WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

МУХАММЕД МУКБЕЛЬ МАРЕАЙ

АДАПТАЦИЯ ТРАНСГЕННЫХ РАСТЕНИЙ РАПСА (Brassica napus L.) СО ВСТРОЕННЫМ ГЕНОМ ТРАНС-ФАКТОРА Osmyb4 РИСА К ТЯЖЕЛЫМ МЕТАЛЛАМ

03.01.05 – физиология и биохимия растений

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва – 2012

Работа выполнена в лаборатории физиологических и молекулярных механизмов адаптации Федерального государственного бюджетного учреждения науки Института физиологии растений им. К.А. Тимирязева Российской академии наук и на кафедре ботаники, физиологии растений и агробиотехнологии Российского университета дружбы народов, Москва.

Научный консультант:

кандидат биологических наук Ралдугина Галина Николаевна Научный консультант:

доктор биологических наук профессор, чл.-корр. РАН Кузнецов Владимир Васильевич

Официальные оппоненты:

Балнокин Юрий Владимирович. доктор биологических наук, профессор, Федеральное государственное бюджетное учреждение науки Институт физиологии растений им. К.А. Тимирязева Российской академии наук, лаборатория солевого обмена и солеустойчивости, заведующий лабораторией Тараканов Иван Германович, доктор биологических наук, профессор, Российский государственный аграрный университет – МСХА им. К.А. Тимирязева, кафедра физиологии растений, заведующий кафедрой

Ведущая организация: Федеральное государственное бюджетное учреждение науки Институт биологии Карельского научного центра Российской академии наук

Защита состоится 19 июня 2012 г. в 13:00 часов на заседании диссертационного совета Д 002.210.01 при Федеральном государственном бюджетном учреждении науки Институте физиологии растений им. К.А. Тимирязева Российской академии наук по адресу: 127276,г. Москва, ул. Ботаническая, 35. Факс: (499)977 80 18, e-mail: ifr@ippras.ru

С диссертацией можно ознакомиться в библиотеке Федерального государственного бюджетного учреждения науки Института физиологии растений им. К.А. Тимирязева Российской академии наук

Автореферат разослан «18» мая 2012 г.

Ученый секретарь диссертационного совета канд. биол. наук Азаркович Марина Ивановна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы. Одним из негативных результатов бурного развития промышленности является загрязнение среды обитания тяжелыми металлами (ТМ), к которым относятся химические элементы, имеющие плотность больше 5 г/см3 и атомную массу более 40 Да (Кузнецов, Дмитриева, 2011). Многие ТМ, такие, например, как медь и цинк, являются эссенциальными элементами, т.е.

элементами, которые в низких концентрациях жизненно необходимы для нормального роста и развития организма (Kholodova et al., 2011). Тем не менее, в высоких концентрациях они негативно влияют как на жизнь растений, так и на здоровье человека, накапливаясь в организме и вызывая различные нарушения.

Так, высокие концентрации ТМ вызывают ингибирование роста растений и снижение урожая, торможение фотосинтеза и дыхания, нарушение синтеза белка и донорно-акцепторных отношений, инактивацию ключевых ферментов метаболизма, изменение водного и гормонального статуса и даже гибель организма (Титов и др., 2007; Kholodova et al., 2011).

Растения могут адаптироваться к токсическому действию высоких концентраций ТМ. В основе этой адаптации лежит формирование и функционирование как специализированных (хелатирование, секвестрация и компартментация ТМ), так и общих механизмов устойчивости (низкомолекулярные органические стресс-протекторные соединения, защитные макромолекулы и антиоксидантные системы) (Hall, 2002; Clemens, 2006; Кузнецов, 2009). Клетки растений воспринимают действие стрессорных факторов и передают внешний сигнал на особые регуляторные белки, называемые транскрипционными факторами или транс-факторами (Vannini et al., 2006), которые вызывают изменение экспрессии генов и формирование стресс-протекторных систем.

Знание механизмов устойчивости растений к ТМ позволяет получить методами генной инженерии трансгенные растения, обладающие большей устойчивостью к токсическому действию ТМ. Для этой цели можно переносить в сельскозяйственные культуры (1) гены, участвующие в хелатировании ионов (Lefebvre et al., 198; Gasic et al., 2005), (2) гены, продукт которых превращает высокотоксичные формы в менее токсичные (Bizilli, 1999), (3) гены общих механизмов устойчивости или, наконец, (4) гены, кодирующие транс-факторы (Mattana et al., 2005; Latchman, 2007; Гомаа и др., 2012).

Одним из наиболее перспективный биотехнологических путей получения растений, обладающих повышенной устойчивостью к ТМ, является использование генов транс-факторных белков. Транс-факторные белки взаимодействуют с ДНК (либо с другими белками, а затем с ДНК), в результате чего образуется комплекс белок-ДНК, регулирующий экспрессию большого числа генов, в том числе и генов стрессорного ответа (Latchman, 2007). В растениях весьма распространены транскрипционные факторы MYB семейства (Vannini et al., 2006). К этому семейству относится и используемый в данной работе ген Osmyb4, который был изолирован из генома растений риса (Pandolfi et al., 1997).

Ранее было установлено, что сверхэкспрессия гена Osmyb4 риса в трансгенных растениях A. thaliana приводила к повышению засухо- и холодоустойчивости (Vannini et al., 2004, Mattana et al., 2005), а также сопровождалась повышением устойчивости растений ярового рапса (Brassica napus L.) к низким положительным и отрицательным температурам (Гомаа и др., 2012).

При этом было показано, что повышение устойчивости этих трансгенных растений сопровождается интенсивной аккумуляцией совместимых осмолитов, обладающих стресс-протекторным эффектом (пролин, сахара и т.п.), а также низкомолекулярных органических соединений с антиоксидантной активностью (Mattana et al., 2005; Гомаа и др., 2012). На этом основании нами было высказано предположение, что трансгенные растения рапса с суперэкспрессией гена Osmybриса могут быть устойчивы не только к засухе и низкотемпературному стрессу, но также и к повреждающему воздействию высоких концентраций ТМ, в частности, солей меди и цинка. Несмотря на то, что получение трансгенных растений рапса с повышенной устойчивостью к ТМ актуально как с теоретической, так и с практической точек зрения, до сих пор оно никем не проводилось.

