WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Рузина Мария Николаевна

АНАЛИЗ ПОЛИМОРФИЗМА ГЕНА BOLA-DRB3 В СВЯЗИ С ГЕНЕТИЧЕСКОЙ УСТОЙЧИВОСТЬЮ КРУПНОГО РОГАТОГО СКОТА К ЛЕЙКОЗУ И ВИРУСОНОСИТЕЛЬСТВОМ

03.02.07 – генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва-2012

Работа выполнена в лаборатории сравнительной генетики животных Федерального государственного бюджетного учреждения науки Института общей генетики им. Н.И. Вавилова Российской академии наук, г.Москва Научный руководитель Сулимова Галина Ефимовна доктор биологических наук, профессор

Официальные оппоненты: Ковалюк Наталья Викторовна доктор сельскохозяйственных наук Северо-кавказский НИИ животноводства Российской академии сельскохозяйственных наук, г. Краснодар-55, заведующая лабораторией биотехнологии.

Малинина Татьяна Владимировна кандидат биологических наук Институт общей генетики им. Н.И.

Вавилова РАН, г. Москва, старший научный сотрудник лаборатории генетических проблем идентификации.

Ведущая организация: Московский государственный университет имени М.В.Ломоносова, г.Москва

Защита состоится «24» мая 2012 г. в _____ часов на заседании Диссертационного совета Д 002.214.01 на базе Федерального государственного бюджетного учреждения науки Института общей генетики им. Н.И. Вавилова Российской академии наук по адресу: 119991, ГСП-1, г. Москва, ул. Губкина, д.

3. Факс: (499) 132-89-62, e-mail: aspirantura@vigg.ru.

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждения науки Института общей генетики им. Н.И. Вавилова Российской академии наук.

Автореферат разослан «____»_____________2012г.

Ученый секретарь диссертационного совета, кандидат биологических наук Синельщикова Татьяна Аркадьевна - 2 -

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы Одной из проблем российского животноводства является обеднение породного, а значит, и генетического разнообразия крупного рогатого скота (КРС). Из 70 пород, разводимых на территории бывшего СССР в 80-90е гг XX, на сегодняшний день официально зарегистрировано 18 отечественных пород крупного рогатого скота. Обеднение генетических ресурсов КРС, может привести к снижению эффективности селекции и снижению резистентности животных к постоянно эволюционирующим возбудителям заболеваний. В связи с этим, важно поддерживать максимально возможное разнообразие генофонда КРС.

Необходимым условием для проведения таких работ является проведение генетического мониторинга пород КРС на молекулярном уровне. Особый интерес представляют гены, участвующие в формировании полезных признаков. Одним из наиболее значимых в этом отношении генов является ген BoLA-DRB3, кодирующий антигены класса II главного комплекса гистосовместимости КРС, обладающий высоким аллельным разнообразием.

Установлены ассоциации аллельных вариантов данного гена с устойчивостью к таким заболеваниям, как лейкоз, мастит, цистит, дерматофилоз, тейлериоз, кожному заболеванию, вызываемому иксодовыми клещами Boophilus microplus.

Особенно актуальным является изучение полиморфизма гена BoLA-DRBв связи с резистентностью к лейкозу. Лейкоз крупного рогатого скота (КРС) – хроническое инфекционное заболевание опухолевой природы, в основе которого лежит системное поражение лейкопоэтической ткани. Данное заболевание широко распространено в нашей стране и приносит значительный экономический ущерб сельскому хозяйству вследствие падежа животных, недополучения продуктов животноводства, потери уникального генофонда в молочном скотоводстве. В первую очередь лейкозу подвержены высокопродуктивные животные. Возбудителем данного заболевания является вирус лейкоза крупного рогатого скота (ВЛКРС). Для эффективной профилактики лейкоза важно не только учитывать данные о полиморфизме гена BoLA-DRB3 КРС в селекционной работе, но и рассматривать распространение различных форм ВЛКРС на территории регионов нашей страны. В странах Западной Европы и Америки обнаружены географические изоляты ВЛКРС, генотипы которых существенно различаются. Однако российские разновидности ВЛКРС не исследовались.

Таким образом, исследование полиморфизма гена BoLA-DRB3 у отечественных пород КРС актуально в связи с необходимостью разработки селекционно-генетических подходов к оздоровлению стад животных и проблемой сохранения пород и их биоразнообразия. Несомненный практический интерес представляет детекция эндемичных для России разновидностей ВЛКРС.

- 3 - Цель исследования Цель данного исследования – анализ полиморфизма гена BoLA-DRB3 у калмыцкой, якутской, костромской, красно-пестрой, черно-пестрой пород КРС и зебувидного скота, а также детекция форм ВЛКРС, распространенных на территории Российской Федерации.

Задачи исследования:

Изучить разнообразие и характер распределения аллелей и генотипов BoLA-DRB3 у шести пород КРС: у калмыцкой, якутской, костромской, красно-пестрой, черно-пестрой пород КРС, зебувидного скота и провести сравнительный анализ с ранее изученными породами.

Оценить характер распределения BоLA-DRB3-аллелей и генотипов, ассоциированных с резистентностью к лейкозу, в исследованных породах КРС.

Оценить характер распределения аллелей гена BоLA-DRB3, ассоциированных с резистентностью к другим заболеваниям (маститу, циститу, отслоению плаценты, клещевому заболеванию, вызываемому Boophilus microplus), в исследованных породах КРС.

Оценить характер распределения аллелей гена BоLA-DRB3, ассоциированных с признаками молочной продуктивности, в исследованных породах крупного рогатого скота.

На основании анализа полиморфизма гена pol выявить формы ВЛКРС, распространенные на территории РФ.

Научная новизна Впервые получены данные о полиморфизме гена BoLA-DRB3 у пород отечественной селекции (калмыцкой, якутской, костромской пород КРС, зебувидного скота), хорошо приспособленных к суровым условиям обитания в регионах Российской Федерации, относящихся к различным географическим и климатическим зонам.

Впервые проведен сравнительный анализ разнообразия и характера распределения аллелей и генотипов BoLA-DRB3, ассоциированных с признаками молочной продуктивности и резистентностью к заболеваниям, у пород КРС российской селекции. Показана высокая частота аллелей и генотипов, определяющих устойчивость к лейкозу, у костромского, калмыцкого и зебувидного скота.

Впервые на основе анализа нуклеотидной последовательности вирусного гена pol охарактеризована изменчивость вируса лейкоза КРС в животноводческих хозяйствах на территории России и Украины.

Впервые выявлены новые формы ВЛКРС, эндемичные для России.

Предложена новая классификация форм ВЛКРС на основе анализа изменчивости областей гена pol, кодирующих обратную транскриптазу и интегразу.

- 4 - Практическая значимость Полученные в ходе выполнения работы данные по аллельному полиморфизму гена BoLA-DRB3 и частотам встречаемости ценных аллелей, ответственных за устойчивость к заболеваниям, у широкого спектра отечественных пород, могут стать фундаментальной основой для разработки селекционно-генетических подходов к оздоровлению стад животных и сохранению биоразнообразия. Высокое содержание ценных аллелей и генотипов у костромского, калмыцкого и зебувидного скота может служить основанием для разработки программ по сохранению их генофондов и рациональному использованию в целях улучшения генофондов других пород КРС, разводимых в России.

Разработанные новые варианты аллель-специфичной ПЦР, позволяющие дифференцировать трудно тестируемые аллели (*07 и другие), могут быть использованы для разработки тест-систем с повышенной точностью типирования аллелей гена BoLA-DRB3 и получить применение в научной и селекционной практике.

Обнаружение российских разновидностей ВЛКРС позволит в будущем создать эффективные диагностикумы для детекции вирусоносительства среди КРС с учетом эндемичных для России форм вируса.

