфекционистов в 2004-2011 гг.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Олигонуклеотидные праймеры были синтезированы в НИИ Химической биологии и Фундаментальной медицины СО РАН (Новосибирск) и ФБУН ГНЦ ВБ «Вектор» и очищены двукратной жидкостной хроматографией.

Штаммы энтеровирусов LEV8 и LEV15 любезно предоставлены П.М.

Чумаковым.

Клинический материал. В настоящей работе были использованы образцы спинномозговой жидкости и фекалий от 246 пациентов с диагнозом «серозный менингит», а также с подозрением на энтеровирусную инфекцию. Клинический материал был собран в МБУЗ г. Новосибирска Городской инфекционной клинической больнице №1 и в МУЗ г. Новосибирска Детской городской клинической больнице №в течение 2008 – 2009 гг.

Также в работе использованы образцы фекалий от 100 пациентов с острой кишечной инфекцией, 1 проба воды насосной и 1 проба 20% сметаны производства ОАО «Южно-Сахалинский молочный комбинат», поступивших из ФГУЗ ЦГиЭ Сахалинской области 01 сентября 2010 года.

Суспензию фекалий готовили интенсивным перемешиванием на приборе Vortex 1-3 г материала в 500 мкл 0,1М Na-фосфатном буфере pH 7,4, центрифугировали 15 мин при 4800g для удаления дебриса. Полученный супернатант хранили при -70°С и применяли в дальнейшем исследовании.

Для выделения РНК из спинномозговой жидкости брали по 100 мкл пробы.

Выделение нуклеиновых кислот производили из 100 мкл образца с использованием наборов «РИБО-сорб» (Интерлабсервис, Россия) согласно инструкции производителя.

Обратная транскрипция. Комплементарные ДНК синтезировали на матрице суммарной РНК с использованием набора реагентов «Реверта-L» (с randomпраймерами) (Интерлабсервис, Россия) согласно инструкции производителя.

Полимеразная цепная реакция. Для проведения ПЦР готовили смесь компонентов следующего состава (из расчета на одну пробу в 30 мкл смеси): 0,2 мM каждого из дезоксинуклеотидтрифосфатов, 1,5 мМ MgCl2, 30 мM Трис-HCl (рН 8,при +25°С), 16 мМ (NH4)2SO4, 0,1% Nonidet P40 («Sigma»), по 0,15 мкМ специфических олигонуклеотидных праймеров и 1,5 еа Taq ДНК полимеразы («СибЭнзим», Россия), 3 мкл исследуемой кДНК на 30 мкл реакционной смеси.

Температурные условия амплификации для разных пар праймеров подбирали экспериментально (типичные условия: 95°С – 5 min, Тотжига-30 sec, 72°С – 10 sec;

72°С – 7 min, 45 циклов).

Электрофоретический анализ и выделение ампликонов из геля. Продукты амплификации разделялись на 2% агарозном геле в буфере ТАЕ. Для визуализации ДНК гель окрашивался бромистым этидием. Гель фотографировали с использованием системы видеодокументирования Molecular Imager ChemiDoc XRS System 170-81(BIO-RAD, США). Для выделения продуктов амплификации из геля использовали набор Wizard SV Gel and PCR Clean-Up System (Promega, США).

Определение нуклеотидных последовательностей. После проведения ПЦР с праймерами к 5'-UTR и VP1 регионам образцы очищали с использованием набора Wizard SV Gel and PCR Clean-Up System производства «Promega» (США) и секвенировали по прямой и обратной цепи ДНК. Определение нуклеотидных последовательностей проводилось на автоматическом секвенаторе ABI 3130xl Genetic Analyzer (Applied Biosystems) (США). Все последовательности были определены дважды в независимых экспериментах.

Анализ последовательностей. Для генотипирования выявленных вариантов энтеровирусов проводили филогенетический анализ нуклеотидных последовательностей фрагментов 5’-UTR длиной 350 – 450 н.о. и VP1 длиной 350 – 400 н.о. Для сравнения использовали последовательности прототипных изолятов.

Множественное сравнение последовательностей осуществляли с использованием пакета программного обеспечения LaserGene 8. Филогенетический анализ и расчет молекулярных часов проводили с помощью программ MEGA 5 и TREE-PUZZLE (Schmidt, 2002), а также при помощи программы BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Настоящая работа выполнена на базе МБУЗ г. Новосибирска Городской Инфекционной Клинической больницы №1 – анализ архива историй болезни пациентов с диагнозом серозный менингит с 1993 по 2011 гг., непосредственное участие в диагностике и лечении пациентов с серозными менингитами с 2004 по 20гг., сбор коллекции биологических сред (ликвора и фекалий) от больных с подозрением на энтеровирусную инфекцию, в том числе с серозными менингитами в 2008 – 2009 гг.

Лабораторная часть исследования выполнена в лаборатории молекулярной эпидемиологии ООИ Отдела молекулярной вирусологии флавивирусов и вирусных гепатитов ФБУН ГНЦ ВБ «Вектор» – выделение энтеровирусов из биологических сред, генотипирование изолятов и секвенирование выделенных изолятов, а также в вирусологической лаборатории Swedish Institute for Infection Disease Control, г. Стокгольм, Швеция.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ Расчет праймеров для определения генотипов энтеровирусов Ввиду отсутствия коммерчески доступных олигонуклеотидов для генотипирования энтеровирусов нами был проведен дизайн уникальных праймеров и флуоресцентно-меченного зонда для выявления и генотипирования энтеровирусов видов A, B, C, D (на 5’UTR).

Структуры праймеров, рассчитанных нами на основании сравнения нуклеотидных последовательностей различных штаммов энтеровирусов вида А, В, С, D, депонированных в международной базе данных GenBank, и использованных для амплификации фрагментов геномов энтеровирусов 5’UTR, а также VP1 приведены в таблице 1.

Таблица 1.

Праймеры, использованные для анализа проб методом ПЦР.

