WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Данг Тху Тхюи

БИОДЕГРАДАЦИЯ НЕФТИ И НЕФТЕПРОДУКТОВ С ИСПОЛЬЗОВАНИЕМ НОВОГО КОНСОРЦИУМА БАКТЕРИЙ РОДА ACINETOBACTER

03.02.08 – экология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Воронеж – 2012

Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Воронежский государственный университет» (ФГБОУ ВПО «ВГУ»).

Научный консультант: доктор биологических наук, доцент Грабович Маргарита Юрьевна

Официальные оппоненты: Девятова Татьяна Анатольевна доктор биологических наук, доцент, Воронежский государственный университет, заведующая кафедрой экологии и земельных ресурсов Патрицкая Валентина Юрьевна кандидат биологических наук, Воронежская государственная медицинская академия им. Н. Н. Бурденко, ассистент кафедры биологии

Ведущая организация: Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Воронежский государственный университет инженерных технологий»

Защита состоится «30» мая 2012 года в 14 часов на заседании диссертационного совета Д 212.038.05 при Воронежском государственном университете по адресу:

394006, г. Воронеж, Университетская пл., д. 1. ауд. 59.

Автореферат диссертации размещен на официальном сайте Минобрнауки Российской Федерации и на сайте Воронежского государственного университета www.vsu.ru.

С диссертацией можно ознакомиться в Зональной научной библиотеке Воронежского государственного университета.

Автореферат разослан « 27 » апреля 2012 г.

Учёный секретарь диссертационного совета Барабаш Г.И.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. В настоящее время в результате антропогенной деятельности происходит глобальное загрязнение окружающей среды токсичными веществами. Нефть и нефтепродукты признаны основными загрязнителями окружающей среды (Blum et al., 2008). Особую нагрузку при этом испытывает почва, что проявляется в ухудшении её морфологических и физико-химических свойств, угнетении самоочищающей способности и негативных изменениях развития и функциональной активности организмов почвенного биоценоза (Пиковский и др., 2003; Stroud et al., 2007). Аварийные и хронические разливы нефти приводят к быстрой потере продуктивности земель или полной деградации ландшафтов.

Ограниченность земельных ресурсов ставит неотложную задачу возврата в хозяйственное использование всех нарушенных и деградированных почв (Бурмистрова и др., 2003).

Поскольку на современном уровне развития нефтяной промышленности не представляется возможным полностью исключить её негативное воздействие на окружающую среду, возникает необходимость разработки методов и технологий восстановления почв, загрязнённых нефтяными углеводородами (Сулейманов и др., 2005). Экологически перспективными являются микробиологические способы очистки от нефтезагрязнений, основанные на стимулировании роста и активности природных микроорганизмов (биостимуляция) или внесении в почву селекционированных микроорганизмов-деструкторов (биоаугментация) (Нечаева, 2009; Киреева и др., 2009;

Mishra et al., 2001; Wilkinson et al., 2002; Ouyang et al., 2005). Одними из активных нефтедеструкторов являются бактерии рода Acinetobacter. Они используются в качестве монокультуры или в составе биопрепаратов. Однако существующие на сегодняшний день биопрепараты либо не отличаются высокой эффективностью, либо сложны и дорогостоящи в производстве. Кроме того, часто в состав таких препаратов включаются представители Acinetobacter с неясным таксономическим положением.

В Воронежской области нет широкомасштабных разливов нефтепродуктов в связи с отсутствием крупных нефтедобывающих и нефтеперерабатывающих предприятий, но проблема загрязнения нефтепродуктами стоит не менее остро на территориях, прилегающих к крупным автострадам, заправочным станциям, автомастерским. В настоящее время эти загрязненные территории не подвергаются обработке биопрепаратами.

В связи с вышесказанным остро стоит вопрос разработки экологически безопасных и экономически обоснованных мероприятий, направленных на интенсификацию процессов биоразложения углеводородов, очистки и восстановления плодородия земель, в частности, разработка и применение консорциума на основе штаммов углеводородокисляющих микроорганизмов, эффективных в условиях местного региона.

Цель и задачи исследования. Целью данной работы является установление таксономического статуса штаммов рода Acinetobacter sp. В-5064, В-2838, В-3780 и на их основе разработка и применение нового консорциума бактерий-нефтедеструкторов для очистки от нефтезагрязнений в условиях местного региона.

Для достижения поставленной цели в работе решались следующие задачи:

1. На основе полифазного анализа определить таксономическое положение штаммов рода Acinetobacter sp. В-5064, В-2838, В-3780.

2. Изучить способность штаммов Acinetobacter sp. В-5064, В-2838 и В-3780 к деструкции отдельных углеводородов нефти и нефтепродуктов на примере лабораторного, вегетационного и микрополевого опытов.

3. Выделить биоПАВ штаммов Acinetobacter sp. В-5064, В-2838, В-3780 и изучить их поверхностно-активные свойства.

4. Проверить возможность технологического использования ПАВ-биопродуктов для очистки технологических емкостей от нефтепродуктов, эмульгирования нефти и десорбции нефти с песка.

5. Обосновать возможность использования консорциума микроорганизмов – нефтедеструкторов рода Acinetobacter в составе биопрепарата для биоремедиации почв.

Положения, выносимые на защиту:

1. Полифазный анализ коллекционных штаммов (ВКПМ ФГУП ГосНИИГенетика) рода Acinetobacter с неясным таксономическим положением, позволяет отнести их к видам Acinetobacter calcoaceticus (штамм В-3780) и Acinetobacter radioresistens (штаммы В-2838 и В-5064).

2. Штаммы A. calcoaceticus В-3780, A. radioresistens B-2838 и B-5064 обладают высокой углеводородокисляющей активностью и способны к образованию биосурфактанта.

3. Штаммы нового консорциума отличаются избирательностью в отношении биодеградации нефти и нефтепродуктов: основная роль Acinetobacter radioresistens – ферментативное окисление нефтепродуктов (штамм В-5064 эффективно окисляет нефть, штамм В-2838 – бензин), A. calcoaceticus В-3780 – продуцирует эффективный биосурфактант.

4. Консорциум из штаммов Acinetobacter calcoaceticus В-3780, Acinetobacter radioresistens B-2838 и B-5064 эффективно осуществляет деструкцию нефти и нефтепродуктов и может использоваться для процессов биоремедиации почв.

Научная новизна и значимость работы. На основе полифазного анализа, включающего морфологические, культуральные, физиолого-биохимические и филогенетические характеристики, был установлен видовой статус бактерий Acinetobacter sp. В-5064, В-2838 и B-3780, полученных из Всероссийской коллекции промышленных микроорганизмов ФГУП ГосНИИГенетика: штамм В-37принадлежит к виду Acinetobacter calcoaceticus, а штаммы B-2838 и B-5064 относятся к виду Acinetobacter radioresistens.

