WWW.DISSERS.RU


...
    !

 >> 
B B -RAS :

: 14.01.12 03.01.04 B - 2012 - ..

:

, , :

, , B - . . .. _13_ ____ 2012. 14.00 208.052.01 - .. (197758, -, , .

, .68).

. .. 197758, -, , . , 68, www.niioncologii.ru .

_10_ _____ 2012 , () : 1 .

200 . 700 . [Cancer incidence, 2007]. 2010 142 570 [Jemal A. et al., 2010]. 2007 . 54 738, 2008 2666 [ , 2007; .., 2010]. 9-14% . (10%), (10,6%), [ .., 2007; .. ., 2007;

Jemal A. et al., 2010]. -, 2005 ., , , 19% 2007 .

[ .., 2007, 2008].

. , - 10-20 , , , . .

, , , . K-ras. 80- XX ras , , K-ras [Vogelstein B. et al., 1988]. 1990 . Fearon Vogelstein , K-ras, , . [Fearon E., Vogelstein B., 1990].

K-ras . , , K-ras (epidermal growth factor receptor, EGFR) [Van Cutsem E. et al., 2008]. , K-ras K-ras , EGFR. Kras EGFR, .

K-ras , , 30 50% [Andreyev H. et al., 1998, Brink M. et al., 2003, Hsieh J.S. et al., 2005, Kaji E. et al., 2011]. K-ras [ .., 2000]. K-ras [Breivik J. et al., 1994, Arber N. et al., 2000, Krtolica K. et al., 2007, Yuan Y. et al., 2010]. K-ras [Diergaarde B., 2003], . - , [Schimanski C. et al., 1999, Frattini M. et al., 2004, Lchtenborg M. et al., 2005]. K-ras [Conlin A. et al., 2005; Roth A.D. et al., 2009].

, K-ras .

:

1. K-ras .

2. .

3. ( ) K-ras .

4. K-ras .

5. K-ras .

6. K-ras .

, 1. K-ras.

2. K-ras .

3. 13 K-ras.

4. K-ras , .

5. K-ras .

(207 ) K-ras .

13 K-ras.

13 ( ).

K-ras .

, K-ras K-ras.

K-ras ( 40%) K-ras , , , . , K-ras EGFR, . - .

13 K-ras 13 , , . 13 , .

. . .. .

:

150 , , , . 22 , 47 . 146 .

:

. . .. (-, 2011), - 2011 (-, 2011), (, 2011), XI (, 2011).

M K-ras .

- 317 , . .. 2005-2006 . 2. 212 , , 207 . , , . . 17 , . 19 , . , , : , , , , , , , , . , , TNM, , , , .

K-ras 207 . 212 196 , 11 - , 5 . , , .

199 7- TNM (AJCC Cancer Staging Handbook. Seventh Edition, 2010). : 5 (2.5%) in situ ( 0), 31 (15.6%) I, 68 (34.2%) II, 46 (23.1%) III 49 (24.6%) IV. (Pathology and Genetics of Tumours of the Digestive System, 2000).

53 77 . 152 . , , , . , , - ( ..., . .. ).

15 . , 40% . . , , , . .

K-ras 5 . 96% 2 .

(10 Tris-HCl (pH=8.0), 0.1 ; pH=8.0, 2% ) (20 /). 60 8-16 . - . 0,3 (24:1). 15000 g 20 .

() , 0,1 3 Na (pH=4.0), 0,3 . 15000g 20 . C .

(20 /) - . -20 . 15000 g 30 . , 70% 10 . 40, 30 65 10 .

-20 ().

- , 12, 13, 61 146 K-ras, . - 20 . : 1 ; 0,5 -; (pH 8.3); 2,5 MgCl2; 200 (dATP, dCTP, dGTP, dTTP); 0,3 ; Eva Green I (20X ).

, K-ras ( ) KRAS1F AATGACTGAATATAAACTTGTG 1G KRAS1R CAAGATTTACCTCTATTGTTGG M13-KRASc61F TGTAAAACGACGGCCAGTACCT 1GTCTCTTGGATATTCTC M13-KRASc61R AGCGGATAACAATTTCACACAG GTACTGGTCCCTCATTGCAC KRASc146F GTAGACACAAAACAGGCTCAG 1KRASc146R TGTATTTATTTCAGTGTTACTTAC Taq- 95 10 . 40 - 45 ( 95 15 ), ( 60 30 ) ( 72 60 ). (high-resolution melting, HRM) CFX96 (Bio-Rad, USA) RotorGene 6000 (Corbett Research, Australia) 0,1 72 92. .