Название Район Нуклеотидная последовательность Позиция Т отжига праймера генома ЭВ в геноме (0 С) в направлении 53 F903-30 5’UTR CAAGNACTTCTGTTNCCYCGGACNGA 72-98 R41-32 5’UTR ATNTNTCAATTGTCANCATAAGCAGCCA 493-521 F40-31 5’UTR GAAGAGTCTATTGAGCTARTTGGT 328-352 R42-33 5’UTR ACACGGACACCCAAAGTAGTCGGTTC 446-472 Z951 5’UTR FAM–CCTYCGGCNCCTGAYTGCGGCTAATCC– 354-3BHQF224 VP3 GCIATGYTIGGIACICAYRT 1977-1996 F292 VP1 MIGCIGYIGARACNGG 2612-2627 R222 VP1 CICCIGGIGGIAYRWACAT 2969-2951 Праймеры для определения полной нуклеотидной последовательности энтеровирусов Коксаки А7 и Коксаки ВДля определения полной нуклеотидной последовательности энтеровирусов Коксаки А7 и Коксаки В6 при помощи пакета программного обеспечения LaserGene на основе сравнения известных полных нуклеотидных последовательностей геномов Коксаки А7 и Коксаки В6 были рассчитаны 60 олигонуклеотидных праймеров.

Исследование биологических проб от пациентов, поступивших в ГИКБ №1 г. Новосибирска с подозрением на серозный менингит и/или энтеровирусную инфекцию В период с 2006 по 2009 гг. был проведен анализ историй болезни пациентов с серозными менингитами, поступивших в ГИКБ №1 г. Новосибирска. За этот период поступило 293 человека (74 – в 2006 г., 62 – в 2007 г., и 59 – в 2008 г., 98 – в 2009 г.) с диагнозом серозный менингит. Наряду с архивными данными ГИКБ №1 за 1993 – 2005 гг., 2010-2011 гг. это позволило построить следующий график, который отражает динамику госпитализации пациентов с серозными менингитами в течение 19 лет.

(Рис.1).

121180 11111111174 90 80 60 40 37 40 Рис. 1. Количество больных с СМ, поступивших в ГИКБ№1 за период 1993 – 2011 гг.

Эти данные указывают на то, что подъем заболеваемости серозными менингитами в г. Новосибирске происходит каждые 5-6 лет.

На следующем рисунке (Рис. 2) представлена сезонная динамика заболеваемости серозными менингитами. Наибольшая заболеваемость пришлась на летне-осенние месяцы.

35 10 10 5 2006 2007 2008 20Рис. 2. Сезонность заболевания серозными менингитами Заболеваемость не зависела от пола, а наибольшее число заболевших было в возрасте до 30 лет – 233 человека (80%), то есть болеют в основном молодые люди.

Количество человек 19191919191919202020202020202020202020Количество пациентов март-май март-май март-май март-май июнь-август июнь-август июнь-август июнь-август сентябрь-ноябрь сентябрь-ноябрь сентябрь-ноябрь сентябрь-ноябрь декабрь-февраль декабрь-февраль декабрь-февраль декабрь-февраль Молекулярно-биологическое и эпидемиологическое исследование пациентов ГИКБ №1 в 2008-2009 гг.

Для исследования на наличие РНК энтеровирусов был взят материал от пациентов ГИКБ №1 в 2008-2009 гг. со следующими диагнозами: серозный менингит –165 человек (72,1 %), острая респираторная инфекция – 56 человек (24,5 %), инфекционная диарея – 4 человек (1,7 %), экзантема – 3 человека (1,3 %), герпангина – 1 человек (0,4 %).

Из 246 проб было 199 образцов СМЖ и 47 образцов фекалий. При этом от пациентов с серозным менингитом были собраны как фекалии, так и СМЖ.

Биологический материал от больных исследовался методом ПЦР со специфическими праймерами к 5'UTR и VP1 региону.

5'UTR является относительно консервативным участком генома энтеровирусов и поэтому используется для скрининговой диагностики. ПЦР со специфическими праймерами на VP1 регион позволяет генотипировать энтеровирусы в случае, когда при определении нуклеотидной последовательности 5'UTR не представляется возможным уточнить генотип.

Положительными образцами в данном исследовании считались те, которые были положительны в ПЦР со специфическими праймерами к 5'UTR, всего образцов (67 пациентов). Из них 26 образцов подтверждено в ПЦР по VP1 региону.

Для 42 – была определена нуклеотидная последовательность.

Из 199 проб СМЖ энтеровирусы выявлены в 56 образцах (28,1%), из 47 проб фекалий в 14 образцах (29,8%).

Результаты генотипирования выявленных энтеровирусов Определение нуклеотидных последовательностей по 5’UTR и VP1 региону исследованных нами энтеровирусов выявило их принадлежность к следующим генотипам: Cox A2 (10%), Cox A4 (5%), Cox A6 (3%), Cox A14 (3%), Cox A16 (7%), Cox B5 (7%), ECHO 6 (2%), ECHO 9 (2%), ECHO 2 (2%), ECHO 25 (2%), и наибольший процент был представлен генотипом ECHO 30 (57 %).

Филогенетический анализ нуклеотидных последовательностей фрагментов 5’UTR региона выявил принадлежность 24 изолятов к генотипу энтеровирусов ECHO30 (Рис.3). Наиболее близкие к ним изоляты этого генотипа ранее были выявлены в Австралии (Australia-2006(GU236299), Australia-2006(GU236300)), Франции (France-1997(AM237015), France-1997(AM237014), France-1997(AM237013), France-1991(AM237021), France-1992(AM237034)), США (USA-1995(EU870486)) и Нидерландах (Netherlands-2006(DQ534205)) в 1992-2006 гг.

Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR четырех изолятов выявил их принадлежность к генотипу CoxA2, наиболее близкий изолят был выявлен в Японии в 2003 году (Japan-2003(AB126199)).

Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR трех изолятов выявил их принадлежность к генотипу CoxA16, наиболее близкий изолят выделен в Китае в 2008 г. (China-2008(FJ198212)). Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR трех изолятов выявил их принадлежность к генотипу CoxВ5, наиболее близкий изолят был выявлен в Южной Корее в 2000 г. (South Korea-2000(AY875692)). Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR двух изолятов выявил их принадлежность к генотипу CoxA4, наиболее близкий изолят был выявлен в Японии в 2003 г. (Japan-2003(AB126200)).

Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR изолята L32 выявил его принадлежность к генотипу ECHO25. Наиболее близкий изолят был выявлен в Австралии в 1999 г. (Australia-1999(GU236268)).

Изолят F102 – генотип CoxA14, прототип выявлен в США в 2003 г. (strain G-(AY421769)). Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR изолята F83-2 выявил принадлежность ее к генотипу CoxA6, наиболее близкий изолят был выделен в Сингапуре в 2008 году (Singapore-2008(GU198756)).

