WWW.DISSERS.RU


...
    !

Pages:     || 2 | 3 |
-- [ 1 ] --

Van Putten, Wilhelmus Frederik On host race differentiation in smut fungi / Wilhelmus Frederik van Putten. - Utrecht:

Universiteit Utrecht, Faculteit Biologie Thesis Utrecht University. - with ref. - with a summary in Dutch.

Keywords: pathogenic fungus /Microbotryum / Silene / host race / evolution (biology) Over waardrasdifferentiatie in brandschimmels (Met een samenvatting in het Nederlands) Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de Rector Magnificus, Prof. Dr. W.H. Gispen ingevolge het besluit van het College voor Promoties in het openbaar te verdedigen op maandag 25 maart 2002 des middags te 16:15 door Wilhelmus Frederik van Putten geboren op 24 december 1971, te Zuidelijke IJsselmeerpolders Prof. dr. J.M.M. van Damme Faculteit Biologie, Universiteit Utrecht Dr. A. Biere Nederlands Instituut voor Ecologie Centrum voor Terrestrische Ecologie, Heteren Cover: anther smut infected flowers of Silene latifolia.

ISBN 90-393-2962- 2002 W.F. van Putten Parts of this material are allowed to be reproduced, or utilized as long as their source is mentioned.

Voor mijn ouders T T General introduction Host-related genetic differentiation in the anther smut fungus Microbotryum violaceum in sympatric, parapatric and allopatric populations of two host species Silene latifolia and S. dioica Effects of spatial structure on host differentiation of the anther smut Microbotryum violaceum in a natural sympatric host population of Silene latifolia and S. dioica Intraspecific competition and mating between fungal isolates of the anther smut Microbotryum violaceum from the host plants Silene latifolia and S. dioica Host fidelity of the pollinator guilds of Silene dioica and S. latifolia;

possible consequences for host race differentiation of a venereal disease in sympatry Summarizing discussion and conclusions References Summary Nederlandse samenvatting Nawoord / Acknowledgements Curriculum vitae List of publications T T TI I TI When discussing different modes of speciation, it is important to know which definition of a species is used. In the broad range of biological studies on speciation, there were, and still are, many different species concepts (cf. Harrison 1998). Until the twentieth century, the time of Linnaeus, Darwin and Wallace, a commonly used species concept was a simple one, based on morphologytigers look like tiger and lions look like lions (Berlocher 1998b). In modern day speciation research, the most well-known of the species concepts, and hence the most frequently used for that matter, is the biological species concept that is defined by Mayr (1963) and Dobzhansky (1970), stating respectively;

groups of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups, and systems of populations between which the gene exchange is limited or prevented in nature by a reproductive isolation mechanism or by a combination of such mechanisms. From these definitions it can be seen that the key mechanisms of speciation should provide some form of reproductive isolation between populations of the same species. This can lead to speciation by natural selection and genetic drift (cf.

Coyne, 1992). Genetic divergence may increase as populations adapt to their local environments. Prezygotic (e.g. selfing, or positive assortative mating, reducing the production of hybrid offspring) and postzygotic (reduced fitness of hybrid offspring) forms of reproductive isolation will gradually develop between geographically isolated populations. When sub populations have diverged, maladaptive hybridization is often avoided by mate discrimination, a process that is known as reinforcement (cf.

Noor 1999). Once these processes are completed, speciation has occurred (Rice and Hostert 1993).

Many present day ideas on speciation and possible mechanisms for speciation come from theoretical modeling. The basic allopatric, or geographical models of speciation that have been developed (e.g. Mayr 1963) are often easier to comprehend than models of sympatric speciation (e.g. Maynard Smith 1966). Virtually all of the older models have postulated that speciation in sympatry is driven by genetic trade offs in adaptation to different habitats, i.e. by antagonistic pleiotropy of genes that improve fitness in one habitat, and reduce fitness in the other (cf. Kawecki 1997).

More recent models have shown that other mechanisms, e.g. deleterious mutations (Kawecki 1997), sexual selection (Higashi et al. 1999), or disruptive selection and assortative mating (Dieckmann and Doebeli 1999), can provide ecologically realistic conditions as under which sympatric speciation theoretically could occur as well.

Empirical data, and good biological examples are still scarce however (Coyne 1992), and are almost exclusively concerned with phytophagous insects and their host plants.

fitness is host dependent Schematic representation A host race specialization of pathogen fitness trade-offs on different host species in models of (sympatric) speciation. The scheme displays possible allelic effects on the performance of two host races on two different host species.

