WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

АКОПЯН ЖАННА АЛЕКСЕЕВНА

Функциональная активность эндотелиальных, мезенхимальных и циркулирующих прогениторных клеток 

при повышенной концентрации глюкозы in vitro и

гипергликемии у больных сахарным диабетом

03.01.04 - Биохимия

03.03.04 Клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата медицинских наук

Москва – 2012

Работа выполнена на кафедре биохимии и молекулярной медицины Факультета фундаментальной медицины ФГБОУ ВПО

«Московский государственный университет имени М.В.Ломоносова»

Научные руководители:

доктор медицинских наук,

профессор                                                        Парфенова Елена Викторовна

кандидат биологических наук,

доцент                                                        Калинина Наталья Игоревна

Официальные оппоненты:

Терентьев Александр Александрович

доктор медицинских наук, профессор, член-корр.РАМН,

ГБОУ ВПО Российский национальный исследовательский медицинский университет им. Н.И.Пирогова Министерства здравоохранения и социального развития России,

Заведующий кафедрой биохимии

Тарарак Эдуард Михайлович

доктор медицинских наук, профессор,

ФГУ «Российский кардиологический научно-производственный комплекс» Министерства здравоохранения и социального развития России,

Руководитель отдела клеточной биологии Института экспериментальной кардиологии

Ведущая организация:

ФГБУ «Эндокринологический научный центр» Министерства здравоохранения и социального развития РФ.

Защита диссертации состоится «18» мая 2012 года в 14.00 на заседании диссертационного совета Д 212.203.13 при Российском университете дружбы народов по адресу: 117198, г. Москва, ул. Миклухо-Маклая, д. 8, Медицинский факультет.

С диссертацией можно ознакомиться в библиотеке Российского университета дружбы народов по адресу: 117198, г. Москва, ул. Миклухо-Маклая, д. 6.

Автореферат разослан «___» апреля 2012 года.

Ученый секретарь Диссертационного Совета

доктор биологических наук, профессор                                 Е.В. Лукашева

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. Сахарный диабет (СД) является одной из актуальнейших проблем здравоохранения. Самыми опасными последствиями СД являются его системные сосудистые осложнения - нефропатия, атеросклероз кровеносных сосудов сердца, головного мозга и нижних конечностей (Шестакова М.В., Дедов И.И. 2006, 2009, 2011). Именно клетки сосудистой стенки служат основной мишенью для повреждения при СД. Основным повреждающим фактором  при СД является гипергликемия, которая посредством активации сорбитолового пути, протеинкиназы С и гликирования белков приводит к развитию окислительного стресса, уменьшению образования оксида азота NO  и увеличению синтеза белков внеклеточного матрикса клетками сосудистой стенки, что, с одной стороны, способствует ускоренному развитию атеросклероза и прогрессированию макроангиопатий, а с другой — вызывает повреждение микрососудистого русла. Нарушение процессов неоваскуляризации в сетчатке глаза проявляется избыточным ангиогенезом с образованием неполноценных высокопроницаемых сосудов, что приводит к диабетической ретинопатии (Шестакова М.В., Дедов И.И. 2011). В сердце и мышцах нижних конечностей нарушения неоваскуляризации, напротив, проявляются недостаточным адаптивным ангио-артериогенезом, что способствует развитию тяжелой  ишемии, незаживающих трофических язв и  отягощено последующими ампутациями (Удовиченко О. В., Грекова Н. М., 2010).

Неоваскуляризация ишемизированных тканей опосредована участием нескольких типов клеток сосудистой стенки, а именно эндотелиальных и прогениторных, включая резидентные мезенхимальные стволовые клетки (МСК), локализующиеся в стенке сосуда  (Potente M, Gerhardt H, Carmeliet P, 2011). Репарация сосудистой стенки и неоваскуляризация также опосредованы циркулирующими предшественниками эндотелиальных клеток (ЦПЭК), мобилизующимися из костного мозга в ответ на ишемию и повреждение сосудов  (Chavakis E, Dimmeler S.,2011; Dimmeler S.,2010)

Процесс ангиогенеза начинается с активации эндотелиальных клеток (ЭК) при возникновении локальной ишемии тканей за счет того, что в условиях гипоксии в клетках тканей повышается продукция ангиогенных факторов, прежде всего фактора роста эндотелия сосудов (VEGF), рецепторы к которому селективно экспрессированы на ЭК. Взаимодействие VEGF с рецепторами 1 и 2 типов на поверхности ЭК запускает внутриклеточный сигнальный каскад, ведущий к активации пролиферации и миграции этих клеток, что в конечном итоге приводит к формированию нового сосудистого отростка. Для дальнейшего роста новых кровеносных сосудов необходимо участие резидентных МСК, которые в значительной степени представлены перицитами. Они продуцируют ангиогенные факторы роста, включая VEGF, bFGF, HGF и TGF- и отвечают за стабилизацию новых сосудов и формирование зрелой сосудистой сети (Potente M, Gerhardt H, Carmeliet P, 2011). Помимо этого в процессах неоваскуляризации ишемизированных тканей участвуют и  циркулирующие предшественники эндотелиальных клеток, которые мобилизуются из костного мозга в ответ на ишемию тканей и повреждение эндотелия сосудов, мигрируют в участок повреждения, где замещают поврежденные ЭК и участвуют в формировании новых сосудов (Dimmeler S.,2010).  При нарушениях мобилизации  предшественников эндотелиальных клеток из костного мозга их количество в крови и их участие в процессах репарации и неоваскуляризации может нарушаться.

Для понимания молекулярных механизмов нарушенной неоваскуляризации при сахарном диабете необходимо исследование влияния гипергликемии на все типы клеток, участвующие в формировании новой сосудистой сети.

       Цель исследования: изучить влияние высокого уровня глюкозы на функциональные свойства основных типов клеток, участвующих в процессах роста и восстановления кровеносных сосудов, и исследовать влияние нарушения углеводного обмена на количество циркулирующих прогениторных клеток у больных ишемической болезнью сердца.

       Задачи исследования:

  1. Проанализировать влияние высокой концентрации глюкозы на уровень экспрессии рецепторов VEGF-A 1 и 2 типов на эндотелиальных клетках, направленную миграцию и  формирование этими клетками капилляроподобных структур in vitro.
  2. Исследовать влияние культивирования мезенхимальных стволовых клеток при высокой концентрации глюкозы (25 мМ) на способность  продуктов секреции этих клеток, стимулировать капиллярогенез in vitro.
  3. Оценить влияние культивирования мезенхимальных стволовых клеток при высокой концентрации глюкозы (25 мМ) на уровень экспрессии генов, кодирующих факторы, регулирующие ангиогенез.
  4. Исследовать влияние сопутствующего сахарного диабета 2 типа на число циркулирующих прогениторных клеток в периферической крови больных ИБС. 
  5. Оценить связь между показателями углеводного обмена и  количеством циркулирующих прогениторных клеток у больных ИБС, сочетающейся с  сахарным диабетом и без него.