Цель и задачи исследования. Цель данной работы заключалась в том, чтобы выяснить, сопровождается ли суперэкспрессия гена Osmyb4 риса в растениях рапса повышением устойчивости к действию тяжелых металлов и, если сопровождается, то каковы физиологические механизмы этого явления.

В соответствии с этой целью были поставлены следующие задачи:

(1) Изучить наследование трансгена Osmyb4 риса в растениях рапса и его экспрессию.

(2) Исследовать влияние высоких концентраций ТМ на некоторые физиологические процессы у трансгенных растений.

(3) Исследовать влияние ТМ на функционирование антиоксидантных систем у трансгенных растений рапса.

(4) Исследовать экспрессию некоторых генов устойчивости растений к ТМ.

Научная новизна работы. Показано, что в процессе генеративного размножения трансгенных растений рапса ген трансфакторного белка Osmybнаследуется и активно экспрессируется в процессе адаптации к тяжелым металлам.

Установлено, что экспрессия трансгена Osmyb4 в растениях рапса сопровождается повышением устойчивости к тяжелым металлам, в основе которой лежит снижение интенсивности окислительного стресса в результате аккумуляции низкомолекулярных органических антиоксидантов и увеличение активности антиоксидантных ферментов, с одной стороны, и накопление совместимых осмолитов, с другой. Впервые установлено, что интенсивная экспрессия гена Osmyb4 транс-фактора риса в растениях рапса в ответ на воздействие ТМ сопровождается активацией «работы» генов различных метаболических путей, обеспечивающих формирование защитных механизмов и повышение устойчивости к повреждающему действию тяжелых металлов.

Практическая ценность работы. Рапс (Brassica napus L.), выбранный в данной работе в качестве объекта исследования, является многоцелевой культурой, поэтому очень важно получить растения, обладающие устойчивостью к действию многих абиотических стрессоров. Созданные и изученные трансгенные растения рапса могут быть использованы в селекционной практике в качестве исходных линий для создания новых сортов растений с повышенной устойчивостью к тяжелым металлам. Данные, полученные в настоящей работе и сделанные на их основе обобщения, могут быть использованы в курсах лекций по стрессфизиологии и трансгенозу для студентов различных учебных заведениях.

Апробация работы. Результаты работы были представлены: на Международной научно-практической конференции преподавателей, молодых ученых и аспирантов аграрных вузов РФ (Москва, 2010); Всероссийском симпозиуме "Растение и стресс" (Москва. 2010), на VII съезде Общества физиологов растений России, на Международной конференции «Физиология растений – фундаментальная основа экологии и инновационных биотехнологий» (Нижний Новгород, 2011), на II Международной школе-конференции молодых ученых «Генетика и селекция растений, основанная на современных генетических знаниях и технологиях» Москва-Звенигород, 5-10 декабря 2011.

Публикации. По теме диссертации опубликовано 5 работ, Структура и объем диссертации. Диссертационная работа состоит из введения, 5 глав, выводов и списка цитированной литературы. Объем работы составляет 130 страниц. В диссертации содержится 20 рисунков, 15 таблиц. Список цитированной литературы содержит 251 источник, в том числе 208 – на иностранных языках.

ОБЪЕКТ И МЕТОДЫ ИССЛЕДОВАНИЯ Объект исследования. Объектом исследования были трансгенные и нетрансформированные растения Brassica napus var. napus ярового рапса сорта Вестар канадской селекции. Трансформированные растения рапса с геном Osmybриса были созданы ранее в ИФР РАН. Полученные через культуру тканей растения размножали черенкованием in vitro на модифицированной среде Мурасиге-Скуга, После укоренения черенков их помещали в условия гидропонной культуры на среду Хогланда-Снайдерс при 24оС в условиях фитотрона с фотопериодом 12/день/ночь. Соли меди и цинка вносили в питательную среду в концентрациях:

CuSO4 – от 25 до 150 мкМ; ZnSO4 – от 500 до 5000 мкМ Методы исследования. Биомассу и содержание воды в растительном материале оценивали, используя гравиметрический метод. Сухую массу определяли после фиксации материала при 90оС и высушивания при 70оС до постоянного веса. Содержание воды (% от сырой массы) рассчитывали, исходя из разности свежей и сухой биомасс.

Содержания меди и цинка в тканях растений проводили по методу мокрого озоления, содержание пигментов определяли по методу Шлык (1971), содержание малонового диальдегида (МДА) определяли по методу Heath and Packer (1968).

Содержание свободного пролина - по методу Bates et al. (1973). Активность СОД – по методу Beauchamp, Fridovich (1971), определение активности пероксидазы проводили по методу Ridge, Osborne (1971). Определение растворимых фенольных соединений проводили по методу Фолина-Дениса (Загоскина и др., 2003), содержание флавоноидов - по методу Gage (Gage, Wendei, 1950), содержание антоцианов - по методу Муравьевой (Муравьева и др., 1987), содержание белка - по методу Esen (1978). Тотальную ДНК выделяли методом Fulton (Fulton et al., 1995), обрабатывали ее РНКазой (Serva, Германия) и оценивали качество ДНК с помощью электрофореза в агарозном геле. Тотальную РНК выделяли фенольным методом по Westhoff et al. (1981). Очистку ДНК от примесей, обратную транскрипцию и полимеразную цепную реакцию (ПЦР) проводили с использованием реактивов фирм «Fermentas» (Литва) и «СибЭнзим» (Россия). Подбор праймеров осуществляли с помощью программ Oligo 6.71. Для ПЦР использовали праймеры, синтезированные фирмой «Литех» (Россия):





Таблица Последовательности праймеров, использованных в полимеразной цепной реакции после обратной транскрипции Ген Последовательность (5'-3') s - CGGGAGGACGGACAACGAG myb as - GGATGGCGGCGCGACGAAC nptII s - GTGGAGAGGCTATTCGGCTA as - CCACCATGATATTCGGCAAGZIP4 s - GCTGCTGGTAGTGAAGAGAT as - ATCAGCTGCGATGAGGTCCA ZIP1 s - GGAAGAACCAAGCTCCTTATCAT as - CAAATCATTCGCCTCTGGAA PDH s - GAATCGAGTCCTCTCTACCA as - CACCAACTTGAACCCCATAG P5CS s - AATGCTATCTTACACAAGGTGAT as - ACCATCAGAGAATCTTGTGCT PCS s - ATCAGACCACCATTGACGACTT as - GAACTCACAAGACGAGGAACATCT 18SrRNA s - GAGTGATGTGCCAGACCTAGGAATT as - ATGCTGATCCGCGATTACTAGC Примечание: s – прямой праймер; as - обратный праймер.