L34 5UTR L96 5UTR L33 5UTR L61 5UTR L31 5UTR L28 5UTR L25 5UTR L26 5UTR L22 5UTR L20 5UTR L105 5UTR L108 5UTR L29 5UTR Echo30 Australia-06(GU236299) Echo30 Australia-06(GU236300) Echo30 USA-95(EU870486) Echo30 France-92(AM237034) Echo30 France-97(AM237014) 1 Echo30 France-97(AM237013) Echo30 France-97(AM237015) Echo30 Netherlands-06(DQ534205) Echo30 France-2000(AM237026) Echo25 Australia-99(GU236268) 1 L32 5UTR F83-2 5UTR 1 CoxA6 Singapore-08(GU198756) F67 5UTR 1 CoxA16 China-08(FJ198212) 85 CoxA2 Japan-03(AB126199) BL37 5UTR F84 5UTR 0,Рис. 3. Филогенетическое древо энтеровирусов ECHO 30, ECHO 25, Cox A6, Cox A16, Cox A2, построенное по нуклеотидной последовательности фрагмента генома 5’UTR (72-521 п.о.).

Анализ проведен методом «объединения ближайших соседей» с использованием 2-х параметрической модели Кимуры (с помощью программы MEGA5). Цифры около узлов отражают индекс поддержки ветвей. Линия отражает генетическую дистанцию.

- прототипные штаммы F, L, BL - идентификационные номера исследуемых образцов Филогенетический анализ нуклеотидных последовательностей фрагмента гена VP1 выявил принадлежность изолятов L105, L119 и L56 (2008 г.) к геному энтеровирусов ECHO 30. Наиболее близкие по последовательности изоляты этого генотипа ранее были выявлены в Корее в 2008 г. (South Korea-2008(FJ848358), South Kor 8361), FJ848349)), Нидерландах (Netherlandsrea-2008(FJ848 South Korea-2008(F 200 ) городе 08(GQ250164), 06(DQ534205)) и России, в Нижнем Новг в 2008 г. (Russia-200, Rus 646397), a-2008(GU6463 Филоге нализ а ssia-2008(GU6 Russia 396)). енетический ан изолята F83 о принадлежно у энтеровируса более близкие 3-2 выявил его ость к геному а Cox A6, наиб е изо по данн региону были выделен в Финлянди в 2007-2008 гг. (Finlandоляты ному б ны ии 200 ) и Исландии ( GU248459)).

08(GU248466)) (Iceland-2007(G Встреча демические се аемость генотипов энтеровирусов в эпид езоны 2008 и 2009 гг. в г. Но овосибирске На Рис. 4 видно, что в 2008 г. бол часть выявленных энтеровирусов 4 льшую э в сос 30 (76 %). На долю генотипа ходится 9 %, C, ставил ECHO 3 д а Cox B5 прих Cox A16 – 6 %, а на долю Cox A6, Cox A2 и Cox A4 – по 3 %. В 200 г., в отличи от 2008 г., н A и 09 ие, обр жащих ECHO 3 2 т разцов, содерж 30, обнаружено не было. В 2009 г. наибольший процент сре энтеровиру составил Cox A2 (33 %). Генотип Cox A4 состав 22%, а на еди усов л C вил а дол CHO 9, ECHO 2 и CoxA 16 п й генотип.

лю ECHO 6, EC пришлось по 11% на каждый Таким об среди больных в 2009 г. не выявлено ECH однако бразом, и в HO30, о уве являемость CoxA2, CoxA16 и появились новые генот CoxA4, еличилась выя o 6 ь типы:, EC CHO 2,6,9.

100% CoxB B5; 3% ECHO25; 3% E ECHO2; 11% CoxA A6; 3% 90% CoxA A2; 3% CoxB B5; 6% E ECHO9; 11% 80% CoxA16; 6% E ECHO6; 11% 70% 60% C CoxA4; 22% 50% 40% ECHO30; 72% 30% C CoxA2; 33% 20% 10% CoxA16; 11% 0% 20 200Рис 4. Распреде генотип энтеровир среди па с эн й с. еление пов русов ациентов нтеровирусной инф фекцией в 2008 г. и 2009 г.

Связь между серотипами энтеровирусов человека и клиническими синдромами, которые они вызывают У больных c острой респираторной инфекцией выявлены следующие генотипы: Cox A2, Cox A16, ECHO 25 и ECHO 30, причем, как и среди больных серозным менингитом, большая часть приходится на генотип ECHO30 (73%), а на долю генотипов Cox A2, Cox A16 и ECHO 25 приходилось по 9% (Рис. 5).

Среди больных с серозным менингитом более половины случаев (51,7%) были вызваны вирусом генотипа ECHO 30. Также обнаружены энтеровирусы CoxA2 и CoxB5 (по 10,3%), CoxA16 и CoxA4 (по 6,9%) и ECHO6, ECHO9, CoxA14 и ECHO(по 3,4%) (Рис. 6).

У больного с герпангиной обнаружен генотип ECHO 30. У больного с экзантемой выявлен генотип Cox A6, данный клинический случай будет подробно рассмотрен ниже.

CoxACoxACoxACoxA11,1% 9,1% 9,1% 7,4% ECHO CoxB9,1% ECHO 11,1% 51,9% CoxAECHO 7,4% ECHO72,7% 3,7% ECHOECHO3,7% 3,7% Рис. 6. Энтеровирусы, Рис. 5. Энтеровирусы, выделенные у больных с серозным выделенные у больных с ОРВИ менингитом Обсуждение результатов В работе были получены данные о циркуляции энтеровирусов, на территории г. Новосибирска, которые вызывают различные клинические синдромы. Основное количество биологических проб было получено из МБУЗ г. Новосибирска ГИКБ № 1, куда госпитализируется взрослое население города и области от 15 лет, поэтому проб от детей было очень мало.

По результатам исследования видно, что наибольший процент заболевших как среди мужчин, так и среди женщин приходится на возраст до 30 лет. После 30 лет эта цифра значительно снижается. Это может быть связано с тем, что среди энтеровирусов существует множество генотипов и при заражении ЭВИ вырабатываются антитела, специфичные к определенному генотипу. Кроме этого, выработанные антитела могут реагировать перекрестно, т.е. взаимодействовать с несколькими генотипами. Исходя из этих данных, мы предполагаем, что человек, перенесший разные энтеровирусные инфекции, к определенному возрасту имеет специфические антитела, которые будут нейтрализовать разные генотипы энтеровирусов.

При изучении заболеваемости в течение года выявлено, что для энтеровирусной инфекции характерна летне-осенняя сезонность. Эта закономерность коррелирует с данными, опубликованными в мировой литературе (Pallansch, 2007;

Ortner, 2009).