Показана высокая углеводородокисляющая активность Acinetobacter radioresistens В-5064, В-2838 и Acinetobacter calcoaceticus B-3780 в лабораторном, вегетационном и микрополевом почвенном эксперименте. Деструкция нефти в почве составила 48 % за 40 дней.

Выявлена способность исследуемых штаммов Acinetobacter к образованию биосурфактанта. Поверхностно-активные свойства биоПАВ штамма A. calcoaceticus В3780 значительно отличаются от аналогичных свойств ПАВ Acinetobacter radioresistens В-5064, В-2838. ПАВ A. calcoaceticus В-3780 обладает высокой поверхностной активностью, которая в 14-15 раз превышает таковые для двух других штаммов на границе раздела «вода - воздух», и в 7-40 раз на границе раздела «вода петролейный эфир», что свидетельствует о большей гидрофобности сурфактанта штамма В-3780.

Обоснована возможность использования консорциума данных штаммов в составе биопрепарата: основная роль Acinetobacter radioresistens – ферментативное окисление нефтепродуктов (штамм В-5064 эффективно окисляет нефть, штамм В-2838 – бензин), A. calcoaceticus В-3780 продуцирует эффективный биосурфактант.

Показано, что ПАВ-биопродукты штаммов Acinetobacter можно применять для очистки технологических емкостей от нефтепродуктов, эмульгирования нефти.

Биопродукт Acinetobacter calcoaceticus В-3780 перспективен для десорбции нефти с песка, что можно использовать для биоремедиации песчаных площадок при нефтеразливах.

Практическая значимость. Разработан новый консорциум бактерийнефтедеструкторов рода Acinetobacter, включающий A. calcoaceticus B-3780, A.

radioresistens B-2838, B-5064 для биоремедиации почв. Новый консорциум, пройдя серию полевых и лабораторных испытаний, зарекомендовал себя как эффективный деструктор нефтепродуктов. Результаты работы могут быть использованы при разработке комплексных технологий по восстановлению нефтезагрязненных почв, для очистки технологических емкостей от нефтепродуктов и для биоремедиации песчаных площадок при нефтеразливах.

Апробация работы. Основные положения работы доложены на конференциях:

1. Международная экологическая студенческая конференция «Экология России и сопредельных территорий» (Новосибирск, 2011).

2. Международная молодежная школа – конференция «Биология – наука XXI века» (Пущино, 2011).

3. VIII научно-практическая экологическая конференция (Воронеж, 2012).

Публикации. Материалы диссертации содержатся в 8 печатных работах: экспериментальных статьях и 3 тезисах. 4 статьи, опубликованные по теме диссертации, состоят в списке журналов, рекомендованных ВАК РФ.

Объем и структура диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов, результатов исследования и их обсуждения, заключения, выводов, списка использованной литературы и приложения.

Работа изложена на 153 страницах, включает 19 таблиц, 38 рисунков, список литературы из 241 наименований, из них 79 на русском и 162 на английском языке.

Место проведения работы и благодарности. Работа выполнена на кафедре биохимии и физиологии клетки Воронежского государственного университета под руководством д.б.н. Грабович М.Ю.

Автор выражает глубокую признательность ассистенту Белоусовой Е.В., аспиранту Логиновой О.О., студентке Вязниковой О.С. за помощь на отдельных этапах работы.

Автор выражает глубокую благодарность к.б.н., доценту Н.В. Безлер (ВГУ) за помощь в постановке и интерпретации почвенных экспериментов, к.б.н., доценту Т.Н.

Поярковой (ВГУ) за помощь в исследовании поверхностно-активных свойств биоПАВ, ООО «ВЕГА-эко» в лице генерального директора Е.Г. Большакова за предоставленные штаммы и возможность использования оборудования.

Автор выражает особую благодарность научному руководителю д.б.н. Грабович М. Ю. за помощь в формулировании положений диссертации, полезные советы и поддержку на всех этапах работы.

СОДЕРЖАНИЕ РАБОТЫ

Глава 1. Обзор литературы Приведен обзор литературы по изучаемой проблеме. Рассмотрено влияние нефтепродуктов на окружающую среду, способы биоремедиации, и факторы, имеющие значение в данных процессах. Дана характеристика рода Acinetobacter и ПАВ, образуемых микроорганизмами.

Глава 2. Объекты и методы исследования Объектами исследования служили углеводородокисляющие штаммы бактерий из Всероссийской коллекции промышленных микроорганизмов ФГУП ГосНИИГенетика.

Согласно паспортам коллекции ВКПМ «ГосНИИгенетика», выбранные штаммы: В-2838, В-3780 и В-5064 «специализируются» на разных субстратах. Так, штамм В-2838, депонированный как Acinetobacter «calcoaceticus», способен осуществлять деструкцию парафинов С6-С22; штамм В-3780, депонированный как A. «calcoaceticus», способен к деструкции метанола, формальдегида, фенола; штамм В-5064, депонированный как Acinetobacter sp., способен к деструкции нефтепродуктов, н-парафинов, этанола.

Выбранные штаммы ранее не включались в состав известных на сегодняшний день препаратов.

Состав питательных сред. Для культивирования штаммов Acinetobacter использовали питательную модифицированную среду MS (Larkin, Williams, 1977).

Штаммы культивировали на жидких и твердых средах, в последнем случае добавляли агар в количестве 17 г/л. Опыты по изучению окисления углеводородов нефти проводили с использованием минеральной модифицированной среды Армбрустера (Armbruster, 1969).

Изучение физиолого-биохимических свойств культур проводили с помощью стандартных методов, используемых в микробиологической практике.

Оценка резистентности к антибиотикам проводилась стандартизированным диско-диффузионным методом на основании МУК 4.2.1890-04 «Определение чувствительности микроорганизмов к антибактериальным препаратам».

Учёт общей численности микроорганизмов проводили методом посева на РПА.

Выделение ДНК из биомассы бактерий проводили согласно методу (Булыгина и др., 2002).

Амплификация гена 16S рРНК. Для проведения ПЦР гена 16S рРНК была использована универсальная праймерная система 27 F (AGAGTTTGATCCTGGCTCAG) 1492 R (TACGGYTACCTTGTTACGACTT) (Lane, 1991). Выделение и очистку продуктов ПЦР проводили из легкоплавкой агарозы с применением набора реактивов Wizard PCR Preps (Promega, США), согласно рекомендациям производителя.

Определение нуклеотидной последовательности генов 16S рРНК проводили по методу Сэнгера с соавт. (Sanger et al., 1977) с помощью набора реактивов Big Dye Terminator v.3.1 (Applied Biosystems, Inc.,USA).

Филогенетический анализ нуклеотидных последовательностей генов 16S рРНК изучаемых штаммов проводили с помощью программного пакета BLAST (Camacho et al., 2008). Для построения филогенетических деревьев использовали алгоритмы «neighborjoining» и «maximum parsimony».