Все опыты были поставлены в трехкратной биологической повторности.

Аналитическая повторность для каждой из них равна 3. Результаты обработаны с использованием пакета программ Windows Exel. Бары показывают относительную ошибку среднего.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Наследование трансгена Osmyb4 риса в растениях рапса и его экспрессия при действии ТМ Семена 2-го поколения трансгенных растений рапса проращивали в стерильных условиях; из семядолей проростков выделяли ДНК. Затем с помощью ПЦР проверяли наличие в проростках трансгенов Osmyb4 и nptII. При этом было показано, что из 50 трансгенных растений целевой ген Osmyb4 присутствовал в проростках, селективный ген устойчивости к Км nptII - в 35 проростков, тогда как одновременно оба эти трансгена обнаруживались лишь в 25 проростках (табл. 2).

Таблица 2. Наследование трансгенов Osmyb4 и nptII Число Число Число Число Число растений с Число растений, высажен- исследо- растений с растений с генами Osmyb4 и экспрессировавных ванных геном геном nptII nptII ших ген Osmybcемян растений Osmyb50 50 40 35 25 В дальнейшем 25 растений, содержавших оба трансгена, были размножены черенкованием и высажены в сосуды с питательным раствором, содержавшие 30мкМ ZnSO4 или 50 мкМ CuSO4. Спустя 15 суток от начала эксперимента из каждого растения была выделена тотальная РНК, которую использовали для проведения ОТ-ПЦР. Проведенный анализ показал, что из 25 полученных нами трансгенных растений, содержавших оба гена Osmyb4 и nptII, экспрессия гена Osmyb4 на уровне образования транскриптов наблюдалась только у 7 растений, тогда как у остальных 18 растений ген Osmyb4 не экспрессировался, хотя и присутствовал в геноме (табл. 2, рис. 1А). Следует особо отметить, что в каждом из растений трансген Osmyb4 избирательно экспрессировался лишь в ответ на действие или ZnSO4 или CuSO4. Так, было установлено, что в 5 из 7 растений, способных экспрессировать трансген Osmyb4, он активировался в ответ на воздействие ZnSO4, а у 2-х других растений – в ответ на воздействие CuSO4.

Для дальнейшей работы по исследованию физиологии трансгенных растений рапса со встроенным геном Osmyb4 риса было выбрано по одному растению для изучения действия каждой из исследуемых солей: растение линии №5 - для изучения воздействия ZnSO4 и растение линии №6 - для изучения влияния CuSO4.

1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 А Б В Г Рис. 1. Экспрессия гена Osmyb4 у трансгенных растений рапса в ответ на действие солей тяжелых металлов.

Уровень индивидуальных транскриптов Osmyb4 (А) и R18 (Б) оценивали с помощью ОТ-ПЦР. Из листьев растений, обработанных солями ТМ, выделяли тотальную РНК, на которой синтезировали кДНК и амплифицировали её с помощью ПЦР со специфическими прймерами к генам Osmyb4 и R18. Фрагмент гена R18 использовали в качестве внутреннего контроля (для нормализации результатов).

А – уровни транскриптов Osmyb4 гена в трансгенных растениях: 1, 2, 3, 4, 5 – в условиях действия 3000 мкМ ZnSO4; 6, 8 – при действии 50 мкМ CuSO4; 7 – вода; 9 – ДНК из нетрансформированного растения; 10 – использованная плазмида; 11 - маркер;

Б – уровни транскриптов гена R18; 1–7 – трансгенные растения; 8 – нетрансформированное растение.

В – уровни транскриптов Osmyb4 гена при воздействии на растения CuSO4;

Г – уровни транскриптов Osmyb4 гена при воздействии на растения ZnSOТрансгенные растения 2-х отобранных линий №5 и №6 были размножены черенкованием и высажены в сосуды с питательной средой, в которую были добавлены соли CuSO4 и ZnSO4 в указанных на рис. 1 концентрациях. Через 7 и суток экспонирования из растений выделяли тотальную РНК и оценивали относительное содержания транскриптов гена Osmyb4 (рис. 1В, Г).

Как следует из полученных данных, при низких концентрациях ТМ (25 мкМ для CuSO4; 500 и 1000 мкМ - для ZnSO4) трансген Osmyb4 не экспрессировался, тогда как при более высоких концентрациях каждой из солей наблюдалась его интенсивная экспрессия. При этом интенсивность экспрессии гена Osmyb4 была значительно выше на 15 сутки экспозиции растений на растворе CuSO4 по сравнению с 7 сутками (рис. 1В) При действии ZnSO4 в течение 7 суток экспрессия гена наблюдалась лишь для самой высокой из испытанных нами концентраций - 5000 мкМ. Причем, уровень транскриптов этого гена повышался лишь через суток воздействия более низких концентраций ZnSO4 (2000 и 3000 мкМ) (рис.1Г).

Накопление сырой биомассы и оводнённость растений Для сравнительной оценки устойчивости трансгенных и нетрансформированных растений изучали их способность выживать и накапливать биомассу при различных концентрациях ТМ. Отобранные нами линии растений были размножены черенкованием и высажены в сосуды с питательной средой, содержавшей CuSO4 в концентрациях от 25 до 150 мкМ и ZnSO4 от 500 до 50мкМ. Выживаемость растений и накопление ими биомассы определяли через суток воздействия ТМ (рис. 2).

Из результатов, представленных на рис. 2, прежде всего, видно, что к 15 дню экспозиции при самых высоких из использованных нами концентраций CuSO4 (1мкм) и ZnSO4 (5000 мкМ) нетрансформированные растения погибали, тогда как трансгенные оставались живыми. Этот аргумент однозначно свидетельствует о более высокой устойчивости к ТМ трансгенных растений, экспрессирующих ген Osmyb4 риса.

876543210 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSO мкМ Рис. 2. Накопление биомассы растениями рапса при действии различных концентраций CuSO4 или ZnSOПрирост биомассы рассчитывали в % к массе исходных нетрасформированных и трансгенных растений, которую принимали за 100%.