Среди общего количества генотипированных образцов энтеровирусов наибольший процент приходился на ECHO 30. Этот же генотип наиболее распространен среди больных серозным менингитом и среди больных острой респираторно-вирусной инфекцией. В 2008 г. на долю ECHO 30 приходилось 73 % среди генотипированных образцов, однако в 2009 г. этот генотип выделить не удалось. Это говорит о циркуляции ECHO 30 в г. Новосибирске только в 2008 г., что подтверждено также данными об обнаружении энтеровируса этого генотипа в сточных водах в 2008 г. Центром Гигиены и Эпидемиологии г. Новосибирска (Щербатов А.Ф., 2011). При этом в 2009 г. наибольший процент среди генотипированных образцов приходился на Cox A2 (33 %) и Cox A4 (22 %), которые не обнаружены в 2008 г. Такая смена генотипов может быть связана с тем, что значительная доля населения стала иммунной к ECHO30. При этом появление в 2009 г. новых генотипов вызвало подъем заболеваемости серозными менингитами энтеровирусной этиологии, что отражено на Рис. 1. Таким образом, подъем заболеваемости энтеровирусной инфекцией скорее всего обуславливается появлением в циркуляции среди населения новых генотипов.

При анализе филогенетических деревьев можно заметить, что для всех изолятов, для которых определена нуклеотидная последовательность фрагмента гена 5’UTR, прототипами являются энтеровирусы, выделенные в разных странах. Этот факт и процент гомологии исследуемых образцов с прототипами от 86 до 99% говорит как о широком распространении энтеровирусов, так и о циркуляции специфических для данной территории штаммов, выявленных на территории г. Новосибирска.

Филогенетический анализ нуклеотидной последовательности фрагмента генома, кодирующего VP1 регион, позволяет сделать вывод, что генотип изолята L1(ECHO 30), циркулировал среди населения г. Новосибирска. Для изолята L119 (ECHO 30) прототипом являются генотипы, выявленные в России. Высокий уровень гомологии изолятов L56 (ECHO 30) с прототипом из Нижнего Новгорода (Russia-20(GU646397)) и F83-2 (Cox A6) с прототипом из Финляндии (Iceland-2007(GU248459)) может свидетельствовать о завозе штаммов прототипов на территорию г. Новосибирска из перечисленных регионов.

Изучение случая энтеровирусной экзантемы полости рта и конечностей, вызванного изолятом вируса Coxsackie АВ следующей главе диссертации идет речь о заболевании, протекавшем с поражением кожи кистей, стоп, полости рта. В России «энтеровирусная экзантема полости рта и конечностей» отдельно в статистических формах не учитывается. К сожалению, таким больным далеко не всегда сразу выставляют правильный клинический диагноз, и поэтому их пробы не направляют на исследование на энтеровирусную инфекцию. В результате в России нет источника систематических данных о случаях и этиологии данной болезни.

Клинический случай Больная, Н., 28 лет, обратилась к врачу 10 ноября 2008 года с жалобами на лихорадку до 37,7°С, слабость, боли в горле, боль при глотании, сыпь на ладонях, ступнях. Заболела остро 08.11.2008 г., появились боли в горле, недомогание. На следующий день температура повысилась до 37,7°С, боли в горле усилились.

Самостоятельно не лечилась. На третьи сутки от начала заболевания заметила сыпь «в виде пузырьков» на ладонях и подошвах стоп, болезненную при пальпации, после чего обратилась к врачу.

Женщина являлась медицинским работником и накануне заболевания осуществляла уход за больными с серозными менингитами неуточненной этиологии.

Никто из членов ее семьи не заболел.

Status praesens communis: при первичном осмотре - состояние легкой степени тяжести, температура 37,6°С. Кожные покровы нормального цвета, влажные; на ладонях и подошвах стоп, а также на пальцах рук и ног - экзантема в виде везикул диаметром 2-3 мм с серозным содержимым, выступающих над уровнем кожи, окруженных венчиком гиперемии. Наблюдалась инъекция сосудов склер. Ротоглотка гиперемирована, на слизистой задней стенки глотки - везикулярная энантема.

Миндалины увеличены до I ст., налетов нет. Носовое дыхание свободно.

Подчелюстные лимфатические узлы не увеличены, безболезненные. Костномышечная система без особенностей и изменений. Дыхание везикулярное, хрипов нет. Тоны сердца ясные, ритмичные, шумов нет. Живот мягкий, безболезненный.

Печень, селезенка не увеличены, безболезненные. Физиологические отправления в норме.

Клинический материал (фекалии, полученные на 3 сутки от начала заболевания) исследовали методом ПЦР на наличие РНК ротавирусов, астровирусов, коронавирусов, норовирусов, энтеровирусов и ДНК аденовирусов (ФГУН ЦНИИЭ Роспотребнадзора, торговые марки «Амплисенс», Россия). В исследованных образцах была обнаружена только РНК энтеровируса. Полученный результат был подтвержден секвенированием. Для этого, с использованием вирусспецифических праймеров, описанных в (Nix, 2006), методом ОТ-ПЦР был получен фрагмент ДНКпоследовательности гена VP1 (357 п.о.). Филогенетический анализ нуклеотидной последовательности фрагмента гена VP1 выявил ее принадлежность к геному энтеровирусов Коксаки А6. Наиболее близкие по последовательности изоляты этого генотипа были выявлены в Японии в 2000 г. (P-557/CA6/Kanagawa/2000 (AB114101), P-497/CA6/Kanagawa/2000 (AB114095)), в Финляндии в 2009 г. (Fin/Tu88(FJ870508), Fin/Ta81125 (FJ870502)), в Индии в 2009 г. (HFMD TS040/09 (GU393306), HFMD VF07/09 (GU393305)) и в Великобритании в 2007 г. (CSF-1739/07 (FJ525951)).

Уровень гомологии последовательности фрагмента гена VP1 выявленного нами изолята с ними составил 98%.

Таким образом, выявленный энтеровирус Коксаки А6, который мы назвали AD/CA6/Novosibirsk/2009 (по аналогии с подобными Коксаки-вирусами), входит в общую кладу с энтеровирусами, выделенными ранее в Юго-Восточной Азии и в Европе (Рис. 7).