Апробация результатов Основные положения и результаты работы были представлены на ХVII Международной конференции "Новые информационные технологии в медицине, биологии, фармакологии и экологии", секция - "Геномика. Гены и болезни" (Ялта-Гурзуф, 2009), на научно-практических конференциях «БиоТехЖ-2008» (Дубровицы, 2008), «Биотехнология в растениеводстве, животноводстве и ветеринарии», (Москва, 2010), «Популяционная генетика:

современное состояние и перспективы», посвященная памятной дате, 75-летию со дня рождения академика Ю.П. Алтухова (Москва, 2011); на межлабораторном семинаре отдела генетики животных Института общей генетики им. Н.И.Вавилова РАН (Москва, 2011).

Декларация личного участия автора Диссертация написана автором лично с использованием собственных результатов, а так же результатов, полученных ранее в лаборатории. Автор самостоятельно осуществлял выделение ДНК, постановку ПЦР и АС-ПЦР, рестрикционный анализ, электрофоретический анализ, статистическую обработку данных. Данные о полиморфизме гена BoLA-DRB3 у костромского и якутского скота получены совместно с н.с. Т.А.Штыфурко. Данные о полиморфизме данного гена у ярославского и монгольского скота, использованные в сравнительном анализе, были получены ранее к.б.н. М.

Мохаммад Абади. Обработка последовательностей ВЛКРС проводилась совместно с д.б.н. Б.В. Андриановым. Обсуждение результатов исследования и - 5 - написание научных публикаций осуществлялась при участии научного руководителя д.б.н. Сулимовой Г.Е.

Структура и объем диссертации Диссертационная работа состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения, выводов, списка литературы и приложения. Работа изложена на 147 страницах машинописного текста, включая 30 таблиц, 26 рисунков. Список литературы включает 190 наименований.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Материалом для исследования полиморфизма гена BoLA-DRBпослужили образцы крови животных калмыцкой (n=66), якутской (n=105), костромской (n=104), красно-пестрой (n=39), черно-пестрой (n=81) пород КРС и зебувидного скота (n=95).

Для исследования форм ВЛКРС были использованы образцы крови РИДположительных животных, полученные в 2008-2010гг. из двух подмосковных хозяйств, одного хозяйства Краснодарского края и одного хозяйства Украины.

Для анализа было взято от 5 до 8 образцов из каждого хозяйства. Для сравнительного анализа были использованы нуклеотидные последовательности соответствующей области генома ВЛКРС, депонированные в базе данных NCBI.

Выделение ДНК. Суммарную геномную ДНК выделяли из крови животных стандартным гуанидинтиоционатным методом с использованием наборов "Magna DNA prep 200", выпускаемых ООО «Лаборатория изоген» (Москва), согласно рекомендациям фирмы производителя.

Типирование аллелей гена BoLA-DRB3. Для типирования аллелей гена BoLA-DRB3 было использовано три независимых подхода: рестрикционный анализ продуктов амплификации (ПЦР-ПДРФ), алельспецифичная ПЦР с праймерами ER-17 и VD-19, предложенная в работе (Xu et al., 1993), и аллельспецифичная ПЦР с праймерами HLO-30d HLO-07d и HLO-24d, разработанная нами совместно с д.б.н. Климовым Е.А. (табл. 1).

Амплификацию фрагмента экзона 2 гена BoLA-DRB3 проводили в один или два этапа (Nested-PCR) согласно опубликованным ранее протоколам (Van Eijk et al., 1992; Сулимова и др., 1995) с использованием набора «GenePakTM PCR Core» (Isogene Lab. Itd, Москва). Для одноэтапной ПЦР использовали праймеры HLO-30 и HLO-32. Для двухэтапной – для первого раунда HLO-30 и HLO-31, для второго раунда были использованы праймеры HLO-30 и HLO-32.

Состав праймеров приведен в табл. 1.

Рестрикционный анализ продуктов амплификации проводили с использованием эндонуклеаз RsaI, HaeIII и BstYI (XhoII). Продукты реакции разделяли с помощью электрофореза в 4% агарозном геле (TopVision™ LE GQ - 6 - agarose, Fermentas, Канада) в присутствии бромистого этидия (5мМ/мл) и тестировали в УФ-свете.

Аллель-специфичная ПЦР. Характеристика праймеров для аллельспецифичной ПЦР и перечень тестируемых аллелей представлены в табл. 1.

Таблица 1. Характеристика праймеров для аллель-специфичной ПЦР и детектируемые аллели гена BoLA-DRB3.

Праймеры Размер Последовательность продукта Детектируемые аллели Название (5’-3’) п.н.

HLO-30 tcctctctctgcagcacatttcc * *11(0902), *23(2701, 2702, 2703, 2705, ER-17 gacctcctctccgcccg 225 2706), *28(0701), *31(2801), *32(2401), *33(2704), *35(2101), *42(2802) *01(0503), *02(1301), *03(1001, 1002), *05(3301), *07(0201), *08(1201), *09(0301, 0302), *10(1601), *11(1202), *12(1701, 1702, 3201, 3202), *13(0401), *15(20011, 20012, 2002, 2003), *16(1501, 1502), *18(1801, VD-19 cacctgtgcatgacgtctg 21802), *19(2601), *20(2901, 3601), *21(0801), *31(2801), *34(3002), *35(2101), *41(0502, 1901, 3801), *42(2802), *45(3401, 3402), *46(3501), *47(1703), *48(3901) HLO-30d ctctgcagcacatttcc ** - HLO-07d ctccaggatctcctg 206 *07(0201) *03(1001, 1002), *10(1601), *15(20011, 20012, 2002, 2003), *21(0801), *22(1101), *23(2701, 2702, 2703, 2705), *24(0102, HLO-24d ctccaggaagtcct 20101), *27(14011, 3101), *28(0701), *31(2801), *33(2704), *35(2101), *41(3801), *42(2802), *46(3501) Примечания: Жирным шрифтом выделены праймеры, разработанные нами совместно с д.б.н.

Климовым Е.А. * Праймер HLO-30 является прямым для праймеров ER-17 и VD-19.

** Праймер HLO-30d является прямым для праймеров HLO-07d и HLO-24d.

Аллель-специфичную ПЦР проводили с использованием наборов «GenPakR PCR Core» фирмы «IsoGene lab.», Россия. В качестве матрицы использовали ПЦР-продукты первого раунда Nested-PCR (2 мкл для праймеров ER-17 и VD-19, 1 мкл для праймеров HLO-07d и HLO-24d). ПЦР проводили в многоканальном амплификаторе «Терцик» фирмы «ДНК-технология», Россия.

ПЦР-амплификацию ОТ- и Ин-фрагментов гена pol ВЛКРС проводили с использованием разработанных нами RT- и IN-праймеров: RT-1:

5’-gaggtttgtgcatgacctacgagctaca-3’; RT-2: 5’-tagagacccattggaggtctcctaagac-3’; IN-1:

5’-ggaggtgggaagatgcgaactatt-3’; IN-2: 5‘-gtccgctctaccaaccctgaactt-3’.

RT-праймеры использовали для амплификации ОТ-фрагмента гена pol (фрагмент участка, кодирующего обратную транскриптазу) размером 599 пн Центральная часть этого фрагмента размером 494 пн была выбрана для - 7 - последующего анализа. В полном геноме ВЛКРС (GeneBank ID: AF033818) этот фрагмент соответствует области с 2325 по 2818 нуклеотид (рис.1).

IN-праймеры использовали для амплификации Ин-фрагмента гена pol (фрагмент участка, кодирующего интегразу) размером 347 пн. Для последующего анализа была выбрана центральная часть этого фрагмента размером 233 пн. В полном геноме ВЛКРС (GeneBank ID: AF033818) этот фрагмент соответствует области с 3986 по 4218 нуклеотид.