Лабораторный эксперимент по изучению деструкции нефтепродуктов в почве.

Использовали гумусовый горизонт серой лесной почвы. Навески почвы (по 200 г) помещали в вегетационные сосуды 500 мл так, чтобы создать почвенный слой высотой 57 см. Сосуды с почвой стерилизовали в автоклаве при давлении 1атм и температуре 120 °С. Нефтепродукты в почву вносили однократно из расчёта 500 мкл на 200 г воздушно-сухой почвы. Инкубирование почвы с культурой проводили при температуре 27 °С.

Вегетационный опыт. Почву помещали в контейнеры с размерами 1,50,20,15 м.

В качестве загрязнителей использовали следующие нефтепродукты: отработанное масло, дизельное топливо и бензин в концентрации 5 % от массы почвы. Инокулят вносили в объеме 1,5 л, количество клеток при этом составило 1,61014 кл/г почвы. Контейнеры инкубировали при температуре 24 °С.

Микрополевой опыт. В микрополевом масштабе ремедиация осуществлялась на специально оборудованной площадке в естественных условиях. Эксперимент проводили при 13-30 С, регулярной агротехнической обработке: рыхление один раз в неделю и увлажнение почвы.

Определение содержания нефтепродуктов в жидкой среде и почве проводили ИКфотометрическим методом, согласно ПНДФ 14.1:2:4.168-2000 и ПНДФ 16.1:2.2.22-98 при длине волны 342 нм на концентратомере КН-2м («Сибэкоприбор», г. Новосибирск).

Определение ферментативной активности почв проводили по (Хазиев, 2005).

Выделение биосурфактанта. Биосурфактанты получали из 5-7 суточных бактериальных культур, выращенных на минеральной среде с добавлением гексадекана. Экстракт получали с использованием метил-третбутилового эфира.

Определение поверхностного натяжения биосурфактантов на границе раздела «раствор - воздух» проводили сталагмометрическим методом. По полученным данным строили изотермы поверхностного натяжения и адсорбции и находили основные характеристики сурфактантов по уравнениям Ленгмюра и Шишковского (Абрамзон, 1979).

Определение межфазного натяжения биосурфактантов на границе раздела «жидкость - жидкость». Для оценки поверхностной активности ПАВ при адсорбции из воды и углеводорода измеряли межфазное натяжение на границе раздела «вода петролейный эфир», при равновесном распределении ПАВ между фазами (Абрамзон, 1981). Строили изотермы межфазного натяжения, находили поверхностную активность (G) ПАВ в каждой из фаз. Измерения межфазного натяжения растворов производили с помощью сталагмометра.

Индекс эмульгирования гексадекана и вазелинового масла определяли через 5 мин, 1 час. и 24 час. в процентах как отношение величины эмульсионного столба к общей высоте столба жидкости в пробирке после обработки субстрата ультразвуком (22 кГц, мин) или механического встряхивания (1 мин).

Визуальный тест на смачиваемость парафинового слоя проводили, прикапывая 150 мкл пробы на парафиновый слой, нанесенный на предметное стекло путем натирания.

Об эффективности смачивания судили по соотношению высоты и диаметра капель.

Десорбцию нефти с песка изучали на пробах песка с предварительно адсорбированной нефтью. Образцы помещали в чашки Петри с (а) дистиллированной водой, (б) культуральной жидкостью с клетками бактерий Acinetobacter sp., (в) ПАВбиопродуктом и 1 % раствором бытового моющего средства «Fairy», состоящего из синтетических анионных ПАВ (5-15 %) и неионогенных ПАВ (менее 5 %). После выдерживания пробы в стационарных условиях в течение недели, жидкость декантировали в пробирки и проводили визуальную оценку десорбции нефти с песка по величине столбика нефтепродуктов, перешедших в водную фазу.

Десорбция нефти с поверхности стеклянной колбы. В колбу со 100 мл дистиллированной воды вносили 3 г нефти, добавляли 1 мл или 2 мл биопродукта, встряхивали и проводили визуальную оценку результатов.

Статистическая обработка результатов. Опыты проводили в 3-4 кратной повторности, аналитические определения для каждой пробы осуществляли в трех повторностях. Обсуждаются статистически достоверные различия при р < 0,05 (Лакин, 1990).

Глава 3. Результаты и их обсуждение 3.1. Идентификация штаммов Acinetobacter sp. В-3780, В-2838, В-503.1.1. Морфологические и культуральные характеристики новых штаммов Acinetobacter sp. В-5064, В-2838 и В-37Морфологические различия у штаммов В-5064, В-2838 и В-3780 выражены незначительно. Колонии располагаются во всей толще агаризованной среды; белого или кремово-белого цвета, округлой формы, гладкие, матовые, 1-2 мм в диаметре.

Клетки Грамотрицательные, в логарифмической фазе роста клетки короткие, толстые, палочковидной формы (рис. 1), но могут ставиться более кокковидными в стационарной фазе.

Рис. 1. Морфология штаммов.

Acinetobacter sp.

а - штамм B-3780, б - штамм B-2838, в - штамм В-5064, г - цепочки клеток, образованные штаммом В-2838.

Масштаб 5 мкм 3.1.2. Физиолого-биохимические характеристики Из испытанных органических соединений исследуемые коллекционные штаммы способны использовать широкий спектр соединений в качестве источника углерода, включающий органические кислоты, сахара, спирты, некоторые аминокислоты, а также гидролизат казеина, пептон и дрожжевой экстракт. Все штаммы способны использовать в качестве источника азота аспартат, глутамат, пептон, дрожжевой экстракт, гидролизат казеина, пептон аспартат, метионин, цитеин, но не используют аммонийный, нитратный азот, метионин.

Штаммы В-2838, В-3780, В-5064 характеризуются отсутствием гидролитических ферментов, разлагающих сложные органические субстраты – крахмал, желатин, казеин. Все штаммы обладают каталазной и не обладают оксидазной активностью. Не удалось обнаружить образование индола, сероводорода, фумаратного дыхания и дыхания на нитратах. Не образуют пигменты при росте на ароматических аминокислотах. Растут с 3 % NaCl. Не образуют кислоты при росте на сахарах.

Штаммы Acinetobacter sp. способны расти в интервале рН от 4 до 9 с оптимумом рН и диапазоне концентраций NaCl от 0 до 3 %.

3.1.3. Филогенетический анализ Для штаммов Acinetobacter sp. B-3780, B-2838 и B-5064 были определены практически полные последовательности амплификата гена, кодирующего 16S рРНК.

Был проведен анализ полученных последовательностей путем сравнения с аналогичными последовательностями, помещенными в базу данных GenBank. Из полученных данных следует, что филогенетически наиболее близким к исследованному штамму B-3780 был Acinetobacter calcoaceticus штамм NCCB 22016T.

Уровень сходства соответствующих последовательностей составил 100 %.