Fin/Tu88 Fin/Se87 Fin/Ta811 HFMD TS040/ HFMD VF07/ CSF-1739/ 1278/CA6/Hyogo/19 P-557/CA6/Kanagawa/2087 P-536/CA6/Kanagawa/20 P-516/CA6/Kanagawa/20 P-497/CA6/Kanagawa/20 AD/CA6/Novosibirsk/20 Gdula 105 104 P-548/CA5/Kanagawa/201 P-526/CA5/Kanagawa/200.Рис. 7. Филогенетическое древо энтеровирусов Коксаки А6 и AD/CA6/Novosibirsk/2009, построенное по нуклеотидной последовательности фрагмента гена VP1 (2612 - 2969 п.о.). Анализ проведен методом «объединения ближайших соседей» с использованием 2-х параметрической модели Кимуры (с помощью программы MEGA5). Цифры около узлов отражают индекс поддержки ветвей. Линия отражает генетическую дистанцию.

- изолят AD/CA6/Novosibirsk/2009, исследованный в нашей работе В выведенных аминокислотных последовательностях фрагмента гена VP1 (c 2612 п.о. по 2969 п.о.) энтеровируса Коксаки А6 AD/CA6/Novosibirsk/2009 каких-либо замен по отношению к вышеуказанным двум штаммам обнаружено не было.

Филогенетический анализ нуклеотидной последовательности фрагмента 5’UTR изолята вируса также выявил принадлежность ее к генотипу CoxA6, наиболее близкий изолят был выделен в Сингапуре в 2008 году (Singapore-2008 (GU198756)) (Рис. 3).

Таким образом, приведенный здесь клинический случай энтеровирусной экзантемы полости рта и конечностей – первый описанный случай этой болезни в России, причиной которого явился энтеровирус Коксаки А6. Это еще раз указывает на множественность этиологии данного заболевания (в добавление к ЭВ71, Коксаки А10, А16 и т.п.).

Близость по нуклеотидной последовательности данного изолята к изолятам из Японии, Индии, Сингапура, Финляндии и Великобритании может говорить как о его широкой распространенности, так и о значительной генетической стабильности, хотя окончательный вывод может быть сделан только путем молекулярноэпидемиологического мониторинга этого симптомокомплекса на территории Евразии.

Нуклеотидная последовательность части генома (фрагмент VP1 района) депонирована нами в GenBank (AD/CA6/Novosibirsk/2009 (HM559584)).

Расследование вспышки острой кишечной инфекции, энтеровирусной этиологии в сахалинской области в августе 2010 г.

С использованием праймеров к 5’UTR нами была уточнена этиология вспышки в Сахалинской области в августе 2010 г.

01 августа 2010 г. в г. Южно-Сахалинске началась вспышка заболеваемости острыми кишечными инфекционными заболеваниями (ОКИ). Всего за данный период зарегистрировано 1439 случаев острых кишечных инфекционных заболеваний. В возрастной структуре заболевших доля взрослых составила 30,3%, дети до 17 лет – 69,7%. Из клинических форм преимущественно преобладал острый гастроэнтерит – 63,9%, в остальных случаях – пищевая токсикоинфекция. В 49,2% регистрировалась легкая форма тяжести заболеваний острыми кишечными инфекциями, в 50,8% – среднетяжелая форма, случаев с тяжелой формой не зарегистрировано.

Изучение проб в лаборатории ФБУН ГНЦ ВБ «Вектор» показало, что в исследованных клинических образцах генетический материал (вирусные РНК или ДНК) адено-, норо-, астро-, ротавирусов, а также ДНК Yersinia enterocolitica, Yersinia pseudotuberculosis и Listeria monocytogenes отсутствует.

Из 102 проб в 91 образце фекалий, в 1 пробе воды насосной и 1 пробе 20% сметаны (91% проб) нами была обнаружена РНК энтеровирусов, из которых образец фекалий (56%) - от детей до 14 лет. После определения нуклеотидных последовательностей амплификационных фрагментов ДНК в положительных образцах были идентифицированы энтеровирусы: Коксаки А2 – 42 образца (45%), Коксаки А4 – 31 образец (34%), Энтеровирус 71– 6 образцов (6,5%), Коксаки В5 – образцов (6,5%), Коксаки В3 – 4 образца (4%) и Коксаки В1 – 4 образца (4%).

После проведения 3 последовательных пассажей на культуре клеток Vero были выделены и первично охарактеризованы штаммы Коксаки А2 (штамм Sah51), A(штамм Sah5) и Коксаки В5 (штамм Sah2).

Таким образом, нами было проведено расследование вспышки острой кишечной инфекции в Сахалинской области в августе 2010 г. По результатам лабораторных исследований в биологическом материале от больных в 79% обнаружены РНК энтеровирусов Коксаки A2, Коксаки А4. Связь с водным фактором подтвердили обнаруженные РНК энтеровирусов Коксаки A2 в пробе воды питьевой, отобранной на насосной №28 распределительной сети централизованного водоснабжения г. Южно-Сахалинска, связь с молочной продукцией – обнаруженные РНК энтеровирусов Коксаки A2 в пробе 20% сметаны.

Филогенетический анализ показал, что наиболее близкие по нуклеотидным последовательностям штаммы этих генотипов энтеровирусов были выявлены в Японии в 2003 г. (P-2242/CA2/Kanagawa/2003 (AB126199), P2181/CA2/Kanagawa/2003 (AB126197), P-2329/CA2/Kanagawa/2003 (AB162738)) – для Коксаки А2 и (P-2232/CA4/Kanagawa/2003 (AB126200)) – для Коксаки А4 (Рис.8).

На фоне выявления основных генотипов Коксаки А2 и А4, в 21 % случаев нами обнаружены другие энтеровирусы (Коксаки В5, Коксаки В3, Коксаки В1, Энтеровирус 71) у людей с признаками энтеровирусной инфекции.

Филогенетический анализ показал, что наиболее близкие по нуклеотидным последовательностям штаммы этих генотипов энтеровирусов были выявлены в Японии в 2003 г. для Коксаки В1 (P-2346/CB1/Kanagawa/2003 (AB162750)), в Японии в 2010 г. для Энтеровирусов 71 (1095-LPS1 (AB550333)), в Китае в 2006 г. для Коксаки В3 (SSM-CVB3 (GU109481)), в Корее в 2000 г. для Коксаки В(2000/CSF/KOR (AY875692)) (Рис.9).

Определенные нуклеотидные последовательности (фрагменты 5’UTR) депонированы нами в GenBank (JN603367 – JN603368, JQ041369 – JQ041371, JQ065869 – JQ065870).