Для проведения ПЦР использовали наборы "GenePak Core" ООО «Лаборатория изоген» (Москва) в условиях, рекомендованных производителем.

Реакцию проводили в амплификаторе «Терцик» ООО «ДНК-технология» в следующих условиях: первичная денатурация – 5 мин при 95оС; 36 циклов:

денатурация при 94оС – 30 сек, отжиг праймеров при 60оС – 30 сек, синтез при 72оС – 40 сек; завершающий синтез при 72оС – 7 мин. Продукты амплификации разделяли методом электрофореза в 1,8% агарозном геле.

Определение нуклеотидной последовательности. Для очистки продуктов ПЦР их фракционировали в 1% агарозном геле (смесь 1:1 легко- и тугоплавкой агарозы). Экстракцию продуктов ПЦР из геля и их очистку проводили с помощью наборов ООО «Омникс» (Санкт-Петербург) согласно протоколу производителя. Определение нуклеотидной последовательности было выполнено в ЗАО «Евроген» методом автоматического секвенирования на генетическом анализаторе ABI Prism 3130xl (Applied Biosystems, США) с использованием наборов Big DyeTM Terminator v.3.1 Cycle Sequencing (Applied Biosystem, США).

Для статистического анализа данных использовали приложение «Exel Microsoft office», программы «GDA-1.1» и «Statistica 6». Для филогенетического анализа использовали следующие пакеты программ:

«ChromasPro», «DNAStar» - для анализа последовательностей, «ClustalW2» - для построения выравниваний, «Mega5» - для построения филогенетических деревьев. В работе были использованы данные из базы NCBI http://www.ncbi.nlm.nih.gov/.

ОСНОВНЫЕ РЕЗУЛЬТАТЫ Оптимизация условий типирования аллелей гена BoLA-DRBДля амплификации экзона 2 гена BoLA-DRB3 использовали метод как двухэтапной ПЦР с применением праймеров: HLO-30, HLO-31 и HLO-32, так и одноэтапной - с праймерами HLO-30 и HLO-32, описанными ранее (Van Eijk et al., 1992). Характеристики праймеров приведены в таблице 1. Праймер HLO30 фланкирует экзон 2 гена с 5'-конца и его последовательность комплементарна 5'-концевой области экзона 2 (семь нуклеотидов) и прилегающей интронной области. Праймеры HLO-31 и HLO-32 фланкируют экзон 2 с 3'-конца, при этом HLO-31 включает часть интронной последовательности и 3'-конец экзона 2 (восемь нуклеотидов), а HLO-- 8 - полностью локализован в 3'-концевой области экзона 2 и частично перекрывается с праймером HLO-31 (восемь нуклеотидов. В результате двухэтапной и одноэтапной ПЦР продукты реакции представлены одним фрагментом размером 284 пн. (281 пн в случае делеции для некоторых аллелей гена). Использование одноэтапной ПЦР позволило упростить метод, сократить время анализа, уменьшить вероятность загрязнения, а также снизить стоимость самого эксперимента.

Распределение сайтов рестрикции эндонуклеаз Rsa I, Hae III и Bst YI (Xho II) в экзоне 2 гена BoLA-DRB3 у разных аллельных вариантов гена BoLADRB3 различно, что приводит к образованию после обработки продуктов амплификации эндонуклеазами специфического спектра фрагментов ДНК, которые отличаются друг от друга по количеству и длине (ДНК-паттерны) (Van Eijk et al.,1992). Сопоставление ДНК-паттернов, полученных с использованием трх указанных рестрицирующих эндонуклеаз, позволяет идентифицировать 54 аллеля гена BoLA-DRB(http://www.projects.roslin.ac.uk/bola/bolahome.html). Наиболее информативна эндонуклеаза Rsa I, для которой описано 19 типов ДНК-паттернов.

Для рестрикционного анализа продуктов амплификации, как правило, достаточно использования двух эндонуклеаз: Rsa I и Hae III. Однако в ряде случаев типирование аллелей на основе ДНК-паттернов двух указанных эндонуклеаз было затруднено, в особенности для аллелей, имеющих делеции, из-за близких размеров рестрикционных фрагментов. В этих случаях использовали рестрикционный анализ продуктов амплификации с помощью эндонуклеазы Xho II и аллельспецифичную ПЦР.

Разработка метода аллель-специфичной ПЦР для типирования аллелей гена BoLA-DRB3, ответственных за устойчивость или восприимчивость к лейкозу, стала возможной после анализа нуклеотидной последовательности этих аллелей и выяснения молекулярных механизмов этого явления (Xu et al., 1993). Было показано, что у всех аллелей, несущих устойчивость к лейкозу, есть общая последовательность, кодирующая аминокислотную последовательность Glu-Arg в 70-71-м положении белковой молекулы, а у аллелей, ответственных за высокую восприимчивость к лейкозу, имеются общие нуклеотидные последовательности, кодирующие аминокислоты: ValAsp-Thr-Tyr (Val) в 75-78-м положении. Аминокислоты, находящиеся в 70-положении молекулы класса II, входят в антиген-узнающий сайт молекул класса II, т.е. определяют специфичность взаимодействия с антигеном.

Аминокислотная последовательность Val-Asp-Thr-Tyr(Val) является общей для всех аллелей, несущих повышенную восприимчивость к лейкозу и находится в участке связывания с рецепторами Т-клеток (Xu et al., 1993). Наличие мотивов последовательностей, общих для аллелей устойчивости и восприимчивости к лейкозу позволило разработать метод определения аллельных вариантов гена BoLA-DRB3 с помощью аллель-специфичной ПЦР, который позволяет - 9 - тестировать животных на основе электрофоретического анализа продуктов амплификации с праймерами HLO30, ER-17 и VD-19 (Xu et al., 1993).

К сожалению, разработанный Xu et al. (1973) метод аллельспецифичной ПЦР для дифференциации BoLA-DRB3 аллелей, ассоциированных с устойчивостью и восприимчивостью к лейкозу, не всегда дает однозначные результаты, поэтому нами были разработаны новые варианты аллельспецифичной ПЦР, позволяющие дифференцировать трудно тестируемые аллели (состав праймеров, размер продуктов и перечень детектируемых аллелей приведены в табл. 1,). Для идентификации аллеля *7 нами был предложен вариант аллельспецифичной ПЦР с праймерами HLO-30d и HLO-07.

ПЦР с праймерами HLO-30d и HLO-24d позволяет амплифицировать широкий спектр аллелей (15 аллелей), но в сочетании с данными рестрикционного анализа и аллель-специфичной ПЦР с праймерами ER-17 и VD-19 он обеспечивает возможность их дифференциации.

В дальнейшей работе нами были использованы для точного типирования аллелей гена BoLA-DRB3 три независимых подхода: рестрикционный анализ продуктов амплификации (ПЦР-ПДРФ), аллель-специфичная ПЦР с праймерами ER-17 и VD-19, предложенная в работе (Xu et al., 1993), и аллельспецифичная ПЦР с праймерами HLO-07d и HLO-24d, разработанная нами.

Сравнительный анализ разнообразия и характера распределения аллелей гена BoLA-DRB3 у изученных пород крупного рогатого скота Исследованные породы различались как по спектру аллелей гена BoLADRB3, так и по распределению их частот. Наиболее высокое разнообразие спектра аллелей гена BoLA-DRB3 было показано у калмыцкого (36 аллелей), ярославского (35 аллелей) и монгольского скота (35 аллелей). У черно-пестрого скота обнаружено 28 аллелей, у костромского – 23 аллеля, у красно-пестрого и зебувидного скота – по 22 аллеля. Низкий уровень генетического разнообразия по гену BoLA-DRB3 отмечен у якутского скота (14 аллелей). Распределение частот аллелей гена BoLA-DRB3 у исследованных пород представлено в таблице 2.