1 – нетрансформированные растения; 2 – трансгенные растения Выращивание растений на фоне возрастающих концентраций солей меди и цинка сопровождалось ингибированием роста используемых линий рапса, при этом CuSO4 ингибировал рост сильнее, чем ZnSO4 (рис. 2). Существенно, что накопление биомассы трансгенными растениями в присутствии различных концентраций ZnSO4 было менее выражено, чем нетрансформированными.

Подобная же закономерность наблюдается при действии высоких концентраций CuSO4, что говорит о большей устойчивости к ТМ трансгенных растений.

Одновременно измеряли оводненность листовой ткани как показатель способности растений поддерживать водный статус в неблагоприятных условиях.

Полученные результаты (рис. 3) показали, что через 15 дней эксперимента оводнённость листьев контрольных растений, росших в стандартных условиях, практически не изменялась, сохраняясь на уровне оводнённости исходных растений (93%). Оводнённость опытных растений начинала снижаться на фоне небольших концентраций как CuSO4, так и ZnSO4. При этом при небольших ) Накопление биомассы (% концентрациях CuSO4 (до 50 мкМ) и ZnSO4 (до 2000 мкМ) оводненность трансгенных и нетрансформированных растений не различалась, тогда как, начиная со 100 мкМ CuSO4 и 3000 мкМ ZnSO4, оводнённость трансгенных растений была несколько выше (82% воды при действии CuSO4 и 85% при ZnSO4), чем у нетрансформированных (содержание воды - 80% для CuSO4 и 84% для ZnSO4), что также говорит в пользу их большей устойчивости к ТМ.

10 25 50 100 150 500 1000 2000 3000 50 CuSO4 ZnSO мкМ Рис. 3. Оводненность растений рапса при действии различных концентраций CuSO4 или ZnSO1 – нетрансформированные растения, 2 – трансгенные растения Аккумуляция ТМ в листьях растений рапса Можно было думать, что более высокая устойчивость трансгенных растений к ТМ обусловлена их меньшей способностью аккумулировать ионы меди и цинка в тканях и, как следствие этого, более низким токсическим эффектом ТМ.

Для проверки этого предположения исследовали содержание меди и цинка в листьях рапса под влиянием 25-150 мкМ CuSO4 (рис. 4 А) и 500-5000 мкМ ZnSO(рис. 4 Б).

Было установлено, что в растениях, находившихся в течение 15 суток на стандартной питательной среде (контроль), содержавшей 0,25 мкМ CuSO4 и 1 мкМ ZnSO4, содержание меди не превышало 38 и 39 мкг на грамм сухих тканей листа.

При добавлении в питательную среду 25 мкМ CuSO4 аккумуляция металла в обеих линиях растений по сравнению с контрольными увеличивалась примерно в 1,раза. При 50 мкМ CuSO4 в питательном растворе содержание меди у трансгенных растений в 1,9 раза превышало содержание металла в контрольных растениях, тогда как у нетрансформированных растений - в 1,7 раза. После добавления в питательную среду 100 мкМ CuSO4 содержание меди выросло в 2,4 раза у нетрансформированных растений и в 2,9 раз у трансгенных растений. При дальнейшем повышении концентрации меди в растворе до 150 мкМ нетрансформированные растения погибали, а у трансгенных растений содержание металла превышало контрольные показатели более, чем в 4,8 раза.

Содержание воды (%) А Б 70260250140301201 1 100 500 1000 2000 3000 500 25 50 100 1 ZnSO4 (мкМ) CuSO4 (мкМ) Рис. 4. Содержание меди и цинка в листьях рапса при действии CuSO4 или ZnSOРастения выращивали в присутствии CuSO4 (А) или– ZnSO4 (Б).

1 – нетрансформированные растения, 2 – трансгенные растения Накопление Zn в тканях было во много раз выше, чем меди. Его содержание в листьях рапса у растений обеих линий, росших в стандартных условиях (контроль) 15 суток, в среднем не превышало 90 - 110 мкг цинка/г сухой массы листа. Аккумуляция металла при внесении в среду 500 мкМ ZnSO4 у всех линий растений превышала контроль примерно в 3 раза; при 1000 мкМ ZnSO4 - примерно в 10.5 раз. При дальнейшем повышении концентрации соли в питательном растворе накопление металла у трансгенных растений было значительно выше, чем у нетрансформированных (при 3000 мкМ превышение у трансгенов было в 37 раз, а у нетрансформированных - в 30 раз). При самой высокой испытанной нами концентрации в 5000 мкМ ZnSO4 в питательном растворе, содержание Zn в трансгенных растениях составило 6592 мкг на г сухой биомассы листьев. Все это свидетельствует о том, что большая устойчивость трансгенных растений к ТМ не может быть объяснена их меньшим содержанием в тканях, чем у нетрансформированных растений.

Влияние меди и цинка на содержание пигментов Медь и цинк являются эссенциальными элементами отчасти и потому, что вовлекаются в работу фотосинтетической системы. Однако их повышенные концентрации могут оказывать негативное действие, главным образом, через инициацию образования активных форм кислорода, вызывающих окислительный стресс и нарушающих процесс фотосинтеза.

При изучении влияния CuSO4 и ZnSO4 на трансгенные и нетрансформированные растения рапса было обнаружено, что повышение концентрации этих солей в питательном растворе негативно влияло на содержание хлорофилла в листьях рапса. Так, при внесении в питательную среду 25 мкМ CuSO4 суммарное содержание хлорофилла снижалось на 33% (табл. 3), тогда как на фоне 100 мкМ CuSO4 составляло лишь 33% от контроля в обеих линиях рапса.

Наиболее ярко негативное влияние меди проявляется на уровне хлорофилла в, г сух.биомассы) / г сух.биомассы) Содержание Zn (мкг / Содержание Cu (мкг Таблица 3. Содержание пигментов в листьях трансгенных и нетрансформированных растений рапса после воздействия солей CuSO4 или ZnSOКон Содержание пигментов, мг/ г сырой биомассы ценХл. а Хл. b Хл. (a+b) Хл. a/b Каротин Ксантофилл тр.