       Научная новизна. Впервые установлено, что культивирование эндотелиальных клеток при высокой концентрации глюкозы (25мМ) подавляет их ангиогенные свойства - способность к миграции на ангиогенные факторы и к формированию капилляроподобных структур, что может быть обусловлено подавлением уровня экспрессии рецепторов к VEGF на этих клетках.  Впервые показано, что культивирование мезенхимальных стволовых клеток при высокой концентрации глюкозы (25мМ) изменяет уровень экспрессии генов, регулирующих ангиогенез, и подавляет способность этих клеток стимулировать ангиогенез за счет секреторной активности. Впервые обнаружено, что количество циркулирующих прогениторных клеток (ЦПК) в периферической крови больных ИБС, сочетающейся с СД 2 типа, тесно соотносится с уровнем гипергликемии и состоянием компенсации нарушений углеводного обмена: количество ЦПК значительно снижено при выраженной гипергликемии и декомпенсации диабета.

       Практическая значимость. Результаты исследования расширяют представления о влиянии гипергликемии на клетки сосудистой стенки и механизмах нарушения роста и репарации кровеносных сосудов у больных сахарным диабетом. Представленные результаты могут служить основой для дальнейшей разработки методов восстановления кровоснабжения ишемизированных тканей с использованием генной и клеточной терапии  у больных ишемической болезнью сердца, отягощенной сахарным диабетом, а также для поиска новых маркеров неблагоприятного прогноза ИБС при ее сочетании с сахарным диабетом. Согласно полученным результатам таким новым прогностическим показателем может стать количество ЦПК в периферической крови больных.

       Положения, выносимые на защиту:

        1. Высокая концентрация глюкозы подавляет ангиогенные свойства ЭК:  направленную миграцию на факторы ангиогенеза и способность формировать капилляроподобные структуры.  Одним из механизмов этого подавления может быть снижение экспрессии рецепторов к  VEGF на ЭК.
        2. Культивирование МСК в среде с высокой концентрацией глюкозы снижает способность этих клеток стимулировать ангиогенез in vitro за счет секреторной активности.
        3. У больных ИБС и сопутствующим СД 2 типа количество прогениторных клеток, несущих на поверхности антиген CD34, в периферической крови обратно коррелирует с уровнем глюкозы, инсулина.
        4. При декомпенсированном сахарном диабете 2 типа количество циркулирующих прогениторных клеток  в периферической крови снижено.

       Внедрение результатов исследования. Результаты исследования используются в курсе лекций по клинической биохимии, эндокринологии и кардиологии на Факультете фундаментальной медицины МГУ имени М.В.Ломоносова.

       Апробация работы.        Основные положения диссертационной работы доложены и обсуждены на совместном семинаре сотрудников кафедры биохимии и молекулярной медицины, лаборатории генных и клеточных технологий и лаборатории постгеномных технологий Факультета фундаментальной медицины МГУ имени М.В.Ломоносова; лабораторий молекулярной эндокринологии и ангиогенеза Института экспериментальной кардиологии РКНПК МЗСР РФ (31 января 2012 г.).

       Материалы диссертации доложены на Всероссийском симпозиуме  «Культивируемые клетки как основа клеточных технологий» (Санкт-Петербург, 2009г.); 3-ей Всероссийской молодежной школе-конференции «Стволовые клетки и регенеративная медицина» (Москва, 2010г.); 9-ом Международном конгрессе по болезням коронарных сосудов (Венеция, Италия, 2011г.),  Научной сессии «Сахарный диабет: инновационные технологии диагностики, лечения и профилактики» Общего собрания РАМН (Москва, 2011г.) и 5-ой Всероссийской школе-конференции по физиологии кровообращения (Москва, 2012г.).

Работа выполнялась в рамках Государственных контрактов № 16.512.12.2005 от «16» июня 2011 г.  и № 16.512.11.2262 от «14» сентября 2011 г. в рамках ФЦП «Исследования и разработки по приоритетным направлениям развития научно-технического комплекса России на 2007-2013 годы».

       Публикации. По теме диссертации опубликовано 9 научных работ, из них 5 статей в центральных рецензируемых журналах и 2 главы в сборнике статей.

       Объем и структура работы. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, клинической характеристики пациентов и методов их исследования, результатов исследования, обсуждения,  выводов, практических рекомендаций и указателя литературы, содержащего 29 отечественных и 273 зарубежных источников. Работа изложена на 166 страницах машинописного текста, иллюстрирована 5 таблицами и 17 рисунками.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

       Культуры клеток. Исследование проводили на культивируемых ЭК вены пуповины человека и МСК жировой ткани человека. ЭК 0-2 пассажей были любезно предоставлены О.Н. Антоновой (ИЭК РКНПК Минздравсоцразвития). ЭК культивировали на пластике, покрытом  0,2% раствором желатина, в среде  DMEM с 10% FBS (HyClone), 200мкг/мл ECGF, 5ЕД/мл гепарина, 1мМ пирувата натрия (GIBCO BRL), 100 Ед/мл пенициллина и 100 Ед/мл стрептомицина (GIBCO BRL), 20мМ HEPES (Helicon). Клетки выращивали в течение 10-12 дней в условиях 5мМ или 25мМ концентрации глюкозы. Среду роста меняли каждые 3 дня. МСК были выделены из ЖТ взрослых доноров (n=15), полученной в ходе плановых хирургических вмешательств, с помощью обработки растворами коллагеназы I типа (200 ед/мл) (Wornington) и диспазы (40 ед/мл) (Sigma). Полученные МСК выращивали в среде роста для недифференцированных мезенхимальных клеток (HyClone, Logan, UT, USA), содержащей 10% ростовой добавки (HyClone), 100 ед/мл пенициллина и 100 ед/мл стрептомицина. После первого пассирования клетки выращивали в течение 10-12 дней в условиях 5мМ или 25мМ концентрации глюкозы (высокую концентрацию глюкозы создавали, добавляя в среду роста D-глюкозу (Sigma Aldrich)). Среду роста меняли каждые 3 дня.

Все исследования, связанные с образцами ткани, выполнялись на основании разрешения Этического комитета ФГУ РКНПК МЗСР РФ.

       Миграция ЭК в камере Бойдена. Изучение миграции клеток проводили с использованием микрокамеры Бойдена, используя в качестве матрикса коллаген I типа, а в качестве аттрактантов 10% FBS или 5 нг/мл рекомбинантного VEGF-A165 человека. Оценивали миграцию  1х105 ЭК через 4 часа инкубации с помощью окрашивания мигрировавших клеток красителем DIFF-QUICK. Данные выражали в единицах интенсивности окрашивания миграционного поля. В качестве отрицательного контроля использовали миграционные поля в отсутствии хемоаттрактанта. Эксперименты повторяли трижды в 6 параллелях.

       Формирование капилляроподобных структур in vitro. Для оценки формирования капилляроподобных структур 5x104 ЭК, выращенными в присутствии 5 мМ или 25 мМ глюкозы, высевали на 24-луночный планшет, покрытый Матригелем без факторов роста (BD Biosciences), и инкубировали в среде культивирования для эндотелиальных клеток при 370C в течение 24 часов. Для оценки влияния кондиционированной среды МСК на формирование капилляроподобных структур, ЭК инкубировали в среде культивирования для эндотелиальных клеток в присутствии концентрированной в 40 раз кондиционированной среды роста МСК при 370C в течение 24 часов. Суммарную длину капилляроподобных структур оценивали в 5 случайных полях зрения в каждой лунке, используя программу MetaMorph 7.1 (Universal Imaging). Эксперименты повторяли трижды в трех параллелях.