Высокий уровень аллельного разнообразия согласно нашим данным, а также данным по иранской зебувидной породе Систани (32 аллеля) (Мохаммади, 2009) характерен для национальных «местных» породам. В коммерческих породах КРС – голштинской (Kelm, 1997; Ledwidge, 2001), джерсейской (Sharif, 1998; Gillespie, 1999), айрширской (Удина, 2003; Удина, 1998), шортгорнской (Takeshima, 2002) - разными авторами было тестировано 11-18 аллелей. Исключение составила одна из популяций канадской голштинской породы (27 аллелей) (Sharif, 1998; Kulberg, 2007) и иранская голштинская порода (26 аллелей) (Нассири, 2005). Снижение числа аллелей у коммерческих пород по сравнению с местными может быть следствием повышенного селекционного давления на эти группы пород.

- 10 - Таблица 2. Распределение частот аллелей гена BoLA-DRB3 у исследованных пород КРС.

Аллель P, % P, % P, % P, % P, % P, % P, % P, % *01 2,8 3,8 - 3,7 7,2 - 7,7 1,*02 2,8 - 0,5 - - 1,1 - 2,*03 2,8 - - 0,5 - 2,5 5,1 7,*04 - 2,3 - - - - 1,3 2,*05 - 1,5 - - - - - - *06 - 1,5 - - - 1,4 - - *07 5,6 3 1,9 8,4 3,8 - 15,4 4,*08 0,7 3 - 2,1 8,5 0,7 5,1 5,*09 0,7 - - - - - - - *10 0,7 4,5 - - 22,5 2,1 5,1 5,*11 2,1 3,8 - 2,1 12,7 0,4 10,3 1,*12 0,7 6,8 0,5 0,5 3,4 7,4 1,3 3,*13 0,7 0,8 - - 0,8 7,8 - 3,*14 1,4 - - - - 2,5 - - *15 - 5,3 - 1,1 2,1 5 1,3 1,*16 0,7 3,8 - - - 4,6 5,1 0,*17 - 1,5 0,5 - 0,4 0,4 - - *18 8,5 3,8 8,6 - 0,4 1,4 - 2,*19 - 0,8 - - - - - - *20 7,7 - - - 3 1,4 1,3 0,*21 1,4 2,3 0,5 - - 0,4 - 1,*22 0,7 1,5 4,8 14,2 2,1 2,1 12,8 11,*23 - 3 0,5 3,7 - 3,9 - 1,*24 1,4 7,6 - 16,8 - 16,3 9 15,*25 2,8 - - 1,1 0,4 0,4 2,6 0,*26 5,6 0,8 - 1,1 - 0,4 - 2,*27 3,5 2,3 - 15,3 0,4 0,4 2,6 - *28 7 14,4 - 9,5 11,4 16 2,6 9,*29 5,6 - 42,9 - - - - - *30 - - - - - - - - *31 0,7 - 1,4 1,6 0,8 3,2 - 0,*32 - - 1 0,5 - 0,7 1,3 3,*33 - 0,8 - - - 0,4 - - - 11 - Монгольский КРС Калмыцкий КРС Якутский КРС Зебувидный КРС Костромской КРС Ярославский КРС Красно пестрый КРС Черно пестрый КРС *34 4,2 0,8 - 3,2 - - - - *35 - - - - - - 1,3 - *36 4,9 2,3 - - 11,4 1,4 - 3,*37 2,8 1,5 - 1,6 1,3 0,7 - 3,*38 2,8 2,3 - 1,1 - - 1,3 - *39 1,4 - - - - - - - *40 - - - - - 4,3 - - *41 - 0,8 - 1,1 1,7 - - 0,*42 0,7 - - 10,5 - 1,8 5,1 0,*43 2,8 3 - - 0,4 0,4 1,3 - *44 0,7 - - - - 3,5 - - *45 - 0,8 7,1 - - - 1,3 - *46 5,6 0,8 - - - - - - *47 - 1,5 - - - - - - *48 - - - - 1,3 1,1 - 1,*49 5,6 - - - 1,7 - - - *50 0,7 0,8 7,1 - - 0,7 - - *51 - 3 - 0,5 2,1 2,8 - - *52 0,7 1,5 - - - - - - *53 - - - - - - - - *54 - 2,3 22,9 - - 0,7 - - Резко сниженное число BoLA-DRB3-аллелей у якутского скота может быть следствием инбредной депрессии, вызванной низкой численностью данной породы, а также со сниженным количеством патогенов, встречающихся в области ее обитания.

У монгольского, калмыцкого, ярославского, красно-пестрого, чернопестрого скота частоты аллелей гена BoLA-DRB3 распределены относительно равномерно. У монгольского скота с частотой более 5% встречается восемь аллелей, самый распространенный из них (*18) представлен с p=8,5%. Доля аллелей с частотами менее 5% (27 аллелей) составила в сумме 48,6%. У калмыцкого скота наиболее часто встречались аллели: *28 (14,4%), *24 (7,6%) и *12 (6,8%), *15 (5,3%); суммарная доля тридцати двух аллелей с частотой менее 5% составила 65,9%. У ярославского скота преобладают четыре аллеля *24 (16,3%), *28 (16,0%), *12 (7,8%), *13 (7,8%). Суммарная частота редких аллелей (31 аллель) составляет 52,5%. У красно-пестрого скота обнаружено десять аллелей с р>5%. Это *01 (7,7%), *03 (5,1%), *07 (15,4%), *08 (5,1%), *(5,1%), *11 (10,3%), *16 (5,1%), *22 (12,8%), *24 (9,0%), *42 (5,1%). На долю двенадцати редких аллелей приходится всего 19,2%. У черно-пестрой породы КРС наиболее представленными являются аллели *03 (7,4%), *08 (5,6%), *(5,6%), *22 (11,1%), *24 (15,4%), *28 (9,3%). Двадцать два аллеля с р<5% составили по частот 45,7%. В целом, для монгольского, калмыцкого, - 12 - ярославского, красно-пестрого и черно-пестрого скота характерно относительно равномерное распределение частот BoLA-DRB3 аллелей с некоторым преобладанием у калмыцкого скота аллеля *28, и у ярославского скота аллелей *24 и *28.

Сходная ситуация по распределению частот BoLA-DRB3.2 аллелей была описана ранее у черно-пестрой (Удина, 1998) и красной горбатовской (Сулимова, 2006) пород КРС отечественной селекции. Аллели гена BoLA-DRBпредставлены в них относительно равномерно, максимальная частота аллелей у черно-пстрого скота не превышает 9%, у красной горбатовской – 12,9%.

Однако спектры преобладающих аллелей у данных пород иные. С наибольшей частотой у черно-пестрого КРС встречаются аллели *16 (8,86%), *24 (8,86%), *11 (6,63%), *12 (6,33%), *13 (7,59%), *51 (6,33%) (Удина, 1998). У красного горбатовского скота - *3 (12,9%), *16 (7,36%), *24 (7,4%), *11 (8,3%) (Сулимова, 2006). На долю аллелей с низкой частотой приходится 55,65% и 50,28% для черно-пестрой и красной горбатовской пород соответственно.

У якутского, зебувидного и костромского КРС наблюдается неравномерное распределение частот аллелей. У зебувидного скота с высокой частотой встречаются аллели *07 (8,4%), *22 (14,2%), *24 (16,8%), *27 (15,3%), *28 (9,5%), *42 (10,5%). Доля аллелей с частотами менее 5% (16 аллелей) составила в сумме 25,3%. У костромкого скота преобладают аллели *01 (7,2%), *08 (8,5%), *10 (22,5%), *11(12,7%), *28 (11,4%), *36 (11,4%). Суммарная доля 16 редких аллелей составила 26,3%.