- PCR-Clean-up kit (Axygen, USA). 5 , 3 DTCS mix (Beckman Coulter, USA), 1 5- TCATTATTTTTATTATAAGGCCTGCTGAA-3 ( ) 20 . GenomeLab DTCS Quick Start Kit (Beckman Coulter, USA) . 40 SLS (Sample Loading Solution, Beckman Coulter, USA) CEQ 8000 (Beckman Coulter, USA).

: Statistica for Windows 8.0 - , MS Office 2007 , .

. : ; -; U- - (Mann-Whitney U Test);

(Wilcoxon Matched Pairs Test). , , , ;

- (Pearson Chi-square), (Fisher exact test). ANOVA Kruskal-Wallis H-test. R. , , . , , , [ .., 2003; .. ., 2005;

.., 2010].

212 (196 , 5 , 11 ) 207 K-ras. 77 . , , 12. , . K-ras 12 146. - , 2 . K-ras 12 146, 12 Kras.

, 207 K-ras 79 , K-ras 38,2%. , , , , K-ras [Andreyev H.J. et al., 1998; Andreyev H.J. et al., 2001]. , , , , 38,2% - .

196 K-ras 72 (36,7%). K-ras (40,0%), . 8 11 (72,7%). . K-ras , .

82 K-ras 12 51 (62,2%). 13 23 (28,0%). 61 1 ( 4,9% ). (.2).

K-ras N % 12 G>C 3/212 1, G>T 17/212 8, G>T 11/212 5, G>A 18/212 8, G>A 2/212 0,13 G>A 1/212 0, G>A 22/212 10,61 G>C 2/212 0, A>T 2/212 0,146 >T 1/212 0, G>A 2/212 0, G>T 1/212 0, K-ras , K-ras 49 115 30 . 42,6%, 32,6% (p=0,08). 35 12, 30,4% , 11 - 13 (9,6%), 61 (0,9%), 2 146 (1,7%). 12 14 , 13 12 , 61 - , 146 (15,2%, 13,0%, 3,3% 1,1% , ). , (30,4% 15,2%, , p<0,01). .

, , 63,311,1 . K-ras 62,710,9 64,111,4 , , p=0.39. , (.1).

.1. K-ras 80 ( ). 40 : 4 7 . 40 80 K-ras 70 194 (36,1%), .. . , 40 80 , K-ras .

77 207 (37,2%); K-ras 26 (33,8%). 53 130 (40,8%), (p>0,05). , K-ras .

K-ras K-ras , K-ras [Diergaarde B., 2003]. , 205 207 . 48 (23,4%), 1 (76,6%). K-ras 17 (35,4% 39,5%, ). 79 21,5%. 24,6%.

K-ras (. 3).

K-ras n % N % n % 12 5 29,4 44 71,0 49 62,13 10 58,8 13 21,0 23 28,61 1 5,9 3 4,8 4 4,146 1 5,9 2 3,2 3 4, 17 100,0 62 59,3 79 100, , 12 . 13 , (p=0,02, . 2).

, , 10 23 (43,5%). , 13 K-ras.

1,0, 60,5% 61,8% 64,6% 146 0,61 13 1,3% 1,4% 0,2,1% 1,9% 1,9% 8,3% 12 2,1% 11,1% 20,8% 0,28,0% 23,7% 10,4% . 2. K-ras 206 . 32 (15,5%).

- 11 32 (34,4%), (25,0%), (15,6%), (9,4%) (6,3%). (9,4%) .

32 K-ras, 43,8%. 174 65 , 37,4%.

K-ras (p>0,05).

Kras 7 12 7 13, 21,9% , .

61 146 . , , 42 12, 16 13, 4 61 3 146. 24,1%, 9,2%, 2,3% 1,7%, (.3).

. 3. K-ras , , , , 13 K-ras (p=0,06) (p=0,03).

K-ras c K-ras , , 97 (46,9%), 110 (53,1%). K-ras . (32,0%), 66 (68,0%). 110 , 43,6% (p=0,08).

K-ras , . 74 80 K-ras.

, K-ras c 45 12, 19 13, 61 146 (. 4). , , 27 (33,3%), 12 31 (38,7%) 17 34 (50,0%).