Последовательности генов штаммов B-2838 и B-5064 оказались идентичными. Из полученных данных следует, что филогенетически наиболее близким к исследованным штаммам были A. radioresistens штамм S13 и A. radioresistens DSM 6976Т. Уровень сходства нуклеотидных последовательностей у исследуемых штаммов составил 99,9 % и 99,6 %, соответственно. На филогенетическом дереве (рис. 2), включающем представителей рода Acinetobacter, исследуемые штаммы образовывали кластеры с A.calcoaceticus (штамм B-3780) и с A. radioresistens (штаммы B-2838 и B5064).

Рис. 2. Филогенетическое положение исследованных штаммов Acinetobacter sp.

Алгоритм построения дендрограммы – «neighbor-joining» на основании сравнения 10альтернативных деревьев. Слева вверху указан масштаб эволюционных расстояний.

Достоверность ветвления указана в процентах. Указаны величины более 50%. В качестве outgroup использована последовательность гена 16S рРНК Moraxella bovis ATCC 10900, типового вида типового рода семейства Moraxellaсea.

3.2. Деструкция нефтепродуктов A. calcoaceticus В-3780, A. radioresistens В2838, В-503.2.1. Использование штаммами А. calcoaceticus В-3780 и A. radioresistens В5064, В-2838 углеводородов нефти в качестве единственного источника углерода Нами был протестирован ряд соединений, входящих в состав нефти на предмет возможности использования их штаммами в качестве единственного источника углерода при росте. В опытах использовались как соединения циклической, так и нециклической природы (табл. 1).

В результате удалось выяснить, что выбранные нами штаммы эффективно окисляют ароматические и нециклические компоненты, которые являются трудно разлагаемыми в процессах биоремедиации и рекультивирования нефтезагрязненных почв.

Таблица Использование штаммами Acinetobacter углеводородов, входящих в состав нефти в качестве единственного источника углерода Соединения Штамм В-3780 В-2838 B-50Алканы Декан (С10) + + + Гептан (С7) + + + Октан (С8) +* + + Гексадекан (С16) + н.о. н.о.

Ундекан (С11) + + + Циклоалканы Циклогексан (С6) +* - + Ароматические углеводороды Ксилол (С8) + + + Толуол (С7) + + + Бензол (С7) + + + Этилбензол (С8) - - + Полициклические ароматические углеводороды Нафталин (С10) + + Фенантрен (С14) + + + Антрацен (С14) н.о. + + Примечание: + наличие роста; – отсутствие роста, н.о. – не определяли, +* слабый рост 3.2.2. Исследование биодеструкции нефтепродуктов штаммами Acinetobacter в водной среде в лабораторном эксперименте Исследование углеводородокисляющей активности штаммов в жидкой среде проводили в сравнении с контрольной пробой, не содержащей клеток микроорганизмов (рис. 3).

Рис. 3. Деструкция нефти штаммом A.radioresistens В-50в лабораторном опыте.

1 – опыт (+бактерии), 2 – контроль (без бактерий) 1 Степень деградации сырой нефти штаммами Acinetobacter составила 80-94 % за 20 дней при концентрации белка 40-50 мг/л. Наибольшую активность продемонстрировали штаммы В-2838 и В-5064.

3.2.3. Исследование биодеградации нефтепродуктов штаммами Acinetobacter в условиях лабораторного почвенного опыта Лабораторные опыты проводили с добавлением сырой нефти и бензина в почву.

В качестве контроля использовали почву, загрязненную нефтепродуктами, не зараженную бактериями. Концентрацию нефтепродуктов измеряли в динамике в течение 40 дней. Результаты экспериментов представлены в табл. 2. Степень деградации нефтепродуктов составила от 40,3 до 99,7 %.

Таблица Степень деградации нефтепродуктов в почве в лабораторном опыте исследуемыми штаммами Acinetobacter Вид Численность Содержание Степень Штамм нефте- клеток, нефтепродуктов, мг/кг деструкции, бактерий продукта КОЕ/г почвы % начальное конечное A. calcoaceticus нефть 31010 4477,1 2671,1 40,В-3780 бензин 2,71010 1233,9 343,5 72,A. radioresistens нефть 1,81010 3468,1 1828,1 47,В-2838 бензин 3,11010 514,05 1,6 99,A. radioresistens нефть 4,51010 3468,1 915,8 73,В-5064 бензин 4,61010 514,05 94,8 81,Полученные результаты свидетельствуют о высокой углеводородокисляющей активности исследованных штаммов в условиях лабораторного эксперимента. Было установлено, что из трех изученных штаммов, штамм A. radioresistens В-50проявлял наибольшую эффективность в отношении окисления нефти, штамм A.

radioresistens В-2838 был наиболее эффективным в отношении окисления бензина.

3.2.4. Исследование биодеградации нефтепродуктов при интродукции штамма A. radioresistens В-2838 в условиях вегетационного опыта При постановке вегетационного опыта по деструкции нефтепродуктов в модельной системе использовали штамм A. radioresistens В-2838, поскольку он наиболее эффективно окислял бензин (деструкция составила 100 %) в лабораторном опыте. В ходе культивирования в течение 40 дней деструкция дизельного топлива A.

radioresistens B-2838 составила 39 %, бензина – 46,5 %, отработанного масла – 59 %.

3.2.5. Последовательное и одновременное внесение культур Для обоснования использования консорциума, состоящего из трех культур для деструкции нефтепродуктов в почве, был поставлен эксперимент по последовательному и одновременному внесению культур.

Наиболее эффективным оказалось одновременное внесение трех культур – степень деструкции нефтепродуктов составила 35 % за 28 дней, тогда как при последовательном внесении – 10,5 % за 28 дней (рис. 4). Одновременное внесение культур, возможно, способствует проявлению синергизма у трех штаммов (В-3780, В5064, В-2838) в отношении деструкции нефтепродуктов.

Рис. 4. Динамика окисления нефтепродуктов в лабораторном опыте.

1 – одновременное внесение культур: A. calcoaceticus В-3780 + A. radioresistens В-2838 + A. radioresistens В-5064, 2 – последовательное внесение культур.

3.2.6. Влияние степени нефтяного загрязнения почвы на интенсивность деструкции нефтепродуктов По литературным данным известно, что оптимальным для биодеструкции нефтепродуктов в почве является содержание их около 3-5 %. В связи с этим нами были проведены исследования скорости деструкции НП исследуемыми штаммами рода Acinetobacter при загрязнении почвы нефтепродуктами в количестве 10 % по массе. В качестве поллютанта использовали отработанное масло. В почву дополнительно вносили древесные опилки в качестве адсорбента-структуратора. В течение двух недель скорость деструкции оказалась высокой и составила 39,5 % что соответствует 30 г нефтепродуктов на кг почвы (рис. 5).

Рис. 5. Динамика окисления отработанного масла штаммами A. calcoaceticus В - 3780, A. radioresistens В-2838, В-50в лабораторном эксперименте.