       Выделение суммарной РНК и количественная ПЦР. Выделение общей РНК из ЭК или МСК проводили с использованием Qiagen RNeasy Mini Kit по методике, прилагаемой к набору. Для удаления геномной ДНК из образцов использовали RNase Free DNase Set (Qiagen). Концентрацию РНК определяли по поглощению раствора РНК при длине волны 260нм с помощью прибора NanoDrop200. Количественную ПЦР в реальном времени проводили на приборе Rotor-Gene R6-3000 (Corbett Research) с использованием SYBR Green PCR Master Mix (10 мкл), 1 мкл кДНК, синтезированной на 50 нг общей РНК и 1 мкл смеси праймеров в концентрации 1-5 мкМ. Условия для ПЦР выдерживали следующие: 95 С в течение 10 мин, затем 40 циклов 95С – 15 сек, nС – 20 сек (где n – температура, эмпирически подобранная для каждой пары праймеров), 72С – 20 сек. Для проведения количественной ПЦР в реальном времени были подобраны следующие пары праймеров: VEGFR1/FLT1 Fw 5’CAAGATTGACTTGAGAGTAACC3’ Rv 5’CTTCTAGAAATAAGGCTTCGTG3’, длина ампликона 239 пн; VEGFR2 /FLK1 Fw 5’AAGTAATCCCAGATGACAACCA3’ Rv  5’GTTTGCACTCCAATCTCTATCAG3’, длина ампликона 258 пн. Содержание мРНК рецепторов VEGF в образцах нормировали на содержание мРНК генов «домашнего хозяйства» GAPDH и L7; n = 6. Анализ содержания мРНК ангиогенных факторов проводили согласно протоколу RT2 Profiler PCR Array (SABiosciences, Frederik, MD, USA). Амплификация специфичных продуктов была проанализирована на приборе iQ5 (Bio-Rad Laboratories, Hercules, CA, USA). Среднее количество пороговых циклов Ct, для генов «домашнего хозяйства» (B2m, Rpl13a, G3pd и Ps1tp5bp1) использовали для определения относительного порогового цикла измеряемого гена (Ct) в каждой лунке. Различия между значениями Ct МСК, культивированных в условиях 5мМ или 25мМ глюкозы (Ct) были проанализированы с помощью непараметрического теста Вилкоксона.

       Иммунофлуоресцентное окрашивание ЭК. Рецепторы VEGF выявляли на ЭК с помощью иммунофлуоресцентного окрашивания, используя моноклональные антитела мыши, узнающие VEGFR1 или VEGFR2 (Abcam) и вторичные антитела осла против мыши, конъюгированные с флюорохромом Alexa488 (Molecular Probes). Ядра клеток докрашивали DAPI. Полученные препараты анализировали при помощи флуоресцентного микроскопа ZeissAxiovert 200M (Zeiss, Германия).

       Цитофлюориметрия в потоке. Для анализа экспрессии поверхностных маркеров, суспензию МСК, выращенных в условиях 5мМ или 25 мМ глюкозы, (0,5–1х105 МСК в 100 мкл ФСБ) окрашивали антителами мыши против антигенов человека: CD73-PE, CD90-CyChrome (BD Biosciences, Bedford, MA, USA), CD105-FITC или CD49a-Alexa488 (Serotec, Oxford, UK). В качестве контроля использовали изотипические иммуноглобулины. Для анализа клеточного цикла клетки фиксировали в 70% этаноле в течение 2 ч при -20°С и окрашивали Hoechst33342 (10 мкМ, Applichem, Darmstadt, Germany) или йодидом пропидия (PI, 25 мкМ Invitrogen) в ФСБ, содержащем 0,2 мг/мл РНКазы А (Invitrogen) и 0,1% Тритона-X-100 в течение 30 минут при комнатной температуре. Для оценки доли апоптотических клеток, 2-5х105 МСК инкубировали с аннексином V, конъюгированным с фикоэритрином, 7-аминоактиномицином (7-AAD). Окрашенные клетки анализировали с помощью проточного сортера клеток MoFlo (Dako Cytomation).

       Для оценки количества ЦПЭК, образцы крови пациентов окрашивали моноклональными антителами против антигенов человека (CD45-FITC, CD34-PerCP и VEGF-R2-PE) согласно протоколу, рекомендованному производителем (Becton Dickinson, США). Связывание меченых антител с клетками крови измеряли на приборе FACSСalibur (Becton Dickinson, США) с использованием программного обеспечения CellQuest. 

       Клиническая характеристика пациентов, участвовавших в исследовании. В исследование было включено 47 человек в возрасте от 42 до 73 лет (43 мужчины и  4 женщины в периоде менопаузы);  средний возраст больных в целом по выборке составлял 59,0±7,6 лет, проходивших обследование и лечение в Научно-консультативном отделе (рук. профессор Агеев Ф.Т.) Российского кардиологического научно-производственного комплекса Минздравсоцразвития РФ. Участники были разделены на 3 группы, сопоставимые по возрасту и полу:  1) Контрольная группа, 12 человек без  сердечно-сосудистых заболеваний и нарушений углеводного обмена; 2) Группа больных ИБС с постинфарктной сердечной недостаточностью без нарушений углеводного обмена, 21 пациент; 3) Группа больных ИБС с постинфарктной сердечной недостаточностью, сочетающейся с СД 2 типа, 14 человек. Средняя длительность СД 2 типа в целом по группе составляла 7,3+5,7 лет. Из 14 больных с ИБС+СД2 на момент включения в исследование 7 человек находились в стадии субкомпенсации нарушений углеводного обмена  со средне-тяжелым течением; 7 человек находились в стадии декомпенсации нарушений углеводного обмена со средне-тяжелым и тяжелым течением заболевания. Степень компенсации и тяжесть сахарного диабета определяли в соответствии с алгоритмами специализированной медицинской помощи больным сахарным диабетом (И.И. Дедов, М.В. Шестакова, 2009).

Критериями исключения, общими для всех групп пациентов, считали: наличие аутоиммунных патологий; наличие злокачественных новообразований, в том числе в анамнезе; наличие острых или хронических воспалительных заболеваний; длительную гормональную или антибиотикотерапию с возможным повреждением стволовых и прогениторных клеток; анемию (гемоглобин < 10 г/дл) и гематологические заболевания; острые нарушения мозгового кровообращения или черепно-мозговая травма в предшествующие 12 месяцев.

Клиническая характеристика больных, включенных в исследование, приведена в Таблице 1.

       Методы обследования пациентов. Общеклиническое обследование включало опрос пациента с целью выяснения субъективного состояния на предмет наличия ИБС (стенокардии), сбор анамнеза для уточнения длительности и характера течения ИБС (давность стенокардии, перенесенные ИМ и т.п.), уточнение наличия факторов риска ИБС (АГ, курение, избыточная масса тела, сахарный диабет 2 типа и другие нарушения углеводного обмена, гиперлипидемия и т.д.), отягощённого семейного анамнеза, а так же противопоказаний к включению в исследование; подробный осмотр больного. Всем больным проводили общий клинический и биохимический анализы крови, общий анализ мочи и анализ мочи по Нечипоренко. По показаниям: тест толерантности к глюкозе, определение гормонов, характеризующих функцию щитовидной железы.