солей 1 2 1 2 1 2 1 2 1 2 1 мкМ 1,12±0,09 1,11±0,1 0,36±0,03 0,36±0,1,48 1,47 3,1 3,1 0,42±0,021 0,41±0,02 0,56±0,028 0,56±0,0CuSO0,96±0,06 0,95±0,04 0,19±0,01 0,2±0,02 1,15 1,15 5 4,8 0,38±0,019 0,37±0,018 0,44±0,02 0,44±0,00,41±0,02 0,39±0,02 0,12±0,01 0,12±0,01 0,53 0,51 3,4 3,3 0,15±0,007 0,16±0,01 0,22±0,012 0,23±0,010,45±0,03 0,44±0,03 0,12±0,01 0,13±0,01 0,57 0,57 3,8 3,5 0,11±0,005 0,15±0,007 0,18±0,01 0,21±0,150 4,0 0,07±0,01 0,12±0,0,36±0,03 0,09±0,01 0,ZnSO50,41±0,02 0,4±0,02 0,14±0,01 0,14±0,02 0,56 0,54 3,7 3,5 0,39±0,02 0,39±0,016 0,51±0,022 0,50±0,0100,36±0,02 0,35±0,02 0,11±0,02 0,11±0,01 0,47 0,46 3,3 3,2 0,29±0,02 0,31±0,012 0,39±0,02 0,40±0,200,27±0,01 0,26±0,01 0,09±0,02 0,1±0,01 0,36 0,36 3,0 2,6 0,15±0,008 0,16±0,007 0,28±0,03 0,29±0,0300,21±0,01 0,22±0,01 0,04±0,01 0,05±0,01 0,25 0,27 5,3 4,4 0,11±0,005 0,16±0,008 0,22±0,01 0,25±0,05000 0,19±0,01 0,05±0,01 0,24 3,8 0,09±0.004 0,13±0,01 – нетрансформированные растения, 2 – трансгенные растения который в условиях стресса разрушается, частично защищая от деградации хлорофилл а, играющий ключевую роль в фотосинтезе. Содержание каротина и ксантофилла также уменьшалось при увеличении концентрации CuSO4 в растворе.

Однако значимые различия в содержании пигментов между линиями растений наблюдались только при высоких концентрациях этой соли в растворе.

При 1мкМ CuSO4 содержание каротина в трансгенных растениях было на 34%, а ксантофилла на 17% больше, чем у нетрансформированных.

Повышенные концентрации ZnSO4 также отрицательно влияли на содержание хлорофилла: на 15-е сутки экспозиции содержание хлорофилла в диапазоне использованных нами концентраций (от 500 до 3000 мкМ) уменьшалось на 62-83% у нетрансформированных растений и на 63-81% у трансгенных растений. Однако достоверных различий в содержании хлорофилла под действием повышенных концентраций ТМ между трансгенными и нетрансформированными растениями не наблюдалось даже при самых высоких концентрациях. Степень разрушения хлорофилла была одинакова у растений обеих линий. Содержание каротина и ксантофилла при повышении количества соли в растворе было одинаково до концентрации ZnSO4 2000 мкМ; при 3000 мкМ у трансгенных растений каротина было на 45%, а ксантофилла на 14% больше, чем у нетрансформированных.

Величина, характеризующая отношение содержания хлорофилла а к хлорофиллу в, в норме колеблется в пределах 2,5-3,0. Превышение данного уровня свидетельствует о деградации хлорофилла в. Согласно полученным нами данным, отношение содержания хлорофиллов а/в при действии 3000 и 5000 мкМ ZnSO4 в течение 15 дней составляла 5,2 и 5,3, а в трансгенных - 4,4. и 3,8, что свидетельствует о меньшей степени повреждения ТМ фотосинтетического аппарата.

Влияние ТМ на перекисное окисление липидов Полученные выше данные свидетельствуют о том, что весьма вероятной причиной большей устойчивости трансгенных растений к ТМ является меньшая интенсивность окислительного стресса, который испытывают эти растения на фоне действия ТМ. Об интенсивности протекания процесса перекисного окисления липидов мембран свидетельствует уровень малонового альдегида в тканях растений. Из данных, представленных на рис. 5, видно, что в области низких концентраций обеих солей ТМ, добавленных в питательный раствор, в листовых тканях содержание МДА у трансгенных и нетрансформированных растений практически не отличалось. При дальнейшем повышении концентрации солей в растворе проявлялись различия между линиями растений: в трансгенных растениях МДА накапливается значительно меньше, чем в нетрансформированных. Особенно большая разница обнаружена при воздействии повышенных концентраций CuSO4, при которых уровень МДА по сравнению с контролями повышался у трансгенных растений в 10 раз, тогда как у нетрансформированных - почти в 20 раз. При этом влияние обеих солей на накопление МДА в трансгенных растениях было примерно одинаково, хотя и имелось небольшое превышение его аккумуляции под действием CuSO4. В этом случае содержание МДА составляло 2,6 мкМ на г сырой биомассы, тогда как у трансгенных растений оно равнялось 1,7 мкМ. Для растений, находящихся под воздействием ZnSO4, аккумуляция МДА в трансгенных и нетрансформированных растениях почти не отличалась.

2,1,0,0 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSOмкМ Рис. 5. Накопление МДА в листьях трансгенных и нетрансформированных растений рапса после воздействия солей ТМ.

1 – нетрансформированные растения, 2 – трансгенные растения Изменение активностей гваякольной пероксидазы и супероксиддисмутазы при ТМ стрессе Результаты, представленные на рис. 6 и 7, показывают активности некоторых ферментов антиоксидантного комплекса растений.

Уровень активности гваякольной пероксидазы (рис. 6) в трансгенных растениях при действии низких концентраций солей ТМ (25 мкМ CuSO4 или 500 и 1000 мкМ ZnSO4) оставался равным активности фермента у растений, росших суток в стандартных условиях. При увеличении концентрации солей в питательном растворе активность фермента снижалась, причем, под действием CuSOзначительно сильнее, чем под действием ZnSO4. При этом активность пероксидазы у трансгенных растений была выше, чем у нетрансформированных растений При 50 мкМ CuSO4 активность фермента у трансгенных растений уменьшалась в 1,4 раза, у нетрансформированных - в 2 раза, а под действием 1мкМ соли активность падала в 3 раза у трансгенных и почти в 5 раз у нетрансформированных растений.

биомассы) МДА (мкмоль /г сырой Сульфат цинка влиял на активность пероксидазы в меньшей степени, чем CuSO4. При 2000 мкМ ZnSO4 активность фермента оставалась равной в обеих линиях растений, хотя и уменьшалась в 1,4 раза по сравнению с активностью контрольных растений. При увеличении концентрации ZnSO4 до 3000 мкМ отмечалась значительная разница в активности фермента между обеими линиями растений (в 2,7 раза у нетрансформированных растений и в 1,7 раза у трансгенных растений).