SRN17 12- SRN23 12- SRN15 12- SRN9 12- SRN7 12- SRN5 12- SR62-002 10- SR56-005 10- SR55-003 10- SF74-0 SF7-0 SF1-0 SRN27 12- SRN28 12- SRN30 12- SF73-0 SRN31 12- CoxA2 Japan-03(AB126199) CoxA2 Japan-03(AB126197) CoxA2 Japan-03(AB162738) SRN21 12- SF51-001 10- SF52-003 10- SF72-0 SRN16 12- SR75-009 10- SR71-001 10- SRN29 12- SR54-001 10- SR57-007 10- SR66-0 SR76-011 10- SR81-004 10- SRN12 12- SRN22 12- SRN25 12- SR58-009 10- SR80-015 10- SRN8 12- SRN10 12- Polio3 China-10(FJ859192) Aphthovirus India-09(EF120403) 0,Рис. 8. Филогенетическое древо энтеровирусов Коксаки А2, построенное по последовательности фрагмента гена 5’UTR (c 73 п.о. по 520 п.о.). Анализ проведен методом «объединения ближайших соседей» с использованием 2-х параметрической модели Кимуры (с помощью программы MEGA5). Цифры около узлов отражают индекс поддержки ветвей. Линия отражает генетическую дистанцию.

*- ввиду большого количества определенных нуклеотидных последовательностей построено два филогенетических древа; наиболее гомологичные последовательности не включены.

- прототипные штаммы; – аутгруппа (группа сравнения); SRN, SR, SF – идентификационные номера исследуемых образцов.

SRN2 12- SRN6 12- SRN26 12- SRN11 12- SRN24 12- SR77-013 10- SRN32 12- SR82-004 10- SRN19 12- SR74-007 10- SR69-0 SF70-0 CoxA4 Japan-03(AB126200) SRN18 12- SR60-013 10- SRN14 12- CoxB1 Japan-03(AB162750) SF6-0 SF8-0 CoxB3 China-06(GU109481) SF2-0 SF80-0 SF53-005 10- CoxB5 Korea-00(AY875692) SF4-0 SF13-0 EV71 Japan-10(AB550333) Aphthovirus India-09(EF120403) Polio3 China-10(FJ859192) МБ-7/4647(EU251188) 0,Рис. 9. Филогенетическое древо энтеровирусов Коксаки А4, В1, В3, В5, EV71, построенное по последовательности фрагмента гена 5’UTR (c 73 п.о. по 520 п.о.).

Анализ проведен методом «объединения ближайших соседей» с использованием 2-х параметрической модели Кимуры (с помощью программы MEGA5). Цифры около узлов отражают индекс поддержки ветвей. Линия отражает генетическую дистанцию.

- прототипные штаммы; – аутгруппа (группа сравнения); SRN, SR, SF – идентификационные номера исследуемых образцов Исследование потенциально онколитических энтеровирусов: штаммов LEV8 и LEVП.М. Чумаковым были предоставлены для исследования в НГУ и в ФБУН ГНЦ ВБ «Вектор» несколько штаммов энтеровирусов для исследования их потенциальных онколитических свойств и определения полных нуклеотидных последовательностей их геномов.

Ранее в 1960 – 1970-х гг. эти штаммы были исследованы М. К. Ворошиловой с коллегами в Институте полиомиелита и вирусных энцефалитов им. М.П.Чумакова РАМН, г. Москва. Была установлена возможность вирусного лизиса опухолевых клеток под действием непатогенных энтеровирусов и проведены исследования возможности терапии онкологических заболеваний при помощи живых энтеровирусных вакцин (live enterovirus vaccine (LEV)) (Ворошилова, 1979).

Государственный Комитет по Делам Открытий и Изобретений СССР выдал диплом, удостоверяющей это открытие.

В данной части работы нами определены полные нуклеотидные последовательности геномов, проведен молекулярно-генетический анализ, исследованы инфекционные свойства полученных штаммов вирусов LEV8 и LEV15 с целью решения вопроса о возможности использовать данные штаммы при создании онколитических вирусных препаратов.

Исследование цитолитических свойств энтеровирусных штаммов на панели опухолевых и нормальных клеток человека Онколитическая активность штаммов LEV8 и LEV15 определялась in vitro на культурах опухолевых клеток человека различных типов: А431 (эпидермоидная карцинома человека), А549 (эпителиальная аденокарцинома легких человека), SW4(аденокарцинома толстой кишки человека), C-33A (HPV-негативная карцинома шейки матки), DU-145 (карцинома предстательной железы), RD (клетки рабдомиосаркомы человека), Mel-8 (клетки меланомы человека) и на нормальных диплоидных культурах клеток человека: ФЭЧ-15 (диплоидная культура кожно-мышечной ткани эмбриона человека) и HEK293 (клетки почки эмбриона человека). Литическую активность исследуемых вирусных штаммов выражали через 50%-ную тканевую цитопатогенную дозу (ТЦПД50/мл). Результаты приведены в таблице 2.

Как выяснилось, вирус штамма LEV8 (Коксаки А7) инфицирует нормальные диплоидные клетки человека, однако существенно эффективнее он лизирует опухолевые культуры C-33A и RD. Вирус штамма LEV15 (Коксаки В6) практически не инфицирует диплоидную культуру кожно-мышечной ткани эмбриона человека ФЭЧ-15 (инфекционный титр <103 ТЦПД50/мл), но инфицирует и эффективно лизирует опухолевые культуры С-33A и DU-145.

Таблица 2.

Инфекционные титры штаммов LEV8 и LEV15 на различных нормальных и опухолевых культурах клеток человека Титр на культуре клеток ТЦПД50/мл Культура клеток Штамм LEV8 Штамм LEVФЭЧ-15 107 <1HEK293 107 1A431 <103 41SW480 <103 51A549 <103 21Mel-8 <103 <1C-33A 2109 51DU-145 104 51RD 2109 <1Молекулярно-биологическое исследование штаммов LEV8 и LEVДля установления генотипов штаммов LEV8 и LEV15 образцы вирусного материала после пасcирования на культуре клеток HEK293 (клетки почки эмбриона человека) исследованы методом ОТ-ПЦР с использованием набора олигонуклеотидных праймеров на 5’UTR для диагностики и генотипирования энтеровирусов человека видов A, B, C, D (как описано в главе Материалы и методы).

Полученные фрагменты ДНК секвенировали. По определенной нуклеотидной последовательности 5’UTR генома, была установлена принадлежность штамма LEVк энтеровирусам Коксаки А7, а штамма LEV15 к энтеровирусам Коксаки В6.