Для большинства изученных ранее мировых пород КРС характерна такая же картина. Как правило, основную часть общего аллельного разнообразия составляют от двух-трех (35-43%) до пяти-шести аллелей (68-74%). Например, преобладание четырех аллелей обнаружено у бразильского скота гир (*16, *20, *2, *29, в сумме 51,7%) (da Mota, 2002), иранского зебувидного скота Систани (*8, *10, *20, *34, в сумме 48,4%) (Мохаммади, 2009), иранского голштинского скота (*8, *24, *11, *16, в сумме 67%) (Нассири, 2005). Доминирование по частотам для шести аллелей выявлено у джерсейской породы КРС (*8, *10, *15, *21, *36, *ibe, в сумме 74%) (Gillespie, 1999), у иранского зебувидного скота Канкрэй (*34, *15, *6, *20, *37, *20, в сумме - 71%) (Behl, 2007), в одной из линий иранского голштинского скота (*8, *11, *16, *22, *23, *24, в сумме 69, 7%) (Pashmi, 2007), у японской Шортгорнской породы (*8, *9, *21, *27, *7, *24, в сумме 70%) (Takeshima, 2002).

Совершенно особая картина наблюдается у якутского скота. Разнообразие аллелей у этой породы резко снижено (всего 14 аллелей). Налицо доминирование двух аллелей - BoLA-DRB3.2*29(42,9%) и *54(22,9%). С частотой более 5% также встречаются аллели *18 (8,6%), *45 (7,1%), *(7,1%). На долю остальных аллелей приходится всего 11,4%. Такого низкого уровня аллельного разнообразия гена BoLA-DRB3 не было отмечено ни для одной из изученных пород КРС. Надо полагать, что столь низкий уровень аллельного разнообразия исследуемой популяции якутской породы из - 13 - Верхоянского района республики Саха по локусу BoLA-DRB3 обусловлен инбредной депрессией, возникшей в результате длительной изоляции данной группы и ее низкой численностью.

Сравнительный анализ разнообразия и характера распределения BoLADRB3-генотипов у изученных пород крупного рогатого скота Высокий уровень аллельного разнообразия гена BoLA-DRB3 у монгольского, калмыцкого и ярославского скота определил и высокий уровень разнообразия генотипов у этих пород – 56, 56 и 72 генотипа соответственно. У зебувидного, костромского, красно-пестрого, черно-пестрого КРС обнаружено 42, 55, 31, 50 генотипов соответственно. Минимум числа генотипов (18) обнаружен у якутской породы КРС. Во всех исследованных породах КРС, за исключением якутской, генотипы были распределены относительно равномерно.

В данных породах сложно выделить преобладающие генотипы. Так, у монгольского КРС с частотой больше 5% представлен только один генотип – *07/*07 (5,6%). У зебувидного скота пятипроцентный порог частоты встречаемости преодолели пять генотипов: *07/*24 (6,3%), *22/*24 (9,5%), *22/*27 (6,3%), *27/*27 (5,3%), *28/*42 (10,5%); у костромского – 4 генотипа:

*01/*28 (5,1%), *10/*10 (10,2%), *10/*11 (5,9%), *36/*36 (5,9%); у ярославского – четыре генотипа: *12/*13 (7,8%), *24/*24 (7,8%), *24/*28 (5,7%), *28/*28 (9,9%); у красно-пестрого – шесть генотипов: *01/*07 (7,7%), *07/*(5,1%), *07/*22 (5,1%), *16/*24 (7,7%), *22/*24 (5,1%), *22/*42 (5,1%). У калмыцкого и черно-пестрого скота такие генотипы отсутствовали. Итак, можно сказать, что распределение частот BoLA-DRB3-генотипов у исследованных пород носит равномерный характер с преобладанием у зебувидного скота вариантов *28/*42 (10,5%) и *22/*24 (9,5%), у костромского КРС - *10/*10 (10,2%), у ярославского - *28/*28 (9,9%).

Описанная ситуация хорошо согласуется с мнением, согласно которому полиморфизм гена BoLA-DRB3 поддерживается на уровне популяции. В то время как одна особь может нести лишь два варианта данного гена, то набор аллелей в популяции может быть очень широким, а их сочетание в рамках генотипов – многообразным. Это обусловливает распознавание широкого спектра чужеродных антигенов.

У якутского КРС было обнаружено всего восемнадцать генотипов, пять из которых, *18/*29 (5,7%), *22/*54 (6,7%), *29/*29 (38,1%), *45/*50 (14,3%), *54/*54 (17,1%), были представлены с частотой более 5%. Суммарная частота остальных тринадцати генотипов составила 18,1%. Обращает на себя внимание генотип *29/*29, встречающийся чрезвычайно часто.

- 14 - Во всех изученных породах КРС наблюдался недостаток гетерозигот (таблица 3). Это может быть связано с селекционным давлением в данных группах сельскохозяйственных животных. В диких же популяциях отбор поддерживает избыток гетерозигот по данному локусу, что способствует связыванию более разнообразного набора чужеродных антигенов.

Таблица 3. Оценка уровня гетерозиготности по BoLA-DRB3 у изученных пород КРС.

Порода N(hm) N(ht) Ho He 2 k D Монгольская 16 55 0,7746 0,9532 0,033464 -0,187Калмыцкая 12 54 0,8182 0,9485 0,017900 -0,137Якутская 63 42 0,4000 0,7435 0,152335 -0,4Зебувидный скот 10 85 0,8947 0,8952 0,000000 -0,0000,7288 0,8889 0,028831 -0,180Костромская 32 86 Ярославская 44 97 0,6879 0,9215 0,059218 -0,253Красно-пестрая 4 35 0,8974 0,9247 0,000806 -0,029Черно-пестрая 9 72 0,8889 0,9308 0,001886 -0,045Примечания: N(hm) – количество гомозигот в выборке. N(ht) – количество гетерозигот в выборке. Ho – уровень наблюдаемой гетерозиготности. He – уровень ожидаемой гетерозиготности. 2 – значение критерия 2 Пирсона при сравнении Ho и He. k – количество степеней свободы, D – коэффициент Селендера. Различия Но и Не статистически недостоверны.

Анализ распределения аллелей гена BoLA-DRB3 в связи с устойчивостью и восприимчивостью к лейкозу Устойчивость к лейкозу определяется аллелями:*7, *11, *23, *28, восприимчивость к лейкозу - аллелями: *8, *16, *22, *24. Распределение частот BoLA-DRB3-аллелей, ассоциированных с устойчивостью к лейкозу представлено в таблице 4. Статистически значимые различия в представленности аллелей, различающихся по своей функциональной значимости, были получены только для трех пород из восьми исследованных.

У монгольской и костромской пород аллели «устойчивости» к лейкозу встречались достоверно чаще, чем аллели «восприимчивости» к данному заболеванию (2=10,84; V2=10,8; p=0,001; 2(с поправкой Йетса)=9,53; р=0,002 и 2=22,88; V2=22,84; 2(с поправкой Йетса)=21,78; p=0,00001 соответственно). У черно-пестрого КРС преобладали аллели, определяющие восприимчивость к лейкозу (2=10,29; р=0,0013; V2=10,26; p=0,0014; 2(с поправкой Йетса)=9,48;

р=0,0021). У калмыцкого, якутского, зебувидного, ярославского, краснопестрого, черно-пестрого КРС по данному признаку достоверных различий не обнаружено.

- 15 - Таблица 4. Распределение частот BoLA-DRB3-аллелей, ассоциированных с резистентностью к лейкозу.