1,1,0,0,0,0,0 25 50 100 150 500 1000 2000 3000 50 CuSO ZnSO 4 мкМ Рис. 6. Влияние солей тяжелых металлов на активность гваяколовой пероксидазы.

1 – нетрансформированные растения; 2 – трансгенные растения Активность супероксиддисмутазы (СОД) у нетрансформированных растений исходно была выше, чем у трансгенных растений (рис. 7). Увеличение концентрации CuSO4 в питательной среде вызывало значительное падение активности СОД у нетрансформированных растений, тогда как у трансгенных растений ее активность вплоть до 100 мкМ оставалась постоянной, снижаясь в 2,раза при 150 мкМ.

3,1 2,1,0,0 25 50 100 150 500 1000 2000 3000 50 CuSO4 ZnSOмкМ Рис. 7. Активность супероксиддисмутазы в листьях трансгенных и нетрансформированных растений рапса 1 – нетрансформированные растения; 2 – трансгенные растения Активность пероксидазы (мкмоль гваякола / мг белка) белка) СОД (ед. активности / мг ZnSO4 в концентрациях до 3000 мкМ практически не влиял на активность СОД, которая снижалась при 5000 мкМ в 1,8 раза по сравнению с контрольными растениями, находившимися в стандартных условиях.

Полученные данные свидетельствуют о том, что СОД и пероксидаза могут вовлекаться в снижение уровня АФК в трансгенных растениях рапса на фоне действия, прежде всего, ионов меди, обладающих большей токсичностью по сравнению с ионами цинка.

Аккумуляция пролина в листьях растений рапса Одной из универсальных защитных реакций растений в ответ на действие абиотических факторов является аккумуляция совместимых осмолитов, в частности, пролина, обладающих осморегуляторным и стресс-протекторным действием.

При изучении накопления пролина в листьях растений рапса под действием повышенных концентраций солей ТМ было установлено, что в контрольных растениях, росших 15 суток в стандартных условиях, уровень свободного пролина в листьях составлял в среднем 13,2 мкмоль/г сырой массы листа у нетрансформированных растений и 13,6 мкмоль/г сырой массы у трансгенных растений (рис. 8).

443322111 0 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSO мкМ Рис. 8. Накопление пролина в листьях трансгенных и нетрансформированных растений рапса после воздействия CuSO4 или ZnSO1 – нетрансформированные растения, 2 – трансгенные растения При действии на растения в течение 15 дней 25 мкМ CuSO4 (рис. 8) содержание пролина увеличивалось по сравнению с контрольными растениями примерно в 3 раза у трансгенной и нетрансформированной линий растений.

Значимой разницы в накоплении пролина у обеих линий растений не наблюдали и при концентрации 50 мкМ CuSO4, поскольку содержание пролина увеличивалось примерно в 10 раз как у одной, так и у другой линии. Существенная разница в накоплении пролина наблюдалась при действии 100 мкМ CuSO4 (у нетрансформированных растений содержание пролина возрастало в 21,3 раза, а у биомассы) Пролин (мкмоль/ г сухой трансгенных растений его количество возрастало в 27,8 раз). При повышении концентрации CuSO4 в растворе до 150 мкМ аккумуляция пролина у трансгенного растения возрастала незначительно, увеличиваясь на 8% от уровня пролина, аккумулировавшегося при 100 мкМ CuSO4.

Низкие концентрации цинка не оказывали заметного стрессорного влияния на растения рапса (рис. 9), тем не менее, при концентрации 1000 мкМ ZnSOсодержание пролина увеличивалось примерно в 3 раза. При более высоких концентрациях ZnSO4 от 2000 до 5000 мкМ происходило увеличение аккумуляции пролина в обеих исследуемых линиях растений (при 2000 мкМ - в 13 раз у трансгенов и в 11 раз - у нетрансформированных растений, при 3000 мкМ - в 15 и в 12 раз соответственно, и при 5000 - в 20 раз у трансгенных растений, по сравнению с контрольными растениями).

Аккумуляция фенолов, флавоноидов и антоцианов под действием солей меди и цинка.

Представленные выше данные по интенсивности окислительного стресса (рис. 5) свидетельствуют о том, что трансгенные растения рапса с геном Osmybриса при воздействии невысоких концентраций солей ТМ (до 50 мкМ для CuSO4 и до 1000 мкМ для ZnSO4) характеризуются равной интенсивностью окислительного стресса по сравнению с нетрансформированными растениями, тогда как при повышении концентрации солей ТМ в питательном растворе накопление МДА у нетрансформированных растений увеличивалось и особенно ярко это проявилось при действии CuSO4. Это позволило предположить, что одной из причин сохранения внутриклеточного статуса трансгенных растений в условиях действия ТМ является аккумуляция соединений с антиоксидантными свойствами, к которым могут быть отнесены, прежде всего, растворимые фенолы и антоцианы.

Результаты, представленные на рис. 9, показывают, что в контрольных растениях, росших 15 суток в стандартных условиях, содержание фенолов составляло 8 мкг/1 г свежей массы для обеих линий растений. При небольшом повышении концентраций солей ТМ в питательном растворе (до 25 мкМ CuSO4 и до 1000 мкМ ZnSO4) накопление фенолов было примерно равно у исследуемых линий растений, однако при повышении концентраций солей меди и цинка в растворе количество фенолов в тканях резко увеличивалось, причем у трансгенных растений значительно в большей степени (при 100 мкМ CuSO4 в 7,2 раза), чем у нетрансформированных (в 5,2 раза). Надо отметить, что дальнейшее увеличение концентрации CuSO4 не увеличивало накопление общих фенолов в тканях трансгенных растений, тогда как при увеличении концентрации ZnSOпроисходило постоянное увеличение аккумуляции растворимых фенолов в трансгенных растениях (30 мкг/г сырой биомассы при 2000 мкМ соли, 45 мкг/ г сырой биомассы при 3000 мкМ и 66 мкг/ г сырой биомассы при 5000 мкМ ZnSO4).

0 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSOмкМ Рис. 9. Влияние солей меди и цинка на накопление фенольных соединений в листьях трансгенных и нетрансформированных растений рапса 1 – нетрансформированные растения; 2 – трансгенные растения При расчете использовали относительные единицы на основании коэффициента пересчета для рутина.