После установления генотипов штаммов LEV8 и LEV15 были рассчитаны праймеры на весь геном энтеровируса Коксаки А7 и энтеровируса Коксаки В6. С их использованием были определены полные нуклеотидные последовательности геномов штаммов LEV8 и LEV15.

Филогенетический анализ показал, что наиболее близкие по нуклеотидным последовательностям штаммы этих генотипов энтеровирусов были зарегистрированы в США в 2003 г. (Human coxsackievirus A7 strain Parker, GenBank AY421765) и в Канаде в 1999 г. (Coxsackievirus B6 strain Schmitt, GenBank AF105342).

После повторной наработки на культуре клеток HEK293 проведено ресеквенирование полного генома штамма Coxsackie A7. Последовательность депонирована в международной базе GenBank под номером JQ041367. После повторной наработки вирусов на культуре клеток HEK293 проведено ресеквенирование полного генома штамма Coxsackie B6. Последовательность депонирована в международной базе GenBank под номером JQ041368.

Нуклеотидная последовательность штамма LEV8 вируса Коксаки Асоставила 7404 н. При сравнении с прототипным штаммом Human coxsackievirus Astrain Parker (США, 2004г.) процент гомологии составил 99% для нуклеотидной (нуклеотидных отличий) и 99% для аминокислотной последовательностей (аминокислотных отличий).

Нуклеотидная последовательность штамма LEV15 вируса Коксаки Всоставила 7398 н. При сравнении с прототипным штаммом Coxsackievirus B6 strain Schmitt (Канада, 1999г.) процент гомологии составил 99% для нуклеотидной (нуклеотидных отличий) и 99% для аминокислотной последовательностей (аминокислотных отличий).

Штамм Коксаки A7 (LEV8) по сравнению с наиболее близким прототипом Human coxsackievirus A7 strain Parker (США, 2003 г.) имеет 8 аминокислотных замен.

Так, замена N524K находится в белке VP3 в rhv_like регионе. Замены T913A в белке 2А; A1122V, E1215X, V1412L в белке 2С; K1442R в белке 3А, D1609X в белке 3С и E2159K в белке 3D. В тоже время, в сравнении с другими генотипами энтеровирусов процент гомологии как по нуклеотидной, так и по аминокислотным последовательностям ниже 91%.

Штамм Коксаки В6 (LEV15), по сравнению с наиболее близким прототипом Coxsackievirus B6 strain Schmitt (Канада, 1999г.), имеет аминокислотные отличия в белке VP1: K654T, V699I и A727T, находящиеся в rhv_like регионе. Кроме того в VP1 присутствует отличие V594E, а в белке 3D имеется отличие V2159I. В тоже время, в сравнении с другими генотипами энтеровирусов процент гомологии как по нуклеотидной, так и по аминокислотным последовательностям ниже 91%.

Таким образом, нами впервые проведено молекулярно-биологическое исследование вирусных штаммов LEV8 – Коксаки А7 (JQ041367) и LEV15 – Коксаки В6 (JQ041368). Показано, что они могут эффективно лизировать некоторые культуры опухолевых клеток человека, к тому же штамм LEV15 не инфицирует диплоидную культуру. Учитывая свойства обоих штаммов, их потенциально можно использовать как онколитические препараты или как основу для таковых.

ВЫВОДЫ 1. В образцах от пациентов с серозным менингитом, ОРВИ, герпангиной и инфекционной экзантемой, собранных в 2008-2009 гг. в г. Новосибирске и Новосибирской области, выявлены энтеровирусы следующих генотипов:

наибольший процент был представлен изолятами ECHO 30 (57 %), а также Cox A2 (10%), Cox A4 (5%), Cox A6 (3%), Cox A14 (3%), Cox A16 (7%), Cox B5 (7%), ECHO 6 (2%), ECHO 9 (2%), ECHO 2 (2%), ECHO 25 (2%).

2. Филогенетический анализ 5’UTR и VP1 региона генов энтеровирусов, выделенных в Новосибирской области, показал, что близкие изоляты ранее были выявлены в Европе, России, Америке, Азии и Австралии в 1992-2009 гг.

3. В образцах от пациентов с острой кишечной инфекцией, а также в пробах воды и молочных продуктов, собранных во время вспышки в августе 2010 г. в Сахалинской области, выявлены энтеровирусы следующих генотипов:

наибольший процент был представлен генотипами Cox A2 (45%) и Cox A(34%), кроме того выявлены EV 71 (6,5%), Cox В5 (6,5%), Cox В3 (4%) и Cox В(4%).

4. Филогенетический анализ 5’UTR геномов энтеровирусов, выделенных в Сахалинской области показал, что наиболее близкие им изоляты были выявлены в странах Восточной Азии: Японии (P-2346/CB1/Kanagawa/2003 (AB162750), 1095-LPS1 (AB550333)), Китае (SSM-CVB3 (GU109481)), Корее (2000/CSF/KOR (AY875692)) в 2000-2010 гг.

5. Установлено, что в клиническом случае энтеровирусной экзантемы полости рта и конечностей в г. Новосибирске в 2008 году возбудителем являлся изолят вируса Coxsackie A6. Филогенетический анализ 5’UTR и VP1 региона генома вируса Coxsackie A6, показал, что близкие изоляты ранее были выявлены в Европе и Юго-Восточной Азии в 2000-2009 гг.

6. Определены и проанализированы полные нуклеотидные последовательности потенциально онколитических штаммов LEV8 (Coxsackie А7 (JQ041367)) и LEV15 (Coxsackie В6 (JQ041368)). Филогенетический анализ показал, что наиболее близкие по нуклеотидным последовательностям штаммы этих генотипов энтеровирусов были определены в США в 2003 г. (Human coxsackievirus A7 strain Parker (AY421765)) и в Канаде в 1999 г. (Coxsackievirus B6 strain Schmitt (AF105342)).

Список работ, опубликованных по теме диссертации 1. Демина А.В., Маркович Н.А., Нетесов С.В. Энтеровирусы. Часть 1: история открытия, таксономия, строение генома, эпидемиология.// Бюллетень СО РАМН. 2008. №1 (129). С.92-100.

2. Демина А.В., Нетесов С.В. Энтеровирусы. Часть 2. Энтеровирусные инфекции:

многообразие клинических проявлений // Бюллетень СО РАМН. 2009. №6 (140).

С.116-125.

3. Демина А.В., Терновой В.А., Шульгина Н.И., Нетесов С.В. Энтеровирусы. Часть 3. Лабораторная диагностика, лечение, иммунопрофилактика и профилактические мероприятия в очаге // Бюллетень СО РАМН. 2011. №3 (31). С.115-122.