Общий клинический анализ крови с определением количества эритроцитов, лейкоцитов, тромбоцитов, гемоглобина, гематокрита, лейкоцитарной формулы проводился на анализаторе Cell-Dуn 3500, Abbott, США. СОЭ определяли методом Панченкова.

Таблица 1. Клинические характеристики пациентов, включенных в исследование

Показатели

Контроль (1)

СН  (2)

СН+СД (3)

Всего, n=47

12

21

14

Возраст, годы

53,9+9,3

59,5+7,1

62,8+5,0

Мужской пол, n (%)

11

21 (100)

10

Индекс массы тела, кг/м2

28,4+3,4

30,5+4,0

33,2+2,3

Артериальная гипертония, n (%)

5 (41,7)

15 (71,4)

10 (71,4)

Анамнез ИБС, лет

-

7,4+5,3

6,1+4,9

Первичный инфаркт миокарда, n(%)

-

21 (100)

14 (100)

Длительность СН, лет

-

3,2+2,5

3,7+2,9

II ФК NYHA, n (%)

-

18(85,7)

7 (50)

III ФК NYHA, n (%)

-

3(14,3)

7 (50)

Фракция выброса, %

0,62+0,06

0,37+0,01

0,38+0,05

КДО, мл.

91,5+21,4

139,1+31,2

152,2+36,3

ЛП, мм.

38,6+2,8

43,9+3,7

48,6+5,2

ЛП  макс. объем, мл.

52,1+11,9

65+18,9

81+22,1

Соотношение E/A

0,8+0,4

1,5+1,0

Соотношение E/e′

8,9+3,3

13,9+4,6

6-минутный тест ходьбы, м.

-

398+43,6

242+60,4

NT-proBNP, пг/мл

69,6+80,9

383,8+374,7

1366,5+1398,1

Глюкоза плазмы,  ммоль/л

5,2+0,52

5,5+0,76

10,2+4,6

HbA1c, %

-

6,0+0,39

8,2+2,0

ИРИ, мкЕд/мл

10,8+6,2

13,9+6,7

-

С-пептид, нг/мл

2,5+0,9

3,2+0,9

-

ОХС, ммоль/л

5,6+0,9

4,5+1,4

4,5+1,4

ХС ЛПНП, ммоль/л

3,8+0,78

2,8+1,4

2,5+0,9

ХС ЛПВП, ммоль/л

1,1+0,22

1,1+0,19

0,9+0,12

ТГ, ммоль/л

1,4+0,5

1,3+0,5

2,2+1,9

ПЗВД %

5,8+2,6

5,5+2,4

6,2+2,7

Данные представлены в виде среднее ± стандартное отклонение (M+SD). СН- сердечная недостаточность; КДО- конечно-диастолический объем; ЛП- левое предсердие; E/A- соотношение максимальной скорости раннего и позднего диастолического наполнения; E/e′- соотношение максимальной скорости раннего диастолического наполнения левого желудочка и максимальной скорости подъёма основания левого желудочка в раннюю диастолу; NT-proBNP- N-концевой фрагмент предшественника мозгового натрийуретического пептида; HbA1c- гликированный гемоглобин;  ИРИ- иммунореактивный инсулин; ОХС- общий холестерин; ХС ЛПНП- холестерин липопротеидов низкой плотности; ХС ЛПВП- холестерин липопротеидов высокой плотности; ТГ-  триглицериды; ПЗВД-  поток-зависимая вазодилатация.

Биохимический анализ крови включал определение уровня общего белка, мочевины, креатинина, мочевой кислоты, общего билирубина, аланинаминотрансферазы, аспартатаминотрансферазы, щелочной фосфатазы, глюкозы, ОХС, ТГ, лактатдегидрогеназы, гамма-глутамилтрансферазы, электролитов (К+, Nа+). Его проводили на биохимическом анализаторе Hitachi 912 System (Roche, Швейцария). Тест толерантности к глюкозе (глюкозооксидазный метод) проводили из капиллярной крови (прибор Biosen, EKF, Германия). Уровень глюкозы 3,5 - 5,6 ммоль/л принимался за норму; диапазон 7,8 – 11,1 ммоль/л после нагрузки (при условии менее 7 ммоль/л натощак) - относили к нарушенной толерантности к глюкозе (НТГ); более 7,0 ммоль/л натощак и/или 11,1 через 2 часа после нагрузки - к сахарному диабету (СД). Уровень глюкозы натощак 5,6 – 7,0 ммоль/л при нормальных значениях после нагрузки расценивали как гипергликемию натощак (ГГН). Уровень глюкозилированного гемоглобина (HbA1c) определяли методом боратного аффинного анализа тест-системой фирмы «Drew Scientific» (Великобритания).

Определение уровня инсулина и С-пептида в сыворотке крови проводили методом ИФА с помощью набора фирмы SIEMENS (США) на приборе Immulite 1000 (Diagnostic Products Corporation, США). Референсные значения 6,0-27,0 мкЕ/мл и 0,9-4,0 нг/мл соответственно. Индекс инсулинорезистентности (ИИР) по формуле HOMA IR, в 1985 году D.Matthews:

ИИР = [инсулин, мкЕД/мл х глюкоза, ммоль/л / 22,5]. Значение ИИР более 2,27 рассматривали как наличие инсулинорезистентности.

В качестве показателей липидного обмена кроме общего холестерина и триглицеридов, анализировали уровень ХС-ЛПНП и ХС-ЛПВП сыворотки крови. Содержание ОХС и ТГ в сыворотке крови было определено ферментативным колориметрическим методом. Уровень высокочувствительного С-реактивного белка (вч–СРБ) определяли высокочувствительным иммунотурбидиметрическим методом.

Стандартное инструментальное обследование заключалось у всех больных в регистрации ЭКГ в 12 отведениях и проведении трансторакальной двухмерной ЭХО-КГ, при необходимости у некоторых больных - суточного мониторирование ЭКГ по Холтеру, тредмил-теста.

Статистическая обработка. Данные представлены в виде среднее ± стандартная ошибка среднего (M±m). Статистическую обработку данных производили при помощи программного пакета “STATISTIСA 6”. Соответствие выборок нормальному распределению проверяли с использованием критериев Колмогорова-Смирнова и Шапиро-Уилка. Статистически значимым считали различие при р<0,05. Для анализа значимости наблюдаемых различий использовали: множественное сравнение – ANOVA и тест Краскела-Уоллиса; попарное сравнение - параметрический t-критерий Стьюдента при нормальном распределении и непараметрический аналог – U тест Манна-Уитни – в случае ненормального распределения. Для определения значимости различий между связанными выборками применяли парный t–критерий или критерий Уилкоксона, соответственно. Взаимосвязь между показателями оценивали с помощью корреляционного анализа (методы Пирсона и Спирмана) в зависимости от распределения.