Частота аллелей, ассоциированных с устойчивостью к лейкозу № аллелея P, % P, % P, % P, % P, % P, % P, % P, % *7 5,6 3,0 1,9 8,4 3,8 0 15,4 4,*11 2,1 3,8 0 2,1 12,7 0,4 10,3 1,*23 0 3,0 0,5 3,7 0 3,9 0 1,*28 7,0 14,4 0 9,5 11,4 16,0 2,6 9,Сумма 14,8 24,2 2,38 23,7 28 20,2 28 17,Частота аллелей, ассоциированных с восприимчивостью к лейкозу № аллеля P, % P, % P, % P, % P, % P, % P, % P, % *8 0,7 3,0 0 2,1 8,5 0,7 5,1 5,*16 0,7 3,8 0 0 0 4,6 5,1 0,*22 0,7 1,5 4,8 0,0 2,1 2,1 12,8 11,*24 1,4 7,6 0 16,8 0 16,3 9,0 15,Сумма 3,52 15,9 4,76 18,9 10,6 23,8 32 32,Примечание: Различия в суммарных частотах аллелей, ассоциированных с устойчивостью к лейкозу, между породами статистически достоверны (2=49, 32; k=7; р0,001 для аллелей «устойчивости»; 2=87,87; k=7; р0,001 для аллелей «восприимчивости»).

У большинства пород КРС, описанных в литературе, преобладают аллели, ассоциированные с восприимчивостью к лейкозу. Это канадская голштинская, иранская голштинская, аргентинская креольская, креольская сааведрино, иранская систани, японская шортгорнская, российская чернопестрая и красная горбатовская. У айрширской, канадской джерсейской, бразильской зебувидной гир пород КРС преобладают аллели, ассоциированные с устойчивостью к лейкозу.

Распределение частот BoLA-DRB3-генотипов, ассоциированных с устойчивостью и восприимчивостью к лейкозу у изученных пород КРС Степень генетической устойчивости породы к лейкозу важно также рассмотреть на уровне распределения частот генотипов, а не частот аллелей гена BoLA-DRB3. Это обусловлено тем, что устойчивость к данному заболеванию наследуется, как доминантный признак. Таким образом, если генотип несет хотя бы один аллель, ассоциированный с устойчивостью к лейкозу, то такой генотип можно считать генотипом «устойчивости» к лейкозу.

- 16 - КРС КРС КРС КРС КРС КРС Черно Порода Красно Якутский Зебувидный Калмыцкий Костромской Ярославский пестрый КРС пестрый КРС Монгольский Генотипы, имеющие в своем составе хотя бы один аллель, ассоциированный с восприимчивостью к лейкозу, и не несущие аллелей, ассоциированных с устойчивостью к лейкозу, мы считали генотипами «восприимчивости» к данному заболеванию.

Исходя из функциональной значимости аллелей, мы разделили генотипы, представленные в породах на следующие группы: устойчивости/устойчивости (УУ); устойчивости/нейтральный (УН); устойчивости/восприимчивости (УВ);

восприимчивости/нейтральный (ВН); восприимчивости/восприимчивости (ВВ);

нейтральный/нейтральный (НН).

Генотипы «устойчивости» к лейкозу относятся к первым трем группам, «восприимчивости» к четвертой и пятой. Частоты генотипов, относящихся к данным группам, представлены на рисунке 1.

Подобный анализ проводился ранее для черно-пестрой породы КРС (Нассири, 2005). В исследуемую группу входили здоровые (n=17) и больные (n=33) животные. Среди здоровых животных частота встречаемости генотипов устойчивости была очень высокой – 70,5%, а у больных животных такие генотипы вообще не встречались, все генотипы в данной группе несли только аллели восприимчивости нейтральные аллели. Если рассматривать суммарную выборку животных этой породы, не учитывая их статус по отношению к лейкозу, то суммарная частота генотипов устойчивости составит 35,29%, а генотипов, несущих аллели восприимчивости и не несущих аллели устойчивости, - 61,77%, т.е. почти в два раза выше.

Практически у всех изученных пород, за исключением якутского и чернопестрого КРС, преобладают BoLA-DRB3-генотипы, ассоциированные с устойчивостью к лейкозу. У якутского и черно-пестрого скота преобладали генотипы, ассоциированные с восприимчивостью к данному заболеванию.

Наиболее часто встречается сочетание в рамках одного генотипа аллеля, ассоциированного с устойчивостью к лейкозу, и аллеля, нейтрального по отношению к лейкозу, то есть генотип группы УН.

Достоверные различия выявлены у монгольской породы (2=8,38;

V2=8,32; 2 с поправкой Йетса=7,04; k=1; р=0,0038) и костромской породы (2=48,64; V2=48,4; 2 с поправкой Йетса=46,59; k=1; р0,001) КРС. Различия между частотами генотипов разных групп у калмыцкого скота соответствуют нижнему порогу уровня значимости (2=3,59; р=0,058; V2=3,56; р=0,059; 2 с поправкой Йетса=2,91; k=1; р=0,088). У якутского, зебувидного, ярославского, красно-пестрого и черно-пестрого КРС различия между частотами генотипов разных групп недостоверны.

Обращает на себя внимание костромская порода КРС, у которой разница между частотами генотипов, определяющих устойчивость (преобладающие) и восприимчивость к лейкозу составляет 39,1%. Частота аллелей, ассоциированных с устойчивостью к данному заболеванию составляет 28%.

Отмечено, что животные костромской породы редко заболевают лейкозом, что - 17 - Рисунок 1. Распределение BoLA-DRB3-генотипов согласно их функциональной значимости у изученных пород КРС.

Различия между частотами генотипов разных групп у изученных пород статистически достоверны (2=52,15, р0,001 для генотипов «устойчивости» и 2=51,17, р0,001, k=7).

определяется высокой частотой генотипов (а не аллелей), ассоциированных с устойчивостью к данному заболеванию.

У монгольской и калмыцкой пород частота генотипов «устойчивости» к лейкозу (22, 4% и 37,5% соответственно) также превышает частоту аллелей «устойчивости» к этому заболеванию (14,8% и 24,2% соответственно). Эти породы относятся к единому турано-монгольскому корню происхождения.

Согласно эпизоотическим исследованиям, животные этой группы обладают повышенной устойчивостью к лейкозу.

К данному корню происхождения относится и якутский КРС. Но у животных этой породы практически отсутствуют генотипы, определяющие устойчивость к лейкозу. Это может быть связано с тем, что данная порода долгое время формировалась без контакта с вирусом лейкоза крупного рогатого скота, что привело к исчезновению в популяции аллелей и генотипов, контролирующих устойчивость к этому типу рака.

У ярославского и красно-пестрого скота преобладают аллели, ассоциированные с восприимчивостью к лейкозу, а генотипы - ассоциированные с устойчивостью к данному заболеванию, что позволяет поддерживать благоприятный фон по устойчивости к лейкозу в этих породах.

У черно-пестрого КРС преобладают BoLA-DRB3-аллели и генотипы, ассоциированные с восприимчивостью к данному заболеванию.

Неспецифическим фактором устойчивости к лейкозу популяции в целом может служить уровень гетерозиготности. Ранее было показано, что высокий уровень гетерозиготности в группе соответствует высокому уровню устойчивости к лейкозу. Во всех изученных породах, за исключением якутской, уровень гетерозиготности в популяции был высоким, хотя и ниже ожидаемого (-0,462

Распределение частот аллелей гена BoLA-DRB3 у исследованных пород КРС в связи с устойчивостью к другим заболеваниям На сегодняшний день выделены аллели гена BoLA-DRB3, ассоциированные с устойчивостью (*07, *11, *13, *18, *27) и восприимчивостью (*16, *23, *26) к маститу, а также с устойчивостью к таким заболеваниям, как цистит (*16, *22), отслоение плаценты (*3), клещевое заболевание, вызываемое иксодовыми клещами Boophilus miсroplus. Для аллелей *08, *22, *24 разные авторы отмечают ассоциации и с устойчивостью, и с восприимчивостью к маститу.