4. Демина А.В., Терновой В.А., Нордер Х., Нетесов С.В. Случай энтеровирусной экзантемы полости рта и конечностей, вызванный вирусом Coxsackie A6 // Журнал «Эпидемиология и инфекционные болезни». 2011. №3. С.23-26.

5. Демина А.В., Терновой В.А., Дарижапов Б.Б., Якубич Т.В., Семенцова А.О., Демина О.К., Протопопова Е.В., Локтев В.Б., Агафонов А.П., Нетесов С.В.

Вспышка острой кишечной инфекции энтеровирусной этиологии в Сахалинской области в августе 2010 г. // Вестник РАМН. 2012. №2. С.64-68.

Доклады и тезисы конференций 1. Кузнецова В.Г., Мечетина А.А., Демина А.В., Денисова А.А., Караваева Ю.Ю.

Клинико-эпидемиологическая характеристика энтеровирусного менингита по данным вспышки 2004 года. // Сборник материалов XV Научно-практической конференции врачей. Новосибирск. 26-27 апреля 2005г. С.415-416.

2. Demina A.V., Mechetina A.A., Karavaeva U.U., Burmistrova T.G. Clinical and epidemiological characteristic of enterovirus infection from 1993 until 2007 in Novosibirsk, Russia. // XI International Symposium on Respiratory Viral Infections.

Bangkok, Thailand. February 19 – 22, 2009. http://www.themacraegroup.com.

3. Демина А.В., Мечетина А.А., Караваева Ю.Ю., Нагорная И.Н. Особенности течения энтеровирусных менингитов в Новосибирской области. // I Всероссийский конгресс по инфекционным болезням. Москва. 30 марта - апреля 2009 г. С.56-57.

4. Demina A.V., Ternovoi V.A. Spread and outbreaks of enterovirus types in Novosibirsk, Russia. // 20th European Congress of Clinical Microbiology and Infectious Diseases. Vienna, Austria. April 10-13, 2010. P.1858.

5. Демина А.В., Терновой В.А., Нордер Х., Нетесов С.В. Случай энтеровирусной экзантемы полости рта и конечностей, вызванный вирусом Coxsackie A6. // VII Всероссийская научно-практическая конференция с международным участием «Молекулярная диагностика-2010». Москва. 24-26 ноября 2010 г.

www.md2010.org.

6. Demina A.V., Ternovoi V.A., Norder H., Netesov S.V. Hand, Foot and Mouth Disease, caused by Coxsackie A6 virus // 21th European Congress of Clinical Microbiology and Infectious Diseases. Milan, Italy. May 7-10, 2011. P.2114.

7. Демина А.В., Терновой В.А., Нордер Х., Нетесов С.В. Молекулярная диагностика случая энтеровирусной экзантемы полости рта и конечностей // 2-ая Международная конференция «Астана Биотех 2011». Астана, Казахстан. 10-11 октября 2011 г. C.32.

8. Демина А.В., Терновой В.А., Дарижапов Б.Б., Якубич Т.В., Семенцова А.О., Демина О.К., Протопопова Е.В., Локтев В.Б., Агафонов А.П., Нетесов С.В.

Молекулярно-эпидемиологическая характеристика вспышки острой кишечной инфекции в Сахалинской области // IV Всероссийский конгресс по инфекционным болезням. Москва. 26-28 марта - 2012 г. С.56-57.

9. A. Demina, V. Ternovoi, B. Darizhapov, T. Yakubich, A. Sementsova, O. Demina, E.

Protopopova, V. Loktev, A. Agafonov, S. Netesov. Outbreak of acute enterovirus intestinal infection in Sakhalin region in August 2010 // 22th European Congress of Clinical Microbiology and Infectious Diseases. London, United Kingdom. March, 31- April, 3, 2012. P.917.

Благодарности Автор благодарит сотрудников лаборатории молекулярной эпидемиологии ООИ ФБУН ГНЦ ВБ «Вектор»: зав. лабораторией к.б.н. В.А. Тернового и зав.

сектором к.б.н. Е.В. Чаусова за обучение методам молекулярной диагностики, участие в проведении экспериментов, а также за терпение, понимание и всестороннюю поддержку. Также признательна коллегам из ФБУН ГНЦ ВБ «Вектор» д.б.н. Локтеву В.Б., к.ф.-м. н. Швалову А.Н., к.б.н. Бондаренко Т.Ю., к.б.н. Ивановой А.В., к.б.н.

Святченко В.А. и к.б.н. Протопоповой Е.В. за плодотворное сотрудничество и ценные предложения; к.б.н. О.В. Носаревой и А.Е. Нестерову за помощь и поддержку в подготовке диссертации.

Автор выражает благодарность коллегам из вирусологической лаборатории Swedish Institute for Infection Disease Control, г. Стокгольм, Швеция – PhD, Ass Prof.

Helne Norder, Prof. Lars Magnius за помощь в проведении экспериментов и совместный анализ полученных данных.

Также благодарит коллег из Городской Инфекционной Клинической Больницы №1 г. Новосибирска, особенно – коллектив 7 отделения под руководством Бурмистровой Татьяны Германовны, коллектив 4 отделения под руководством Солоповой Татьяны Борисовны, врача-инфекциониста Мечетину Анну Антоновну за помощь в сборе коллекции биологических проб и обработке результатов.

Особую благодарность автор выражает своему научному руководителю д.б.н., член-корр. РАН, профессору Сергею Викторовичу Нетесову за помощь в выборе темы и направления исследований и всестороннюю поддержку, а также профессору П.М Чумакову за особое внимание к последней части работы и ее поддержку.

Настоящая работа выполнена за счет финансирования по грантам НШ65387.2010.4 и НШ-2996.2012.4 по государственной поддержке ведущих научных школ Российской Федерации, по гранту Фонда МФТИ №00012/00049 «Создание региональной референс-лаборатории для ПЦР-диагностики вирусных гепатитов», по Госконтракту № 02.740.11.0767 «Выявление вирусных возбудителей заболеваний, актуальных для здравоохранения Западной Сибири (гепатиты, гастроэнтериты, серозный менингит), изучение их генетического разнообразия в целях разработки и совершенствования диагностикумов» и по Договору НГУ с Министерством образования и науки № 11.G34.31.0034 «Новые подходы к разработке лекарств:

поиск, отбор и конструирование непатогенных для человека штаммов вирусов, перспективных для использования в качестве онколитических препаратов».






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.