ОСНОВНЫЕ РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Влияние высоких концентраций глюкозы на функциональное состояние эндотелиальных клеток. Хроническая гипергликемия вызывает нарушение роста кровеносных сосудов и обновления их эндотелиальной выстилки, что приводит к развитию эндотелиальной дисфункции и способствует прогрессированию ишемии миокарда и нижних конечностей  у больных сахарным диабетом. Для исследования механизмов влияния гипергликемии на ангиогенные свойства клеток эндотелия сосудов эндотелиальные клетки вены пуповины человека культивировали в условиях, моделирующих гипергликемию in vitro (25 мМ глюкозы), и затем оценивали их способность к направленной миграции на ангиогенные факторы и  образованию капилляроподобных структур на матриксе (Матригеле).  В контрольных экспериментах клетки культивировали в условиях, моделирующих нормогликемию (5,5 мМ глюкозы). Было обнаружено небольшое, но достоверное снижение способности ЭК, культивированных при высокой концентрации  глюкозы, к миграции по градиенту сыворотки и  ключевого фактора ангиогенеза VEGF-165,  в сравнении с ЭК, культивированными при нормальной концентрации  глюкозы (р<0,05) (Рисунок 1).

Рисунок 1. Миграция ЭК в камере Бойдена. А. – По градиенту 10% сыворотки. Б. –По градиенту 5 нг/мл рекомбинантного VEGF-A165 человека. n=18, * - p<0,05.

Способность ЭК, культивированных при 25 мМ глюкозы, к  формированию  капилляроподобных структур на Матригеле, была значительно снижена (на 70%) в сравнении с клетками, культивированными при 5,5 мМ глюкозы (Рисунок 2).

Рисунок 2. Формирование капилляроподобных структур ЭК на Матригеле

А - В. - Репрезентативные микрофотографии капилляроподобных структур, сформированных ЭК на Матригеле. А. – структуры, образованные ЭК, выращенными при 5 мМ глюкозы, в отсутствии FBS. Б. – структуры, образованные ЭК, выращенными при 5 мМ глюкозы, в присутствии 10% FBS. В. - структуры, сформированные ЭК, культивированными при 25 мМ глюкозы в присутствии 10% FBS. Фазовый контраст, Х10. Г. – Результаты морфометрического анализа суммарной длины капилляроподобных структур.

Поскольку основным ангиогенным фактором, активирующим миграцию ЭК в процессе ангиогенеза в условиях ишемии,  является фактор роста эндотелия сосудов (VEGF),  для выяснения возможного молекулярного механизма влияния гипергликемии на ангиогенные свойства ЭК мы исследовали экспрессию рецепторов к VEGF на ЭК, культивированных при различных концентрациях глюкозы.  Было установлено, что в условиях, моделирующих гипергликемию, содержание мРНК рецепторов VEGF 1 и 2 типов (VEGFR1/ FLT1  и  VEGFR2/FLK1) снижалось в 4,5 и в 2,5 раза, соответственно (табл. 2). При иммунофлуоресцентном анализе количества рецепторов к VEGF на поверхности ЭК было обнаружено значительное снижение рецепторов второго типа VEGFR2/FLK1, когда клетки культивировали при 25 мМ глюкозы. Содержание рецепторов VEGF 1 типа (VEGFR1/ FLT1) существенно не отличалось от контроля (5,5 мМ глюкозы) (Рисунок 3).

Известно, что тирозин-киназная активность  VEGFR2/FLK1  почти в 10 раз выше, чем активность VEGFR1/ FLT1 и именно VEGFR2 опосредует активацию миграции ЭК и  формирование новых сосудистых отростков под действием VEGF [Shibuya et al., 2008; Zhong et al., 2006]. Поэтому уменьшение количества VEGFR2  на поверхности ЭК в условиях гипергликемии может приводить к снижению чувствительности к VEGF и подавлению VEGF опосредованных эффектов, в частности, миграции и формирования сосудов ЭК.

Таблица 2. Содержание мРНК рецепторов VEGF1,2 в ЭК, культивированных  в условиях высокой концентрации глюкозы .

мМ глюкозы/мРНК

5,5  мМ

25 мМ

VEGFR1/FLT1

1,1±0,4

0,21±0,18*

VEGFR2/FLK1

1,4±0,6

0,6±0,12*

* p<0,05;  ПЦР в реальном времени, отн.ед. n=6,

Рисунок 3. Иммунофлуоресцентный анализ содержания рецептора VEGF 2 типа в ЭК. А. – ЭК, инкубированные с неспецифичными иммуноглобулинами вместо первых антител. Б. – ЭК, культивированные при 5,5 мМ глюкозы. В. – ЭК, культивированные при 25 мМ глюкозы. Клетки окрашены антителами против VEGFR2 (зеленая флуоресценция). Ядра клеток докрашены DAPI (синяя флуоресценция.

Полученные данные показывают, что в условиях гипергликемии ангиогенные свойства  (способность к миграции и образованию сосудистых структур) клеток эндотелия сосудов снижаются, что вероятно и обусловливает недостаточный адаптивный ангиогенез, способствующий прогрессированию ишемии в миокарде и нижних конечностях у больных с диабетом.  Одним из механизмов этого снижения может быть подавление в условиях гипергликемии экспрессии рецепторов к VEGF 2 типа на эндотелиальных клетках.

Влияние повышенной концентрации глюкозы на способность МСК стимулировать рост кровеносных сосудов. Поскольку в организме МСК локализованы в сосудистой стенке (периэндотелиально и в адвентиции) и в значительной степени представлены перицитами или перицитоподобными клетками, они, по крайней мере, отчасти, выполняют функцию перицитов, включая стабилизацию капилляров, регуляцию проницаемости и тонуса кровеносных сосудов (Dar A. et al. 2012;  Armulik A, Genov G, Betsholtz C., 2011).  Поэтому адекватная биологическая активность этих клеток необходима для нормального роста и функционирования кровеносных сосудов, а ее изменение в условиях гипергликемии может существенно влиять на эти процессы.

При исследовании влияния повышенной концентрации глюкозы на содержание клеток, несущих маркерные антигены МСК CD105 и CD73 [Dominici et al., 2005], или МСК с высоким клоногенным потенциалом, CD49a и CD73, в популяциях МСК 2-го пассажа, полученных из жировой ткани, было установлено, что длительная инкубация при 25 мМ глюкозы не влияла на содержание мезенхимальных стволовых клеток в популяции культивируемых МСК. Культивирование в условиях высокой концентрации глюкозы также не влияло на долю пролиферирующих клеток в популяции (14±3,1% при 5,5 мМ; 14,6±4,3% при 25 мМ глюкозы) и их жизнеспособность (0,3±0,09% и 0,26±0,08% клеток находилось на ранних стадиях апоптоза при 5,5 или 25 мМ, соответственно).

       Ранее в нашей лаборатории было показано, что МСК стимулируют не только рост, но и созревание кровеносных сосудов, формируя физический контакт с эндотелиальными клетками [Rubina et al., 2009]. Поскольку стабилизация растущих сосудов требует привлечения МСК, миграция последних необходима для адекватного ангиогенеза. Одним из основных факторов, способствующих привлечению муральных клеток, в том числе и МСК, в растущий сосуд, является тромбоцитарный фактор роста (PDGF-BB), секретируемый эндотелиальными клетками формирующегося сосудистого отростка.