Все исследованные породы демонстрируют преобладание аллелей, ассоциированных с устойчивостью к маститу (31,34<2<93,73; k=7; p0,001).

Аллели, ассоциированные с устойчивостью к клещевому заболеванию (Boophilus microplus), достаточно хорошо представлены в изученных породах - 19 - КРС (максимальная частота - 20,4% у монгольского КРС; минимальная частота - 3,7% у черно-пестрого КРС). Аллель *3, ассоциированный с низким риском отслоения плаценты, встречается у данных пород достаточно редко (максимальная частота - 7,4% обнаружена у черно-пестрого КРС;

минимальная частота - 2,5% у ярославского КРС). У калмыцкого, якутского и костромского скота этот аллель отсутствовал. Максимальная частота (17,9%) аллелей, ассоциированных с устойчивостью к циститу, обнаружена у красно-пестрого КРС, минимальная (1,4%) – у монгольского КРС. Различия по частотам аллелей, ассоциированных с устойчивостью к данным заболеваниям между исследованными породами достоверны (37,35< 2<44,87; k=7; р0,001).

Распределение аллелей гена BoLA-DRB3, ассоциированных с признаками молочной продуктивности Различные аллельные варианты гена BoLA-DRB3 ассоциированы с такими признаками молочной продуктивности, как количество соматических клеток (Somatic cell count, SCC) в молоке (повышенное - *8, *22, *23, сниженное - *3,*11), белковость молока (повышенная - *3, *9, *11, *26, сниженная - *22), объем удоев (повышенный - *8, *11, *23, сниженный - *22). По видимому, это связано с тесным физическим сцеплением гена BoLADRB3 и гена пролактина.

Преобладание у костромского КРС аллелей, ассоциированных в пониженным параметром SCC (суммарная частота 12,7%) хорошо согласуется с эпизоотическими данными об устойчивости этой породы к лейкозу и маститу. Преобладание у зебувидного скота аллелей, ассоциированных с повышенным SCC (суммарная частота 20%) может служить косвенным признаком предрасположенности животных этой породы к лейкозу и маститу. Преобладание у костромского КРС аллелей, ассоциированных с повышением удоев и белковости молока (суммарная частота 21,2%) хорошо согласуется с наблюдаемыми показателями молочной продуктивности у этой породы. У зебувидного скота велик процент неблагоприятных аллелей. Различия частот аллелей, ассоциированных с различными признаками молочной продуктивности, статистически достоверны (56,48< 2<122,51; k=7; р0,001).

Характер распределения частот аллелей, ассоциированных с признаками молочной продуктивности схож у калмыцкой, костромской, канадской голштинской, иранской голштинской, иранской систани, красной горбатовской, японской шортгорнской, российской черно-пестрой пород КРС. У этих пород высоки частоты аллелей, ассоциированных с повышенным SCC и с увеличением удоев. У голштинского скота Канады и Ирана частоты этих аллелей крайне высоки. Айрширская порода КРС и - 20 - бразильская зебувидная гир обладают такими же низкими частотами аллелей, как и якутский КРС.

Идентификация новых форм и классификация изолятов вируса лейкоза крупного рогатого скота России и Украины, на основе анализа изменчивости вирусного гена pol ВЛКРС принадлежит к семейству Retroviridae, роду Deltaretrovirus. К этому же роду относятся и Т-лимфотропные вирусы человека I и II типов (HTLV). ВЛКРС обладает тропизмом к лимфоидным клеткам и размножается в них. Зрелые вирусы обнаруживаются в лимфоцитах и в молоке. Вирус проникает в клетку путем эндоцитоза, В клетке, на геномной РНК вируса обратная транскриптаза синтезирует двухцепочечную ДНК-копию, которая встраивается в геном, образуя провирус. Генетическая карта генома ВЛКРС представлена на рисунке 2.

Рисунок 2. Структура провируса ВЛКРС. Провирус фланкирован двумя идентичными ДКП. Светло-серыми прямоугольниками под рисунком отмечены открытые рамки считывания. Темно-серыми прямоугольниками над рисунком отмечены изучаемые ОТ- и Ин-фрагменты. Локализация фрагментов дана относительно полногеномного сиквенса AF03381.

ВЛКРС распространен по всему миру. Показано, что у молочных пород доля инфицированных животных выше, чем у мясных (Murakami et al., 2011).

Для ВЛКРС, как и для других Т- лимфотропных вирусов характерна строгая видоспецифичность по отношению к хозяину и медленное развитие инфекционного процесса. Вероятность инфицирования человека изучалась с применением ряда молекулярных методов (иммуноцитохимия, ПЦР, ОТ- 21 - ПЦР). Наличие провируса ВЛКРС в тканях грудных желз показано у ряда пациентов. Анализ выборки здоровых людей, контактирующих с коровами, (240 человек) в 50% случаев показал наличие специфических антител к ВЛКРС (Buehring et al., 2003). Опасность развития лейкоза у человека в результате инфекции ВЛКРС оценивается как маловероятная, но не исключена полностью (Calattini et al, 2006).

В настоящее время основным методом обнаружения ВЛКРС и исследования разнообразия его форм является реакция иммунной диффузии, (РИД) и метод иммуноферментного анализа (ИФА). Методы ДНКдиагностики находятся в стадии разработки и оптимизации. Для последней используют ПЦР на вирусные гены: gag (ген белка нуклеокапсида), pol (ген обратной транскриптазы), env (ген белка внешней оболочки), tax (транскрипционный активатор вирусной экспрессии). Наиболее подробные данные получены по изменчивости гена env. Описано несколько типов этого гена, среди которых есть как широко распространнные, так и эндемичные для отдельных географических локальностей (Rodriguez et al., 2009;

Moratorio et al., 2010; Matsumura et al., 2011). Интерес к гену env определн вероятным участием этого гена в определении степени инфекционности данного изолята вируса. Вместе с тем, высокая изменчивость env генов может привести к ложноотрицательным результатам типирования. Для наджного выявления всех вариантов вируса лучше подходит самый консервативный вирусный ген pol, кодирующий белок с доменами обратной транскриптазы (ОТ), интегразы (Ин) и другие консервативные энзиматические домены.

Поэтому в данной работе нами исследовано разнообразие ВЛКРС на территории России и сопредельных территорий (Украины) на основе анализа полиморфизма нуклеотидных последовательностей ОТ- и Ин-фрагментов гена pol. Анализируемый ОТ-ПЦР фрагмент соответствует домену обратной транскриптазы гена pol ВЛКРС, а Ин-ПЦР фрагмент соответствует домену интегразы. Два фрагмента гена pol были взяты для анализа для того, чтобы можно было выявить возможные рекомбинационные события и их значимость для эволюционного изменения генома вируса.

Всего нами получено и проанализировано 18 нуклеотидных последовательностей ОТ-фрагмента и 21 последовательность для ИНфрагмента гена pol ВЛКРС. Полученные нуклеотидные последовательности зарегистрированы в базе данных GeneBank под номерами JQ319122- JQ319160. Помимо собственных данных для проведения сравнительного анализа были взяты имеющиеся в базе данных NCBI последовательности:

Аргентина (FJ914764, AF257515), США (AF033818, EF600696, K02120, M10987), Австралия (D00647), Бразилия (DQ288972, DQ288973, DQ288977, DQ288979, DQ288980), Северная Италия (S83529).

Реконструкция филогенетических отношений изолятов ВЛКРС построенная на основе анализа изменчивости ОТ-фрагмента приведена на - 22 - рис. 3. Анализ филограммы ОТ-фрагментов выявляет несколько кластеров с бутстреп поддержкой менее 50% и низкой внутригрупповой изменчивостью (не более 2%). Эти группы на рисунке обозначены как BLV формы.