3.2.7. Исследование биодеградации нефтепродуктов в условиях микрополевого опыта При постановке эксперимента по деструкции нефтепродуктов в микрополевом опыте использовали все три штамма (A. calcoaceticus В-3780 и A. radioresistens В-2838, B-5064). В ходе культивирования в течение 60 дней деструкция нефтепродуктов в системе «почва+отработанное масло» составила 8,83 %, в системе «почва+масло+опилки» – 14,35 %, а в системах «почва+масло+ бактерии» и «почва+масло+опилки+бактерии» – 48,37 % и 20,98 %, соответственно (рис. 6).

Вероятно, более низкая степень деградации нефти в системе «почва+масло+опилки+бактерии» связана с недостатком источника азота вследствие конкуренции за азот между целлюлозолитиками входящими в состав аборигенной микрофлоры и интродуцированными штаммами Acinetobacter.

Рис. 6. Изменение содержания общих нефтепродуктов (г/кг почвы) в ходе микрополевого опыта.

1 – почва без воздействия, 2 – система «масло», 3 – система «масло+бактерии», 4 – система «масло+опилки», 5 – система «масло +опилки + бактерии» 3.2.8. Ферментативная активность почвы в процессе биоремедиации Внутри почвенного профиля главная роль в окислении нефти и нефтепродуктов принадлежит биологическому окислению, которое осуществляется в результате ферментативных реакций. Для определения изменения биологической активности почвы в процессе биоремедиации часто используют показатели пероксидазной и полифенолоксидазной активности. Пероксидаза (ПО) принимает участие в окислительно-восстановительных процессах в почве. Ее влияние направлено на окисление гумусовых веществ. Полифенолоксидазы (ПФО) участвуют в превращении органических соединений ароматического ряда в компоненты гумуса.

Исследования по изучению ферментативных свойств нефтезагрязненной почвы мы проводили с образцами из микрополевого опыта (табл.3). В первые 15 дней наблюдалось увеличение активности пероксидазы и полифенолоксидазы, в последующие дни активность пероксидазы начала стабилизироваться, а активность полифенолоксидазы стала снижаться.

Коэффициент гумификации – это величина, выражающая отношение активности ПФО к активности ПО и позволяющая судить о преобладании катализируемых процессов.

В системе «почва+отработанное масло» и «почва+масло+опилки» наблюдалось резкое уменьшение коэффициента гумификации, что свидетельствует о преобладании процесса окисления гумусовых веществ над процессом гумификации почвы и о снижении качества почвы в связи с ее загрязнением. В системе «почва+масло+бактерии» падение коэффициента гумификации замедлялось после внесения живой культуры углеводородразлагающих бактерий, но по мере отмирания клеток падение коэффициента гумификации возобновлялось в связи с присутствием в почве остаточных нефтепродуктов, тогда как в системе «почва+масло+опилки+бактерии» за 35 суток нам не удалось обнаружить падение коэффициета гумификации.

Таблица Динамика пероксидазной и полифенолоксидазной активности в процессе ремедиации в микрополевом эксперименте Активность (мг пурпургаллина /г почвы за 24 часа) Участки Ферменты Время (сут.) 7 14 21 ПО 0,75 0,99 1,05 0,ПФО 0,81 1,26 1,05 0,Почва Падение коэффициента - 0 7 гумификации, % ПО 0,27 0,9 1,2 1,ПФО 0,51 1,11 1,08 0,Масло Падение коэффициента - 35 52 гумификации, % ПО 0,3 1,11 1,05 1,Почва+масло+ ПФО 0,39 1,08 1,05 0,бактерии Падение коэффициента - 25 27 гумификации, % ПО 0,24 0,66 0,72 1,Почва+масло+ ПФО 0,51 0,78 0,87 0,опилки Падение коэффициента - 44 43 гумификации, % ПО 0,63 0,78 1,08 0,Почва+масло+ ПФО 0,42 0,93 0,99 0,опилки+бактерии Падение коэффициента - 0 0 гумификации, % Примечание: при расчете падения коэффициента гумификации за 100 % брали коэффициент гумификации через 7 дней опыта.

3.2.9. Исследование влияния диазотрофов на биодеградацию нефтепродуктов Учитывая возможность конкуренции между нефтедеструкторами и целлюлозолитиками за источники азота (раздел 3.2.7), нами был поставлен лабораторный опыт по изучению влияния присутствия диазотрофов в системе на эффективность биоремедиации. В качестве представителя диазотрофов мы использовали штамм Azospirillum doebereinerae 13131T, а в качестве нефтедеструкторов все три исследуемых штамма. Почву инокулировали, создавая стартовую концентрацию нефтедеструкторов в диапазоне 108-1010 кл/г почвы. Во все варианты опыта были добавлены опилки в качестве структурообразующего компонента и субстрата для целлюлозолитических бактерий. В ходе эксперимента в течение 28 дней наблюдалось значительное ускорение окисления нефти в системе с добавлением диазотрофов ( в 1,6 раза). Изменение концентрации НП в почве составило 1,74 г/кг почвы в случае внесения культур Acinetobacter и 2,75 г/кг почвы в случае внесения культур Acinetobacter и Azospirillum doebereinerae (рис. 7).

Рис. 7. Динамика окисления нефти в ходе лабораторного опыта при добавлении диазотрофов.

1 – загрязненная нефтью почва+ опилки;

2 – загрязненная нефтью почва + опилки + 3 штамма Acinetobacter;

3 – загрязненная нефтью почва + опилки + 3 штамма Acinetobacter + A. doebereinerae Cут.

Такое ускорение биодеструкции объясняется способностью диазотрофов к фиксации азота и накоплению его в более доступной форме для штаммовнефтедеструкторов, что позволяет им эффективно конкурировать с аборигенной микрофлорой почвы.

3.3. Исследование биоПАВ, продуцируемых A. calcoaceticus B-3780, A. radioresistens B-2838, B-503.3.1. Выделение биосурфактантов, продуцируемых штаммами B-3780, B-2838 и B-50При исследовании способности у штаммов B-3780, B-2838 и B-50продуцировать биоПАВ было установлено, что по отношению к гексадекану исследуемые штаммы проявляют эмульгирующую активность – при культивировании в среде через 5-7 дней образовывалась эмульсия гексадекана. Нами были получены бисурфактанты всех исследуемых культур в количестве 3-5 мл/л среды, при этом прирост белка составил 64 мг/л. Полученные биоПАВ представляли собой белую маслянистую субстанцию, плохо растворимую в воде.

3.3.2. Изучение адсорбционных свойств новых ПАВ-биопродуктов с целью их применения для очистки от нефтезагрязнений 3.3.2.1. Поверхностно-активные свойства биосурфактантов на границе раздела «раствор - воздух» Для оценки поверхностно-активных свойств сурфактантов необходимо определить их важнейшие характеристики, такие как поверхностная активность (G), предельная адсорбция (А) и параметр адсорбционного слоя – молекулярная площадка (Sm).