При добавлении в питательную среду 25 и 50 мкМ CuSO4 содержание флавоноидов практически не отличалось от контрольного значения (рис. 10). При увеличении концентрации меди в питательном растворе до 100 мкМ в листьях рапса накапливалось в 3 раза больше флавоноидов у нетрансформированных растений, тогда как у трансгенных растений их накапливалось в 4 раза больше.

Дальнейшее повышение концентрации ионов меди в растворе не оказывало дополнительного стимулирующего влияния на содержание флавоноидов.

В экспериментах с 500 и 1000 мкМ ZnSO4 содержание флавоноидов в обеих линиях растений существенно не отличалось от контрольных. При повышении концентрации цинка от 2000 до 5000 мкМ количество флавоноидов значительно увеличивалось. На 15-й день воздействия ZnSO4 содержание флавоноидов у нетрансформированных растений оказалось в 2 и 3 раза, тогда как у трансгенных - в 2 и 3,5 раза (соответственно для концентраций 2000, 3000 мкМ) выше. При воздействии 5000 мкМ ZnSO4 уровень флавоноидов возрастал почти в 5 раз, и их содержание составляло 32,85 относит. ед. / г сырой массы.

Характер изменения содержания антоцианов в сравниваемых растениях под действием меди и цинка (рис. 11) практически не отличался от изменения содержания фенольных соединений. В ответ на действие ионов меди происходило быстрое накопление антоцианов в листьях всех растений и на 15-е сутки при концентрации 25 мкМ их содержание превышало контрольные значения в 1,9 раза у трансгенных и нетрансформированных растений; при дальнейшем увеличении ед / г сырой биомассы) Сумма фенольных соединений (отн.

1 0 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSOмкМ Рис. 10. Накопление флавоноидов в листьях трансгенных и нетрансформированных растений рапса после воздействия солей ТМ.

1 – нетрансформированные растения; 2 – трансгенные растения При расчете использовали относительные единицы на основании коэффициента пересчета для рутина.

концентрации CuSO4 разница между аккумуляцией антоцианов в двух линиях растений увеличивалась и при 50 мкМ аккумуляция антоцианов была у трансгенов в 1,4 раза, а при 100 мкМ в 2,6 раза больше, чем у нетрансформированных растений. Если сравнивать накопление антоцианов отдельно по каждой линии, то в нетрансформированных растениях при 100 мкМ CuSO4 увеличение было в 3 раза выше, чем у растений, росших 15 суток в стандартных условиях, а для трансгенных растений произошло увеличение накопления этих соединений в 7,4 раза. Следует отметить также, что аккумуляция антоцианов в трансгенных растениях происходила аналогично с аккумуляцией фенолов – при достижении максимального значения содержания вещества (при 100 мкМ CuSO4) дальнейшее возрастание концентрации CuSO4 до 150 мкМ практически не увеличивало содержание антоциана.

При влиянии ZnSO4 в концентрациях от 500 до 5000 мкМ содержание антоцианов в растениях изменялось также достаточно сильно, постоянно возрастая в значительно большей степени у трансгенных растений (в 3,7 раза при 2000 мкМ, в 6,8 раза при 3000 мкМ и в 9,3 раза при 5000 мкМ ZnSO4), чем у нетрансформированных (в 2,5 раза при 2000 мкМ и в 3,5 раза при 3000 мкМ).

Флавоноиды (относит.

ед. /г сырой биомассы) 111110 25 50 100 150 500 1000 2000 3000 50CuSO4 ZnSOмкМ Рис. 11. Накопление антоцианов в листьях трансгенных и нетрансформированных растений рапса после воздействия солей ТМ.

1 – нетрансформированные растения; 2 – трансгенные растения При расчете использовали относительные единицы на основании коэффициента пересчета для цианидина Влияние ТМ на экспрессию генов системы их детоксикации в трансгенных растений Помимо антиоксидантных ферментов и низкомолекулярных органических соедиений с антиоксидантными свойствами повышенная устойчивость трансгенных растений рапса к ТМ могла быть вызвана изменением экспрессии генов, вовлеченных в хелатирование ТМ или в регуляцию их внутриклеточного гомеостатирования. Для проверки этого предположения изучали действие повышенных концентраций ТМ на экспрессию (1) двух генов, кодирующих мембранные транспортеры ТМ – ZIP1 и ZIP4, (2) гена фермента фитохелатинсинтазы (PCS), обеспечивающего синтез фитохелатинов, а также генов ферментов синтеза (P5CS) и деградации (PDH) пролина.

С помощью метода ОТ-ПЦР оценивали активность экспрессии этих генов на уровне тотального содержания индивидуальных мРНК через 7 и 15 сут.

выращивания растений на средах с повышенным содержанием CuSO4 или ZnSO4.

Опытные образцы в каждой временной точке выравнивались по контрольному показателю. В качестве контроля была выбрана активность данных генов у растений, выращенных на стандартной питательной среде. Пример активности генов ZIP1, ZIP4, PCS, P5CS; PDH и 18SrRNA представлен на рисунке 12.

Сравнительный анализ полученных результатов показывает, что уровни транскриптов указанных выше генов у трансгенных и нетрансформированных растений принципиально не различались. По-видимому, экспрессия этих генов, продукты которых отвечают за хелатирование ТМ и поддержание внутриклеточных концентраций ионов меди и цинка, не регулируются трансфакторным белком OSMYB4. Этим белком, очевидно, регулируются гены, сырой биомассы) Антоцианы (относит. ед /г отвечающие за синтез вторичных соединений фенольной природы, обладающих антиоксидантными свойствами и частично обеспечивающих защиту растений от повреждающего действия ТМ.

Влияние CuSO4 (50 мкМ) и ZnSO4 (3000 мкМ) на экспрессию генов метаболизма пролина, PCS, ZIP1 и ZIP4 в трансгенных растениях рапса Линия №6 Линия №OsMyb4 OsMybZIP4 ZIPP5CS P5CS PDH PDH PCS PCS 18SrRNA 18SrRNA под действием цинка под действием меди 1–к ( нетрансформированные); 2-к ( трансгенное) ;

3-7 дней(нетрансформированные); 4-7 дней ( трансгенное);

5-15 дней( нетрансформированные); 6-15 дней( трансгенное) Рис.12. Электорофореграммы ампликонов, полученных после реакции ОТПЦР с праймерами к соответствующим генам.