Сравнение филограмм ОТ- и Ин-фрагментов не выявляет топологических конфликтов. Следовательно, рекомбинация внутри гена pol, нами не выявлена.

Рисунок 3. Реконструкция филогенетических взаимоотношений изолятов ВЛКРС по изменчивости ОТ-фрагмента гена pol. Филограмма построена методом NJ с бутстерп поддержкой 500 реплик. Цифры обозначают величину бутстреп поддержки ветвей филограммы. Масштаб горизонтальной оси обозначает долю изменчивых нуклеотидов между сравниваемыми последовательностями.

- 23 - Сопоставление географической локализации изучаемых изолятов и их филогенетической близости позволяет сделать ряд выводов. Наиболее гетерогенная популяция ВЛКРС выявлена нами в Украинском хозяйстве. В нм найдено три дальнородственных типа ВЛКРС, которые вероятно попали в него с разными животными.

Образцы первого хозяйства из Подмосковья по ОТ-фрагменту образуют один кластер. Это говорит о том, что данное хозяйство было заражено один раз одной разновидностью вируса, который затем распространился внутри хозяйства. Во втором Подмосковном хозяйстве, единый кластер, распадается на две ветви, что может быть результатом мутации вируса внутри хозяйства в ходе его экспансии, или о двух событиях проникновения ВЛКРС, относящихся к одному типу. Образцы из хозяйства в Краснодаре попадают в два разных кластера, что говорит о том, что данное хозяйство было заражено минимум дважды.

Таким образом, мы предлагаем использовать наиболее консервативный домен обратной транскриптазы вируса ВЛКРС как стандарт для определения форм вируса. Учитывая редкость рекомбинационных событий в генофонде ВЛКРС, можно предположить, что биологические свойства отдельных изолятов вируса, такие как инфекционность и вирулентность можно будет обобщать на всех представителей данной формы вируса.

Полученные данные позволили предложить классификацию изолятов ВЛКРС и метод их обнаружения, пригодный для практического животноводства ВЫВОДЫ:

1. Высокий уровень аллельного разнообразия гена BoLA-DRB3 показан для монгольской, калмыцкой, ярославской и черно-пестрой пород крупного рогатого скота. Число аллелей варьировало у этих пород от 28 до 36. Для якутского скота продемонстрирован крайне низкий уровень аллельного разнообразия гена BoLA-DRB3 (14 аллелей), что, по-видимому, объясняется инбредной депрессией, возникшей в результате длительной изоляции данной группы и ее низкой численностью.

2. Характер распределения частот аллелей гена BoLA-DRB3 у костромского, зебувидного и якутского КРС сходен с описанным для большинства европейских пород: на 5-6 аллелей приходится 74-88,6% аллельного разнообразия, остальные встречаются с частотой менее 5%. У монгольского, калмыцкого, ярославского, черно-пестрого КРС частоты аллелей распределены более равномерно: на долю 4-8 аллелей с частотой более 5% приходится 34,1-54,3% аллельного разнообразия.

3. Генотипы по BoLA-DRB3 во всех изученных породах КРС, за исключением якутской, распределены равномерно. Во всех исследованных породах наблюдается недостаток гетерозигот (-0,462

- 24 - 4. Аллели и генотипы по BoLA-DRB3, ассоциированные с устойчивостью к лейкозу и маститу, широко представлены у монгольского, калмыцкого, зебувидного и костромского скота, что указывает на высокий генетический потенциал местных пород в отношении устойчивости к заболеваниям.

5. Выявлены новые эндемичные для России формы вируса лейкоза КРС на основе анализа полученных в работе нуклеотидных последовательностей двух областей гена pol, кодирующих обратную транскриптазу и интегразу.

6. Предложена новая классификация форм вируса лейкоза КРС на основе анализа изменчивости гена pol. Рекомбинация между разновидностями вируса не выявлена.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ:

Статьи в журналах, рецензируемых ВАК:

1. Генджиева О.Б., Рузина М.Н., Сулимова Г.Е. Анализ генетических факторов устойчивости калмыцкой породы крупного рогатого скота к лейкозу // Молочное и мясное скотоводство. 2008. №12. С.9-10.

2. Рузина М.Н., Штыфурко Т.А., Мохаммад Абади М.Р., Генджиева О.Б., Цэндсурен Цедев, Сулимова Г.Е.. Полиморфизм гена BoLA-DRB3 у крупного рогатого скота монгольской, калмыцкой и якутской пород // Генетика, 2010, т.46, № 4, С.517–525.

3. Сулимова Г.Е., Лазебная И.В., Перчун А.В., Воронкова В.Н., Рузина М.Н., Бадин Г.А. Уникальность костромской породы крупного рогатого скота с позиции молекулярной генетики // Достижения науки и техники АПК. 2011. №9. С 52-54.

4. Рузина М.Н., Андрианов Б.В., Шайхаев Г.О., Сулимова Г.Е.

Идентификация новых форм и классификация изолятов вируса лейкоза крупного рогатого скота России и Украины, на основе анализа изменчивости вирусного гена pol // Генетика. 2012. т.48. № 7. С.810815.

Тезисы научных докладов:

1. Рузина М.Н., Штыфурко Т.А., Мохаммад Абади М., Генджиева О.Б., Цедев Ц., Сулимова Г.Е. Полиморфизм гена BoLA-DRB3 у крупного рогатого скота якутской, калмыцкой и монгольской пород // «Постгеномная эра в биологии и проблемы биотехнологии», КГУ, Казань, 15-16 сентября 2008г.

2. Рузина М.Н., Штыфурко Т.А., Мохаммад Абади М.2, Генджиева О.Б., Цедев Ц., Сулимова Г.Е. Аллельный полиморфизм гена BoLA-DRB3 у - 25 - пород крупного рогатого скота турано-монгольского корня // «БиоТехЖ-2008», ВИЖ, Дубровицы, 16-17 октября 2008г.

3. Рузина М.Н., Ребриков Д.В., Сулимова Г.Е. Сравнение нуклеотидных последовательностей разных субтипов вируса лейкоза крупного рогатого скота // Материалы 12-й международной школы-конференции молодых ученых «Биология – наука XXIвека», Пущино, 10-14 ноября 2008г.

4. Сулимова Г.Е., Рузина М.Н., Ребриков Д.В. Существуют ли российский субтипы вируса лейкоза крупного рогатого скота // Материалы XVII Международной конференции: «Новые информационные технологии а медицине, биологии, фармакологии и экологии». Ялта-Гурзуф. 2009. С.43-45.

5. Рузина М.Н., Штыфурко Т.А., Мохаммад Абади М.Р., Генджиева О.Б., Цэндсурен Цедев, Сулимова Г.Е. Исследование полиморфизма гена BoLA-DRB3 у крупного рогатого скота турано-монгольского корня // V съезд Вавиловского общества генетиков и селекционеров, ИОГен им. Н.И. Вавилова РАН и МГУ им. М.В. Ломоносова, Москва, 21-июня 2009г.

6. Рузина М.Н., Сулимова Г.Е. Анализ полиморфизма гена BoLA-DRB3 у Костромского КРС // 10-я научная конференция молодых ученых «Биотехнология в растениеводстве, животноводстве и ветеринарии», 07.04.2010г., Москва.

7. Рузина М.Н., Штыфурко Т.А., Мохаммад Абади М.Р.,Сулимова Г.Е.

Анализ полиморфизма гена BoLA-DRB3 у костромской, ярославской, красно-пестрой и черно-пестрой пород КРС. // Международная молоджная конференция «Популяционная генетика: современное состояние и перспективы», посвященная памятной дате, 75-летию со дня рождения академика Ю.П. Алтухова, 17-18 ноября 2011г., Москва, Россия.

- 26 -






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.