Поверхностная активность. По Ребиндеру (Вережников, 1984) поверхностная активность численно равна отрицательной производной поверхностного натяжения раствора по концентрации растворенного вещества С (при значениях концентрации стремящихся к нулю): G = limc0(-d/dC). Величину поверхностного натяжения растворов ПАВ экспериментально определяли сталагмометрическим методом. Для определения поверхностной активности строили график зависимости поверхностного натяжения () от концентрации растворов (рис. 8). Поверхностная активность ПАВ, продуцируемого штаммом В-3780, оказалась в 14-15 раз выше, чем таковая у ПАВ двух других штаммов, что свидетельствует о большей гидрофобности этого сурфактанта. Причиной этого различия может быть большее значение его молекулярной массы из-за большей длины углеводородного радикала.

Рис.8. Изотермы поверхностного натяжения биосурфактантов.

1 1 - штамм В-3780;

2- штамм В-2838;

3- штамм В-5064.

Как известно, биосурфактанты по величинам поверхностной активности значительно отличаются от дифильных низкомолекулярных эмульгаторов. В нашем случае, биосурфактант штамма В-3780 примерно в 1000 раз более поверхностноактивен, чем типичное низкомолекулярное ПАВ – додецилсульфат натрия (ДДС) (табл. 4).

Таблица Максимальная поверхностная активность, предельная адсорбция, величина молекулярной площадки и минимальное поверхностное натяжение сурфактантов и низкомолекулярного ПАВ на границе раздела «раствор - воздух» Образец G·106, Дж·м/моль А, моль/ м2 Sm, нм2 min,мН/м В-3780 13,75 2,6·10-6 0,64 52,В-5064 0,92 1,2 ·10-6 1,38 61,В-2838 0,90 1,7 ·10-6 0,98 58,Додецилсульфат натрия 0,014 4,8 ·10-6 0,35 32,Изотермы адсорбции. Предельная адсорбция и молекулярные площадки биоПАВ. Для определения предельной адсорбции (А) для всех трех штаммов воспользовались данными, найденными для построения изотерм адсорбции по уравнению Ленгмюра: A = АКС/(1+КС).

Величины площади молекулы (Sm) находили по формуле: Sm = 1/А · N для всех биоПАВ. БиоПАВ штамма В-3780 имело самое маленькое значение молекулярной площадки – 0,64 нм, тогда как эта величина для сурфактантов штаммов В-5064 и В2838 была равна 1,38 и 0,98 нм, соответственно (табл. 4). Известно, что чем меньше значения молекулярной площадки, тем более гидрофобным является биоПАВ (Абрамзон, 1981; Плетнев, 2002; Вережников, 1984). Cогласно выше сказанному, БиоПАВ штамма В-3780 имеет более гидрофобный характер по сравнению с биосурфактантами штаммов В-5064 и В-2838. Предельная адсорбция (А) биоПАВ штамма В-3780 в 1,5 раза превышала аналогичные величины для В-5064 и В-28(табл. 4), что согласуется с видом изотерм адсорбции (рис. 9). Из данных табл. следует, что выделенные биоПАВ штаммов В-5064 и В-2838 имеют близкие значения Поверхностное натяжение, мДж/м А и Sm и, следовательно, могут быть гомологами. Величина поверхностной активности ПАВ, продуцируемого штаммом В-3780, значительно выше, чем таковая у ПАВ двух других штаммов, что является дополнительным подтверждением вывода о большей гидрофобности сурфактанта этого штамма Рис. 9. Изотермы адсорбции для исследуемых биоПАВ 1 – штамм В-3780, 2 – штамм В-2838, 3 – штамм В-5064.

3.3.2.2. Поверхностно-активные свойства биосурфактантов на границе раздела «жидкость-жидкость» Экспериментально в нашей работе для оценки поверхностной активности ПАВ при адсорбции из воды и углеводорода измеряли межфазное натяжение на границе раздела «вода - петролейный эфир», при равновесном распределении ПАВ между фазами (Абрамзон, 1981). Определив равновесные концентрации ПАВ в каждой фазе, строили изотермы межфазного натяжения, находили поверхностную активность (G) ПАВ в каждой из фаз и рассчитывали работу адсорбции ПАВ из воды и петролейного эфира. В качестве ПАВ использовали биосурфактанты. Анализ полученных изотерм (рис. 10, 11) показал заметное отличие в поведении биоПАВ штамма В-3780 по сравнению с двумя другими штаммами. БиоПАВ штамма В-3780 резко снижает межфазное натяжение при адсорбции в обеих фазах.

Рис. 10. Изотермы межфазного натяжения при адсорбции биоПАВ с границы раздела в воду 12 = f (С В) 1-штамм В-5064, 2- штамм В-3780, 3- штамм В-28Рис. 11. Изотермы межфазного натяжения при адсорбции биоПАВ в петролейный эфир 12 = f (С м) 1-штамм В-5064, 2- штамм В-3780, 3- штамм В-28А, моль/м Вид кривых рис. 10 и 11 подтверждает сделанные ранее выводы относительно различия поверхностных активностей трех штаммов на основе изотерм поверхностного натяжения на границе раздела «раствор-воздух» - биоПАВ штамма В3780 является более гидрофобным по сравнению с биоПАВ штаммов В-5064 и В-2838.

3.3.2.3. Определение эмульгирующей активности Для оценки эмульгирующей активности биоПАВ Acinetobacter calcoaceticus B3780 и A. radioresistens В-2838 и В-5064 в качестве субстрата использовали гексадекан или вазелиновое масло в воде в объемном соотношении 1:1. В качестве контроля использовали смесь гексадекана (вазелинового масла) в воде без добавления биоПАВ.

При обработке ультразвуком в контрольных образцах через 24 ч количество эмульсии снижалось до 12,5 % (в случае с гексадеканом это составило 20 % от исходного, а с вазелиновым маслом – 50 %). При добавлении сурфактанта A.

calcoaceticus B-3780 – эмульсия гексадекана и вазелинового масла в воде составила 62,5 (100 % от исходного) и 50 % (67 % от исходного), соответственно. Было установлено, что сформированная с использованием нового биоПАВ штамма A.

calcoaceticus B-3780 эмульсия сохранялась после 24 час. без дальнейшего расслоения.

3.3.4. Технологическое применение ПАВ-биопродукта штамма В-3780 и консорциума штаммов бактерий рода Acinetobacter 3.3.4.1. Применение биоПАВ для диспергирования нефти Нами было показано, что полученные ПАВ-биопродукты способствуют диспергированию нефти и отработанного масла в воде (рис. 12), что также позволяет рекомендовать их к применению для снижения поверхностного и межфазного натяжения.