. 4. K-ras , .

13 (p=0,04, . 4). 61. K-ras , [Breivik J. Et al., 1994; Ahnen D.J. et al., 1998; Brink M. et al., 2003; Luch-tenborg M. et al., 2005]. K-ras , , , .

K-ras 184 207 (88,9%) 23 (11,1%) . K-ras 68 (37,0%), - 11 (47,8%) (p>0,05).

188 . 20 (10,6%) , 137 (72,9%) 31 (16,5%) - . K-ras 10 (50,0%), (35,0%) 11 (35,5%). , (p=0,10).

K-ras K-ras 185 . 5 (2,7%) in situ, 7 (3,8%) (T1), 32 (17,3%) (T2), 104 (56,2%) (T3), 27 (14,6%) (T4a), (5,4%) (T4b).

T K-ras (p=0,19). . : (T3-4b) (Tis-T2) , , , K-ras , , 47,7% 33,3%, , p=0,08.

K-ras K-ras [Pajkos G. et al., 2000; Hsieh et al., 2005; Hirata et al., 2007; Chang Y.S. et al., 2009]. 1 . 185 72 (38,9%, . 4).

, , K-ras 68 (36,8%).

K-ras n % N % n % N0 35 51,5 78 66,7 113 61,N+ 33 48,5 39 33,3 72 38, 68 100,0 117 100,0 185 100, (30,1% 46,8%, , p=0,04).

, K-ras (48,5% 33,3%, , p=0,04, .4).

K-ras , . 204- 49 (24,0%).

20 (40,8%) K-ras, 29 (59,2%) . 57 (36,8%), 98 (63,2%). K-ras .

K-ras , , 120 (60,8%) K-ras 78 (39,2%) . K-ras : in situ 5,3% 0,8%, , I 17,1% 14,6%, , II 22,4% 41,5%, III 28,9% 19,5%, IV 26,3% 23,6%, . , II K-ras II , III , (41,5% 22,4% 28,9% 19,5%, , p=0,02).

K-ras K-ras . (. 5). , , , , c III IV , , II .

. 5. K-ras (, , , , , ) K-ras .

K-ras .

, K-ras K-ras (p=0,02) (. 6). , , , Kras , , , .

. 6. K-ras , K-ras , . K-ras , , , .

1. K-ras 38,2%. K-ras : 12 62,2 %, 13 28,0 %, 61 4,9 %, 146 4,9 %.

2. 12 (30,4% 15,2%, , p<0,01).

3. 13 (20,8% 8,3%, , p=0,02).

4. 13 , (21,9% 9,2%, , p=0,03).

5. K-ras , . 13 (78,2%) , 12 (73,3%) (p=0,04).

6. K-ras K-ras (48,5% 33,3%, , p=0,04).

7. K-ras ( 5- 51,8% 33,4% , p=0,02).

1. (38,2%) (61,8%) K-ras EGFR , 60% .

2. , K-ras , , .

, 1. .B., M .., .B. . // B . 2011. . 57. 3. . 279-285.

2. .., .., .., .., .., .. KRAS . // (). 2011. .57. 2. . 9-10.

3. .., .., .., .., .. KRAS . // . 2011. 1. . 21-22.

4. .., .., .., .., .., .., ... KRAS . / II . . 18-20 2011. . 82-83.

5. .., .., .., .., .. K-ras . // : , ... . 26-27 2011. . 18.

6. .., .., .., .., .., .. KRAS . // : . -: +, 2011. .90-91.

7. Belyaeva A.V., Yanus G.A., Imyanitov E.N., Suspitsin E.N., Goulyaev A.V., Ievleva A.G., Moiseenko A.B. Significance of mutation in K-RAS gene in pathogenesis and clinical course of colorectal cancer. // European Journal of Cancer. 2011. V.47. Supplement 1. 6065.

8. .B., .., .., .., .., .B., .. - k-ras. // . 2011. . 3. 4. . 15-16.

9. .B., .., .., .., .., M .., .B., .. B , k-ras. // . 2012. .25. - 1. .40-45.

, ..., . .. ..., . .. . , , .

-һ 42-0208-26. 6084/16. 100 .

191119, -, . , . ./: 740-11-www.740-11-80.ru

 >> 





2011 www.dissers.ru -

, .
, , , , 1-2 .