Для анализа влияния гипергликемии на миграцию МСК была использована модель зарастания царапины. Обнаружено, что в отсутствии стимулятора МСК, культивируемые как при 5,5 мМ, так и при 25мМ глюкозы, мигрировали слабо. При добавлении PDGF-BB, миграция МСК увеличивалась более чем в 3 раза. При этом клетки, выращенные при повышенной концентрации глюкозы,  мигрировали несколько слабее, чем контрольные МСК, однако наблюдаемое различие не было статистически достоверным. Таким образом,  повышение концентрации глюкозы до 25 мМ существенно не влияет на миграционную активность МСК.

Многочисленными исследованиями показано, что МСК  стимулируют рост кровеносных сосудов в основном посредством продукции цитокинов и факторов роста [Rehman et al. 2004; Bhang et al., 2009; Rubina et al., 2009].  Для исследования ангиогенной эффективности суммарных продуктов секреции МСК мы оценили влияние кондиционированной среды МСК на  формирование капилляроподобных структур эндотелиальными клетками на Матригеле. Оказалось, что  кондиционированная среда МСК, культивированных в условиях 5,5 мМ глюкозы, стимулирует капиллярогенез in vitro (рисунок 4,  А, Б и Г). Однако, когда МСК культивировали при 25 мМ глюкозы стимулирующий эффект кондиционированной среды исчезал (рисунок 4, Б, В и Г).

Рисунок 4. Формирование капилляроподобных структур ЭК под влиянием кондиционированной среды МСК.

А. – Капилляры, образованные ЭК, в присутствии 10% FBS. Б. – Капилляры, образованные ЭК, под действием кондиционированной среды МСК, выращенных при 5,5 мМ глюкозы. В. - Капилляры, сформированные ЭК, под действием кондиционированной среды МСК, выращенных при 25 мМ глюкозы. Фазовый контраст, X10. Г. - Результаты морфометрического анализа.

Для того чтобы выявить возможные молекулярные механизмы подавления ангиогенной активности суммарных продуктов секреции МСК под действием высокой концентрации глюкозы, мы проанализировали в этих клетках содержание мРНК 84 известных регуляторов ангиогенеза.

Оказалось, что при культивировании в условиях, моделирующих нормогликемию, МСК жировой ткани наиболее выражено экспрессируют такие стимуляторы ангиогенеза как PIGF, VEGF-C, bFGF, IGF1, IL-6, IL-8, мидкин и TGF-бета1. Эти клетки также содержат мРНК ингибиторов ангиогенеза, включая тканевые ингибиторы металлопротеаз 1 и 2, а также тромбоспондины 1 и 2. Из генов, регулирующих обмен белков внеклеточного матрикса, МСК наиболее выражено экспрессировали матриксные металлопротеазы 2 и 9, а также урокиназу.  Культивирование клеток в условиях, моделирующих гипергликемию, вызвало изменения уровня экспрессии 19 (22%) из 84 проанализированных генов; из них уровень экспрессии 13 генов был повышен, и 6 - подавлен. Так в клетках одновременно снижался уровень экспрессии металлопротеазы 9 (в 2,4 раза; p=0,1) и повышался уровень экспрессии тканевого ингибитора металлопротеазы 3 (в 2,6 раза; p=0,03).  В тоже время возрастал уровень экспрессии плазминогена, цинк-зависимой металлопротеазы APN, транскрипционного фактора HAND2,  рецепторов нейропилинов 1 и 2, а также ряда стимуляторов ангиогенеза, включая ангиопоэтины, aFGF и лептин. Эти данные указывают на то, что культивирование МСК при повышенной концентрации глюкозы изменяет экспрессионный профиль этих клеток, причем наиболее значительные изменения касаются генов факторов, участвующих в ангиогенезе. Однако зарегистрированные изменения экспрессионного профиля не позволяют объяснить существенное снижение ангиогенной эффективности суммарных продуктов секреции МСК, что диктует необходимость дальнейших исследований изменений секретома этих клеток под влиянием повышенной концентрации глюкозы.

Влияние гипергликемии на циркулирующие прогениторные клетки у больных ишемической болезнью сердца, сочетающейся с сахарным диабетом 2 типа. Циркулирующие прогениторные клетки (ЦПК) играют важную роль в репарации сосудистой стенки и процессах неоваскуляризации (Aicher et al., 2005, 2007;  Dimmeler S.,2010)

Известно, что сопутствующий сахарный диабет усугубляет течение сердечно-сосудистых заболеваний (Jagasia et al., 2003), способствует более выраженным нарушениям функции эндотелия и оказывает отрицательное влияние на функциональную активность ЦПК (Georgescu A., 2011). Последнее может явиться одним из механизмов прогрессирования сердечно-сосудистой патологии и важной мишенью для разработки  новых терапевтических воздействий, направленных на предотвращение осложнений.

Мы исследовали влияние сопутствующего сахарного диабета и выраженности нарушений углеводного обмена у больных ИБС на количественные характеристики циркулирующих прогениторных клеток. Для этого с помощью цитофлуориметрии в потоке исследовали суммарную популяцию прогениторных клеток, несущих на поверхности антиген CD34, но не экспрессирующих или экспрессирующих слабо антиген CD45. 

  Количество ЦПК, экспрессирующих на поверхности CD34, на миллион лейкоцитов в группе больных ИБС без СД 2 типа в среднем на 33,4% превышало их число в контрольной группе (577,3+157,5 и 432,9+103,7  соответственно, p<0,05). Группа больных ИБС  и постинфарктной сердечной недостаточностью в сочетании с СД 2 типа (ИБС+СД 2 типа) в среднем по количеству ЦПК не отличалось от контрольной группы, однако именно в этой группе больных была обнаружена выраженная вариабельность данного параметра.

Разделение этой группы на подгруппы в зависимости от компенсированности нарушений углеводного обмена  позволило установить, что  больные с компенсацией и субкомпенсацией нарушений углеводного обмена (уровень HbA1c  менее 7,5%,  уровень глюкозы плазмы натощак менее 7  ммоль/л) (Дедов И.И., Шестакова М.В., 2009)  характеризуются повышением ЦПК в периферической крови не только по сравнению с контрольной группой относительно здоровых людей того же пола и возраста, но и по сравнению с больными ИБС с постинфарктной сердечной недостаточностью без сопутствующего диабета (таблица 3, рисунок 5). В тоже время у больных с декомпенсацией нарушений углеводного обмена (уровень  HbA1c – более  7,5%, уровень глюкозы плазмы натощак более 7 ммоль/л) (Дедов И.И., Шестакова М.В., 2009) наблюдали выраженное снижение количества ЦПК в периферической крови по сравнению со всеми другими группами больных (таблица 3, рисунок 5).

Корреляционный анализ позволил выявить достоверную обратную связь между уровнем глюкозы натощак и количеством ЦПК у больных ИБС, с сопутствующим СД2 (r= -0,66  p=0,01)  (рисунок 6),  демонстрирующую, что наиболее выраженной гипергликемии соответствует и наибольшее снижение ЦПК. При объединении всех групп обследованных также выявлялась слабая, но достоверная обратная связь между уровнем глюкозы в крови и количеством ЦПК (r= -0,35,  p=0,02).