Рис. 12. Диспергирование отработанного масла биосурфактантом, выделенным из A. calcoaceticus B-37А – контроль (без ПАВ), Б – после обработки биосурфактантом 3.3.4.2. Применение биоПАВ для очистки загрязненных нефтью емкостей Новый ПАВ-биопродукт, полученный из A. calcoaceticus В-3780 был апробирован для очистки загрязненных нефтью емкостей. Нами использовался раствор сурфактанта в воде с конечной концентрацией 1 и 2 %. Выделенное биоПАВ продемонстрировало высокую эффективность очистки поверхности от нефтяного загрязнения при концентрации 2 % (рис. 13).

Рис. 13. Емкости с остаточной нефтью.

1- контроль (без ПАВ), 2 и 3 - после обработки биопродуктом A.

calcoaceticus В-3780, 2 - нефть+1 %-ный раствор биоПАВ, 3- нефть+2 %-ный раствор биоПАВ 3.3.4.3. Применение биоПАВ для десорбции нефти с грунта При исследовании десорбции нефти с песка было установлено, что она происходит под действием ПАВ-биопродукта. По всей вероятности, биоПАВ адсорбируется на песке, пропитанном нефтью. При этом происходит снижение межфазного натяжения между водой и нефтью и между нефтью и песком и вытеснение нефти с песка водой в виде тонкой пленки.

Суспензии клеток в культуральной жидкости всех исследуемых штаммов также проявляли способность к десорбции нефти, но в меньшей степени, чем ПАВбиопродукт штамма В-3780. В нашем опыте наибольшая степень десорбции была зафиксирована при сочетании сПАВ и биоПАВ штамма В-3780, что согласуется с литературными данными (рис. 14).

Рис. 14. Десорбция нефти с песка.

1-песок+НП, 2-песок+НП+биоПАВ, 3-песок+НП+синтетическое ПАВ (cПАВ), 4- песок+НП+биоПАВ+cПАВ, 5- песок+НП+суспензия клеток В-3780, 6- песок+НП+ суспензия клеток В-5064, 1 2 3 4 5 6 7- песок+НП+ суспензия клеток В-283.3.4.4. Применение консорциума штаммов Acinetobacter на полигоне твердых бытовых отходов (ЗАО «Воронеж-ТБО) Почва на полигоне характеризуется как тяжелая, глинистая. Опыт проводился в осеннее время, при температуре 12-15 °С. В качестве полютантов использовали дизельное топливо, бензин, отработанное масло в количестве 70-100 г/кг. В течение месяца концентрация НП снизилась на 1-20 г.

3.3.4.5. Применение консорциума штаммов Acinetobacter B-3780, B-2838, B5064 для деструкции углеводородов в сточной воде Воронежского тепловозоремонтного завода им. Ф.Э. Дзержинского Сточные воды тепловозоремонтного завода характеризуются повышенным содержанием нефтепродуктов в связи с полным отсутствием локальных очистных сооружений. Нами был проведен лабораторный эксперимент по деструкции НП исследованными штаммами. В качестве субстрата использовали сточную жидкость, отобранную перед ее сбросом в городские очистные сооружения. Для опыта использовали консорциум из трех штаммов: В-3780, В- 2838 и В-5064. Исходная концентрация нефтепродуктов составила 129 мг/л. В результате за 10 дней эксперимента удалось обнаружить лишь следовые количества НП. Таким образом, произошло практически полное удаление нефтепродуктов, что делает возможным рекомендовать применение микробиологического способа очистки сточной воды в данных условиях на последней стадии локальной очистки перед сбросом стоков в городские очистные сооружения.

В качестве рекомендации по применению консорциума бактерий рода Acinetobacter в данных условиях можно предложить следующую схему очистки сточных вод от нефтепродуктов (рис. 15).

Откачивание слоя Утилизация в соответствии с нефтепродуктов ГОСТ 21046-86Городские очистные Вторичные Первичный сооружения отстойники отстойник Обработка остаточных НП в сточной воде консорциумом бактерий Acinetobacter Концентрация НП Рис. 15. Гипотетическая схема очистки сточных вод Воронежского тепловозоремонтного завода им. Ф.Э. Дзержинского с применением консорциума микроорганизмов-нефтедеструкторов.

ЗАКЛЮЧЕНИЕ В настоящее время резко обострились проблемы, связанные с загрязнением почвенных ресурсов нефтью и продуктами ее переработки.

Одним из путей решения данной проблемы является разработка наиболее приемлемых путей очистки нефтяных загрязнений, основанных на применении ассоциации микроорганизмов.

Многочисленными исследованиями показано, что бактерии разных таксономических групп разрушают определенные компоненты нефтяного загрязнения.

Благодаря их деятельности нефть трансформируется до простых соединений, происходит накопление нового органического вещества и дальнейшее включение его в круговорот углерода.

В настоящей работе предпринята попытка подбора углеводородокисляющих штаммов для создания эффективного консорциума, осуществляющего деструкцию нефти и нефтепродуктов в почве и для эмульгирования и снижения вязкости нефти.

Для разработки консорциума были исследованы три малоизученных штамма рода Acinetobacter (B-2838, B-5064 и B-3780), полученные из Всероссийской коллекции промышленных микроорганизмов ФГУП ГосНИИГенетика. Полученные из коллекции штаммы бактерий рода Acinetobacter были подвергнуты полифазному анализу, включающему сравнительный анализ морфологических, физиологобиохимических и филогенетических признаков. В результате было установлено, что штамм В-3780, депонированный как Acinetobacter sp., принадлежит к виду A.

calcoaceticus, а штаммы В-2838 и В-5064, депонированные как A. «calcoaceticus» – к виду A. radioresistens.

Проведенные исследования показали, что данные штаммы микроорганизмов рода Acinetobacter эффективны в отношении деструкции отдельных углеводородов: они окисляют нециклические, циклические и ароматические компоненты нефти.

Исследованные штаммы были высокоэффективны по отношению к нефтепродуктам в почве в условиях лабораторного, вегетационного и микрополевого опытов.

В ходе исследования была установлена избирательность штаммов по отношению к нефтепродуктам: из трех изученных штаммов, штамм Acinetobacter radioresistens В5064 проявлял наибольшую эффективность в отношении окисления нефти, штамм A.

radioresistens В-2838 был наиболее эффективным в отношении бензина. Также нами было показано, что после интродукции в нефтезагрязненную почву живой культуры исследуемого консорциума наблюдается уменьшение снижения коэффициента гумификации, что свидетельствует о положительной направленности гумусообразования, способствующего повышению плодородия почвы. Таким образом, применение консорциума трех исследуемых штаммов в составе биопрепарата позволит повысить эффективность процесса биоремедиации почв Воронежской области.