Таблица 4. Биохимические показатели трансгенных растений по сравнению с нетрансформированными растениями.

Показатели Линия 6 (Cu) Линия 5 (Zn) Прирост биомассы 138% +210% МДА 65% 91% СОД 205% 89% Гваяк. пероксидаза 177% 145% Каротин 136% 145% Ксантофилл 116% 114% Пролин 134% 125% Общие фенолы 136% 140% Флавоноиды 168% 137% Антоцианы 258% 189% За 100% принимали значения показателей, полученные для нетрансформированного растения. Растения подвергались 15 дн. воздействию 100 мкМ CuSO4 или 3000 мкМ ZnSO4. Линия 5 – экспрессия гена Osmyb4 под действием ZnSO4; Линия 6 – экспрессия гена Osmyb4 под действием CuSO4.

Таким образом, совокупность представленных выше результатов позволяет заключить, что экспрессия Osmyb4 гена риса в растениях рапса сопровождается повышением их устойчивости к ТМ. В основе повышенной устойчивости трансгенных растений рапса к ТМ лежит стресс-индуцируемая аккумуляция низкомолекулярных органических соединений фенольной природы (общие фенолы, флавоноиды и антоцины), увеличение содержания пролина, обладающего осморегуляторным и защитным эффектом, а также некоторое увеличение активности антиоксидантных ферментов, особенно в условиях действия на растения сульфата меди как наиболее токсичного ТМ (Табл. 4). Совокупность указанных изменений метаболизма сопровождается снижением интенсивности окислительного стресса, о чем свидетельствует более низкий уровень МДА в трансгенных растениях, а также повышенное содержание некоторых фотосинтетических пигментов, и меньшей степенью повреждения растений высокими концентрациями солей меди и цинка. Это подтверждает идею, согласно которой продукт Osmyb4 гена играет особую интегрирующую роль в ответе растений на повреждающее воздействие, координируя экспрессию генов различных метаболических путей, обеспечивающих формирование стрессзащитных механизмов.

ВЫВОДЫ 1. Показано, что в процессе генеративного размножения растений рапса с геном Osmyb4 транс-фактора риса трансген наследуется и экспрессируется. Из анализируемых растений второго поколения 25 растений содержали гены Osmyb4 и nptII, из которых 7 линий экспрессировали этот ген Osmyb4 на фоне высоких концентраций CuSO4 или ZnSO4..

2. Сделано заключение, что трансгенные растения рапса обладают повышенной устойчивостью к солям меди и цинка по сравнению с растениями дикого типа. В пользу этого заключения свидетельствует способность трансгенных растений: (а) выживать в течение 15 суток при 150 мкМ CuSO4 или 5000 мкМ ZnSO4; (б) более активно накапливать биомассу при высоких концентрациях ТМ; (в) в большей мере стабилизировать водный статус в экстремальных условиях. При этом трансгенные растения рапса накапливали до 180 мкг меди и до 6500 мкг цинка на 1 грамм сухой массы, что приближает их к группе растений-гипераккумуляторов цинка.

3. Показано, что большая устойчивость трансгенных растений рапса к солям ТМ может быть обусловлена меньшей интенсивностью окислительного стресса, который они испытывали в условиях повреждающего действия CuSO4 или ZnSO4, о чем свидетельствует меньший уровень МДА у трансгенных растений при высоких концентрациях ТМ по сравнению с нетрансформированными формами.

4. Продемонстрировано, что в ответ на действие высоких концентраций ТМ трансгенные растения рапса интенсивно аккумулировали низкомолекулярные органические антиоксиданты (антоцианы, флавоноиды, сумма фенольных соединений и, в меньшей степени, пролин), и обнаруживали повышенную активность пероксидазы и СОД. Активация антиоксидантных ферментов была характерна, прежде всего, для ответа растений на высокие концентрации ионов меди, обладающих большей токсичностью по сравнению с ионами цинка.

Совокупность указанных изменений метаболизма приводила к снижению повреждающего действия АФК и выживанию растений в условиях повреждающего действия ТМ.

5. Установлено, что суперэкспрессия гена Osmyb4 риса в растениях рапса не сопровождалась активацией экспрессии генов метаболизма пролина, генов фитохелатинсинтазы и транспортера цинка ZIP4 при действии высоких концентраций ТМ по сравнению с нетрансформированными растениями, а приводила к стимуляцией фенольного метаболизма и биосинтезу низкомолекулярных антиоксидантов.

6. Высказано предположение, что полученные нами растения рапса с геном Osmyb4, имеющие повышенную устойчивость к высоким концентрациям ТМ, могут быть резистентны и к другим повреждающим факторам, поскольку они активно аккумулируют универсальные стресс-протекторные метаболиты с антиоксидантными свойствами.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Мареай М.М., Ралдугина Г.Н., Холодова В.П. Сравнительный анализ устойчивости двух сортов ярового рапса (Brassica napus L.) к действию к действию высоких концентраций цинка // Вестник Томского государственного университета, 2011. № 4, С.96-100.

2. Мареай М.М., Ралдугина Г.Н., Алобайди Х.Х. Сравнительный анализ устойчивости двух сортов ярового рапса к действию высоких концентраций Cu2+ и Zn2+ // Вестник РУДН, 2012.-№ 2. С. 62-68.

3. Мареай Мухаммед М., Холодова В.П., Ралдугина Г.Н. Сравнительный анализ устойчивости двух сортов ярового рапса к действию ионов Cu и Zn. Тезисы докладов Всероссийского симпозиума "Растение и стресс" Москва. 2010. С.233.

4. Мареай М.М., Ралдугина Г.Н. Анализ устойчивости 2-х сортов ярового рапса (Brassica napus L.) к действию ионов Cu и Zn // Тезисы докладов VII съезда Общества физиологов растений России. Международная конференция «Физиология растений – фундаментальная основа экологии и инновационных биотехнологий». Нижний Новгород. 2011. С. 453.

5. М.М. Мареай, Г.А. Шумкова, Н.В. Радионов, Г.Н. Ралдугина. Влияние повышенных концентраций солей CuSO4 и ZnSO4 на трансгенные растения рапса (Brassica napus L.) с геном трансфакторного белка OSMYB4 // Тезисы докладов II Международной школы-конференции молодых ученых «Генетика и селекция растений, основанная на современных генетических знаниях и технологиях».

Москва-Звенигород 5-10 декабря. 2011. С. 48.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.