Рисунок 5. Количество ЦПК, экспрессирующих на поверхности CD34 у больных ИБС с  сердечной недостаточностью и сопутствующим СД 2 типа.

Полученные нами результаты свидетельствуют о том, что гипергликемия может являться важным фактором, способствующим снижению числа ЦПК у больных ИБС и нарушениями обмена углеводов.

Другими  параметрами, характеризующими состояние углеводного обмена, являются уровень иммунореактивного инсулина (ИРИ) и С-пептида. В данной работе  мы оценивали концентрацию ИРИ и С-пептида только в группе контроля и в группе больных ИБС без СД 2 типа, поскольку все больные СД 2 типа находились на сахароснижающей терапии, которая модулирует функцию панкреатического аппарата поджелудочной железы и, соответственно, секрецию инсулина.

Рисунок 6. Взаимосвязь количества CD34+ клеток с уровнем глюкозы крови. А. В целом по выборке (n=47). Б. У больных ИБС, отягощенной сердечной недостаточностью, с сопутствующим сахарным диабетом 2 типа (n=14).

По уровню  ИРИ  группа контроля и группа больных ИБС без СД 2 типа статистически значимо не отличались между собой, а концентрация  С-пептида в крови больных с  ИБС без СД 2 типа была достоверно выше по сравнению с группой контроля. Выявлена прямая корреляционная зависимость между уровнем ИРИ и количеством ЦПК в этих группах (рисунок 7), показывающая, что чем больше  уровень ИРИ у пациентов без сахарного диабета, тем больше  количество ЦПК.  И в контрольной группе,  и у больных с ИБС без СД 2 типа количество ЦПК положительно  коррелировало с уровнем  С-пептида (r= 0,85,  p=0,004 и  r=0,57, p=0,006, соответственно).

       

Результаты данного раздела работы показывают, что количество ЦПК в периферической крови больных ИБС с постинфарктной СН (ишемической кардиомиопатией), но без сопутствующего СД 2 повышено по сравнению с контрольной группой относительно здоровых людей того же пола и возраста. Такое повышение может быть обусловлено повышенной мобилизацией ЦПК из костного мозга в ответ на ишемию и гипоксию, обусловленные ИБС и сердечной недостаточностью. Однако при наличии у таких же больных сахарного диабета 2 типа количество ЦПК зависит от выраженности нарушений углеводного обмена и состояния его компенсации. При компенсированном СД сохраняется повышенное содержание в крови ЦПК, в тоже время при выраженной декомпенсации СД наблюдается обратная картина – число прогениторных клеток в крови падает.

ЦПК мобилизуются из костного мозга в ответ на повреждение сосуда и ишемию, мигрируют в участок повреждения, где заменяют поврежденные ЭК и принимают участие в формировании новых сосудов в зоне ишемии  (Dimmeler S.,2010).

Если процессы мобилизации этих клеток из костного мозга не нарушены, то их количество в периферической крови возрастает при наличии повреждения эндотелия или развитии ишемии и может быть маркером этих состояний; в случаях нарушения процессов мобилизации этих клеток из костного мозга их количество в крови может снижаться, как и их участие в процессах репарации и неоваскуляризации, что способствует  существенному нарушению этих процессов.  При исследовании с помощью цитофлуориметрии в потоке количества апоптотических ЦПК в этой группе больных  мы не обнаружили их увеличения по сравнению с другими группами. Поэтому существенное снижение ЦПК у больных с декомпенсированным СД может быть следствием нарушенного процесса их мобилизации из костного мозга. Важным фактором, способствующим этому нарушению, является гипергликемия, о чем свидетельствует достаточно сильная корреляционная связь между уровнем глюкозы крови и уровнем ЦПК в этой группе больных.

В группах пациентов без сахарного диабета количество ЦПК прямо коррелировало с уровнем ИРИ и С-пептида. Возможно, подобные взаимоотношения объясняются стимулирующим эффектом ИРИ и С-пептида на процесс  мобилизации ЦПК из костного мозга. Так, в работе Humpert  et. al. (2005),  показано, что адекватная инсулинотерапия в течение 5 недель у декомпенсированных больных с СД 2 типа  (HbA1c =10,6+1,6%) способствует увеличению в периферической крови количества клеток,  экспрессирующих на поверхности CD34 и CD133. Авторы продемонстрировали, что подобный эффект опосредован стимулирующим влиянием инсулина на экспрессию в периферических тканях и костном мозге цитокина SDF-1 – одного из ключевых факторов, участвующих в мобилизации ЦПК из костно-мозговой ниши.

       Полученные  в работе данные показывают, что гипергликемия может нарушать процессы адаптивного ангио- артериогенеза за счет подавления экспрессии рецепторов к VEGF на эндотелиальных клетках, а также способности этих клеток к направленной миграции и формированию капилляров. Повышенная концентрация глюкозы также снижает способность мезенхимальных стволовых клеток стимулировать ангиогенез, что, вероятно, обусловлено изменением продукции ангиогенных факторов этими клетками. Кроме того, гипергликемия вызывает подавление мобилизации ЦПК из костного мозга в ответ на ишемию тканей и повреждение эндотелия, что в свою очередь может приводить к нарушению репарации сосудистой стенки, а также недостаточному ангио- васкулогенезу при ишемии. Выявленные изменения функционального состояния этих типов клеток могут быть мишенью для терапии, направленной на предотвращение сердечно-сосудистых  осложнений при сахарном диабете.

ВЫВОДЫ

  1. Культивирование эндотелиальных клеток в условиях, моделирующих гипергликемию (при 25 мМ глюкозы), подавляет экспрессию рецепторов VEGF 2 типа,  направленную миграцию этих клеток на VEGF и сыворотку,  а также  формирование ими капилляроподобных структур на Матригеле.
  2. Продукты секреции мезенхимальных стромальных клеток стимулируют формирование капилляроподобных структур эндотелиальными клетками, а культивирование мезенхимальных стромальных клеток в среде с повышенной концентрацией глюкозы (25 мМ) существенно снижает этот эффект.
  3. Культивирование мезенхимальных стромальных клеток жировой ткани при высокой концентрации глюкозы (25 мМ) изменяет уровень экспрессии генов, принимающих участие в регуляции ангиогенеза.
  4. Количество циркулирующих  прогениторных клеток, экспрессирующих на поверхности CD34, в периферической крови больных ИБС с постинфарктной сердечной недостаточностью, сочетающейся с  сахарным диабетом 2 типа, зависит от выраженности гипергликемии и состояния компенсации нарушенного углеводного обмена: число клеток  повышено при компенсированном диабете и снижено при декомпенсированном диабете. Наиболее выраженной гипергликемии соответствует и наибольшее снижение количества циркулирующих прогениторных клеток.
  5. У практически здоровых людей и больных ИБС с постинфарктной сердечной недостаточностью без сахарного диабета количество прогениторных клеток, экспрессирующих на поверхности CD34, в периферической крови прямо коррелирует с уровнем иммунореактивного инсулина и С-пептида.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

Статьи:

1. Ткачук В.А., Акопян Ж.А. Кровеносные сосуды человека // Актуальные проблемы биологии: сборник статей №1 /сост. И.Б. Морзунова. – М.: Дрофа, 2009. – с. 86-99.