Получены биоПАВ всех исследованных штаммов и исследованы их поверхностно-активные свойства. Установлено, что поверхностная активность биосурфактанта штамма A. calcoaceticus B-3780 на порядок выше по сравнению с биоПАВ двух других штаммов, что свидетельствует о его большей гидрофобности, а, следовательно, и большей эффективности. Выделенный ПАВ-биопродукт продемонстрировал высокую эффективность очистки технологических емкостей от нефтепродуктов, эмульгирования нефти, десорбции нефти с песка.

Таким образом, проведённые нами исследования позволяют разработать основы эффективной технологии биоремедиации нефтезагрязнённых объектов при помощи консорциума штаммов A. calcoaceticus и A. radioresistens.

ВЫВОДЫ 1. На основе полифазного анализа, включающего морфологические, культуральные, физиолого-биохимические и филогенетические характеристики, был установлен видовой статус бактерий Acinetobacter sp. В-5064, В-2838 и B-3780, полученных из Всероссийской коллекции промышленных микроорганизмов ФГУП ГосНИИГенетика: штамм В-3780 отнесен к виду Acinetobacter calcoaceticus, а штаммы B-2838 и B-5064 – к виду Acinetobacter radioresistens.

2. Показана высокая углеводородокисляющая активность и выявлена неоднородность штаммов в отношении деструкции нефтепродуктов: A. radioresistens В-5064 – степень деструкции нефти 74 %, бензина – 81,6 %, A. radioresistens В-2838 – степень деструкции нефти 47,3 %, бензина – 99 %, A. calcoaceticus В-3780 – степень деструкции нефти 40 %, бензина – 72 %.

3. Выявлена способность исследуемых штаммов Acinetobacter к образованию биосурфактанта. Поверхностно-активные свойства биоПАВ штамма A. calcoaceticus В-3780 (выход 3-5 мл/л) значительно отличаются от аналогичных свойств двух других ПАВ. БиоПАВ штамма В-3780 имеет самое маленькое значение молекулярной площадки (Sm = 0,64 нм), а предельная адсорбция (А) биоПАВ штамма В-3780 в 1,раза превышает аналогичные величины для В-5064 и В-2838. Установлено, что ПАВ A. calcoaceticus В-3780 обладает высокой поверхностной активностью – в 14-15 раз превышает таковые для двух других штаммов на границе раздела «вода-воздух», и в 740 раз на границе раздела «вода-петролейный эфир», что свидетельствует о большей гидрофобности сурфактанта штамма В-3780.

4. Показано, что ПАВ-биопродукты штаммов Acinetobacter можно применять для очистки технологических емкостей от нефтепродуктов, эмульгирования нефти.

Биопродукт Acinetobacter calcoaceticus В-3780 перспективен для десорбции нефти с песка, что можно использовать для биоремедиации песчаных площадок при нефтеразливах.

5. Доказана эффективность консорциума из 3 штаммов Acinetobacter в очистке почвы, загрязненной отработанным маслом (степень загрязнения 15-20 г НП /кг почвы). Деструкция отработанного масла в микрополевом опыте за 2 месяца составила 48,4 %. При деградации нефтепродуктов с участием консорциума общая численность микроорганизмов возрастала на 2 порядка, а падение коэффициента гумификации замедлялось на 20 % или полностью прекращалось, что свидетельствует о положительной направленности гумусообразования, способствующего повышению плодородия почвы.

6. Обоснована возможность использования нового консорциума данных штаммов в составе биопрепарата: основная роль Acinetobacter radioresistens – ферментативное окисление нефтепродуктов (штамм В-5064 эффективно окисляет нефть, штамм В-28– бензин), A. calcoaceticus В-3780 продуцирует эффективный биосурфактант.

Одновременное внесение культур способствует проявлению синергизма у трех штаммов (В-3780, В-5064, В-2838) в отношении деструкции нефтепродуктов.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ РАБОТЫ 1. Логинова О.О., Гриднева Е.В., Шалимова С.С., Шевченко М.Ю., Данг Т.Т., Грабович М.Ю. Биодеградация нефтепродуктов в почве штаммами микроорганизмов рода Acinetobacter: A. calcoaceticus 134 (B-3780), ACKS-1 (B-2838) Acinetobacter valentis (B-5064) // Межрегиональный сборник научных работ «Организация и регуляция физиологио-биохимических процессов». Воронеж: ВГУ, 2010. – Вып.12. – С. 129-136.

2. Данг T.T., О.О. Логинова, Е.В. Белоусова, М.Ю. Грабович, М.Ю. Шевченко.

Перспективы использования бактерий рода Acinetobacter для деградации почвенных нефтяных загрязнений // Проблемы региональной экологии. – 2011. – Вып. 4, С. 202- 208.

3. Данг Т.Т., Логинова О. О., Белоусова Е. В., Шевченко М. Ю., Грабович М. Ю.

Консорциум штаммов бактерий-нефтедеструкторов рода Аcinetobacter для биоремедиации нефтезагрязненных почв // Вестник Уральской медицинской академической науки. – 2011. – № 4 /1. – С. 170-171.

4. Логинова О.О., Данг Т.Т., Белоусова Е.В., Грабович М.Ю. Использование штаммов рода Acinetobacter для биоремедиации нефтезагрязненных почв на территории Воронежской области // Вестник Воронежского государственного университета. Химия. Биология. Фармация. – 2011. – №2. – C. 127-15. Данг Т.Т., Пояркова Т.Н., Логинова О.О., Вязникова О. С., Белоусова Е.В., Шевченко, Грабович М.Ю.. Поверхностно-активные свойства сурфактантов, полученных из М.Ю. представителей консорциума нефтедеструкторов, состоящего из Acinetobacter radioresistens штамм BCБ-567 (В-5064), штамм ACKS-1(В-2838) и A.

calcoaceticus штамм 134 (В-3780) // Экология урбанизированных территорий. – 2011. – №4. – C. 41-44.

6. Логинова О.О., Белоусова Е.В., Данг Т.Т. Биодеградация нефтепродуктов штаммами микроорганизмов рода Аcinetobacter // Материалы 15-ой международной молодежной конференции «Биология – наука XXI века». – Пущино (18-22 апреля). – 2011. – С. 364-365.

7. Данг T.T., Логинова О. О., Белоусова E. В. Разработка и применение консорциума бактерий – нефтедеструкторов рода Асinetobacter для биоремедиации супесчаных почв Воронежской области // Материалы XVI международной экологической студенческой конференции «Экология России и сопредельных территорий». – Новосибирск. – 2011. – C. 222-223.

8. Данг Т.Т., Вязникова О.С., Пояркова Т.Н., Грабович М.Ю., Белоусова Е.В.

Поверхностно-активные свойства сурфактантов, полученных с помощью бактерийнефтедеструкторов Aсinetobacter radioresistens и A.calcoaceticus // Материалы VIII научно-практической экологической конференции. – Воронеж. – 2012. – С. 23-25.

Статьи № 2-5 опубликованы в печатных изданиях, состоящих в списке журналов, рекомендованных ВАК РФ.







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.