2. Калинина Н.И., Акопян Ж.А., Пахомова Е.А., Шестакова М.В., Парфенова Е.В. Влияние гипергликемии на функциональное состояние клеток эндотелия вены пуповины человека in vitro. Доклады Академии наук. 2009; 426 (4): 1–3.

3. Кочегура Т.Н., Ефименко А.Ю., Акопян Ж.А., Парфенова Е.В. Клеточная терапия сердечной недостаточности: клинический опыт, проблемы и перспективы. Клеточная трансплантология и тканевая инженерия. 2010; 5(2): 11-18.

4. Акопян Ж.А., Шаронов Г.В., Кочегура Т.Н., Ильяшенко Н.Ф., Белянко И.Э., Димитрова В.И., Зотиков А.Е.,  Калинина Н.И., Парфенова Е.В. Влияние высокой концентрации глюкозы на способность мезенхимальных стромальных клеток контролировать рост кровеносных сосудов. Сахарный диабет. 2011, 2(51): с. 32-36.

5. Кочегура Т.Н.,  Акопян Ж.А., Шаронов Г.В., Ефименко А.Ю., Агеев Ф.Т., Овчинников А.Г., Жигунова Л.В., Лахова Е.Л., Кулев Б.Д., Соколова А. В., Шестакова М.В., Парфёнова Е.В. Влияние сопутствующего  сахарного диабета 2 типа на количество циркулирующих прогениторных клеток у больных с ишемической  кардиомиопатией. Сахарный диабет. 2011, 3(52): с. 36-43.

6. Ефименко А.Ю., Акопян Ж.А., Рубина К.А., Калинина Н.И., Суздальцева Ю.Г., Кочегура Т.Н., Бредихин А.М. Системная трансплантация аутологичных мезенхимальных клеток костного мозга больным ишемической болезнью сердца: долгосрочное наблюдение и результаты повторного введения. /В кн. Стволовые клетки и регенеративная медицина./ Под ред. В.А. Ткачука. – М.: МАКС Пресс, 2011. – С. 206-234.

7. Акопян Ж.А., Ефименко А.Ю., Рубина К.А., Калинина Н.И., Суздальцева Ю.Г., Кочегура Т.Н., Бредихин А.М. Системная трансплантация аутологичных мезенхимальных клеток костного мозга больным ишемической болезнью сердца, сочетающейся с сахарным диабетом: долгосрочное наблюдение и результаты повторного введения. /В кн. Стволовые клетки и регенеративная медицина./ Под ред. В.А. Ткачука. – М.: МАКС Пресс, 2011. – С. 235-263. 

Тезисы докладов:

1. Акопян Ж.А., Кочегура Т.Н., Шаронов Г.А., Калинина Н.И., Парфенова Е.В. Влияние гипергликемии на функциональную активность стромальных клеток жировой ткани. Всероссийский симпозиум  «Культивируемые клетки как основа клеточных технологий». Цитология, 2009, 51 (9), с.752-753.

2. Kochegura T., Akopyan Z., Sharonov G., Ovchinnikov A., Jigunova L., Lakhova Y., Kulev B., Sokolova A., Shestakova M., Ageev F., Parfyonova Yе. Сirculating progenitor cells in patients with ischemic cardiomyopathy and type 2 diabetes mellitus comorbidity//9th International Congress on Coronary Artery Disease (ICCAD), Venice, 2011: Abstracts book. - P.1131.

АННОТАЦИЯ

Акопян Жанна Алексеевна «Функциональная активность эндотелиальных, мезенхимальных и циркулирующих прогениторных клеток при повышенной концентрации глюкозы in vitro и гипергликемии у больных сахарным диабетом»

Целью работы была оценка влияния высокого уровня глюкозы на основные типы клеток, участвующие в процессах роста и восстановления кровеносных сосудов. В работе проведено подробное исследование функциональных свойств культивируемых эндотелиальных клеток вены пуповины и мезенхимальных стволовых клеток жировой ткани человека при повышенной концентрации глюкозы in vitro, а также влияния нарушений углеводного обмена на количество циркулирующих прогениторных клеток у больных ишемической болезнью сердца, сочетающейся с сахарным диабетом и без него.

Охарактеризованы ангиогенные свойства ЭК и содержание в них VEGFR1,2; а также дифференцировочный потенциал, пролиферативная активность и  ангиогенные свойства МСК-ЖТ, культивированных до 2 пассажа. Исследовано влияние сопутствующего сахарного диабета 2 типа на число циркулирующих прогениторных клеток в периферической крови больных ИБС. 

Установлено, что культивирование эндотелиальных клеток при высокой концентрации глюкозы (25мМ) подавляет их ангиогенные свойства - способность к миграции на ангиогенные факторы и к формированию капилляроподобных структур, что может быть обусловлено подавлением уровня экспрессии рецепторов к VEGF на этих клетках. Показано, что культивирование мезенхимальных стволовых клеток при высокой концентрации глюкозы (25мМ) изменяет уровень экспрессии генов факторов, регулирующих ангиогенез, и подавляет способность этих клеток стимулировать ангиогенез за счет секреторной активности. Обнаружено, что количество циркулирующих прогениторных клеток (ЦПК) в периферической крови больных ИБС, сочетающейся с СД 2 типа, тесно соотносится с уровнем гипергликемии и состоянием компенсации нарушений углеводного обмена: количество ЦПК значительно снижено при выраженной гипергликемии и декомпенсации диабета.

Zhanna A. Akopyan. Functional activity of endothelial, mesenchymal and circulating progenitor cells under increased glucose concentration in vitro and hyperglycemia in diabetes mellitus patients.

       The aim of this study was to evaluate effects of high glucose concentration on major cell types, mediating the growth and repair of blood vessels. Detailed investigation of functional activity of endothelial and mesenchymal cells cultured in the presence of high glucose concentration as well as the effect of disordered carbohydrate metabolism on the amount of circulating progenitor cells in diabetes mellitus patients was conducted in this study.

       Angiogenic behavior of EC and expression of VEGFR1,2 as well as differentiation, proliferation and angiogenic properties of cultured MSC were characterized. The effect of diabetes mellitus on the amount of circulating progenitor cells in the peripheral blood of patients with ischemic heart disease was conducted in this study.

       Incubation of endothelial cells in high glucose concentration (25mM) inhibits their angiogenic behavior – the ability to migrate along the angiogenic factors gradient and to form capillaries, at least in part due to decreased level of VEGF receptors expression on these cells. It was shown that incubation of mesenchymal stem cells in high glucose concentration (25mM) affects the expression profile of angiogenic factors in these cells and inhibits their ability to stimulate angiogenesis. It was also demonstrated that the number of circulating progenitor cells in the peripheral blood of patients with ischemic heart disease complicated by diabetes mellitus tightly correlates with the level of hyperglycemia and the compensation of disordered carbohydrate metabolism: the amount of CPC is decreased in prominent hyperglycemia and decompensate diabetes.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.