Formation, specialization or maintenance of host races in sympatry can be achieved actively fitness is host dependent B in panel A, but not in B or C race 1 outcompetes race without other mechanisms of reproductive isolation being present (adapted from Kawecki 1997). Note that in the case of host race formation, race in this figure may be referred to as deme.

fitness is host independent C race 1 outcompetes race race race Host 1 Host Among the first authors presenting empirical evidence for speciation in sympatry is Bush (1969), who investigated frugivorous flies of the genus Rhagoletis, the apple maggot fly, and observed strong correlations between mate and host selection in several sympatric groups of sibling species. Together with some other Relative fitness rac e e rac rac e e rac characteristics of the genus, and evidence that host races had evolved in recent history (reported by Walsh 1867), they suggested that certain groups of sibling species may have evolved in sympatrically as a result of minor alterations in genes associated with host plant selection. The two main pillars on which the Bush model of sympatric speciation rests;

host (habitat) specific mating and host-associated fitness trade-offs (illustrated in figure 1), in fact represent forms of pre- and postzygotic reproductive isolation mechanisms. Sympatric speciation by host- or habitat shift hassince thengained much more support in a wide range of insect-plant systems (as reviewed in Tauber and Tauber 1989), and more recently for instance in pea aphids (Via et al.

1999;

2000), but remains subject of much debate. A frequently used criticism is that mostif not allcases of sympatric speciation in natural populations could equally well be explained by allopatric mechanisms. Berlocher (1998a) addresses this point and concludes that there are cases that are best explained with sympatric rather than allopatric speciation, pointing to the case of cichlid species in African crater lakes, which due to their size and shape are likely to be colonized only once and consist of several monophyletic flocks (Schliewen et al. 1994), that provided even stronger evidence than the huge bulk of data on parasitic insects.

Berlocher (1998a) gives a clear path of four stages for sympatric speciation via host race formation, with increasing genetic distances between the races. Each of these stages is documented with biological examples on parasitic insects. (1) The first stage is represented by a distinct host shift event. Isolation by host fidelity occurs due to differences in post diapause emergence time and host choice behavior. There are no prezygotic or postzygotic isolation mechanisms independent of host fidelity, and no host-specific allele frequencies in this stage. (2) In the second stage, the species (or races) are still isolated by host fidelity only, without any severe postzygotic isolation mechanism. Allele frequency differences between host races do exist, but do not exclude the possibility of gene flow. There are no species-specific alleles (in allozymes). (3) In the third stage, both pre- and postzygotic forms of reproductive isolation mechanisms that are not related to host fidelity have developed. Species specific alleles (in allozymes) exist, but are not fixed, and low levels of gene flow are still present. (4) In the fourth and last stage, species are totally isolated, characterized by great genetic divergence, without gene flow, and with a strong postzygotic isolation mechanism that is unrelated to host adaptation.

Host race formation and specialization of phytopathogenic fungi is much less documented however, let alone sympatric fungal speciation. There are a few examples of fungal speciation which might have evolved in sympatry, for instance in three subspecies of Phytophtera palmivora from cocoa (Sansome et al. 1979;

Brasier and Griffin 1979). However, even in these cases it is feasible that these species arose in allopatry, and that their ranges became overlapping at a later stage (cf. Burnett 1983).

In these fungi, evidence for (sympatric) speciation points to two major environmental factors (Brasier 1987), (1) (micro-)climate, in which divergence is promoted by locally strong gradients and discontinuities, and (2) substrate, in which divergence is led by opportunistic nutritional strategies of the pathogen. Both pre- and postzygotic mechanisms of reproductive isolation have been reported, ranging from (prezygotic) temporal isolation by asynchronous gamete release (Federici 1982) to homing in basidiomycetes, i.e. active movement of spores towards for instance host produced chemicals (Deacon and Donaldson 1993) and from (postzygotic) hybrid sterility (e.g.

Federici 1982) to complex vegetative incompatibility systems, as for instance is found in some ascomycetes (Glass and Kuldau 1992).

However, often these studies are strongly biased towards more economically important organisms (cf. Brasier 1987), putting the emphasis unintentionally on the host rather than on the pathogen (but see Giraud et al. 1999). This also holds true for the physiological specialization of smut fungi in the review of Fisher and Holton (1957 p.331) that examines susceptibility and resistance of cereal and oat smuts of the Ustilago genus. Nevertheless, they represent good examples of host specialization in phytopathogenic fungi, which can be a starting point for host race formation and eventually for speciation. Recent examples often use molecular markers in search of a genetic basis of (sympatric) host races, e.g. studies by Peever and co-workers in Alternaria (brown spot fungus of citrus), showing host-related genetic differentiation between citrus fruit cultivars (Peever et al. 1999;

Peever et al. 2000), and in Macrophomina (charcoal rot fungus infecting root tissue of some crop species) showing both genetic differentiation between host species, and combine this with data on host preference (Su et al. 2001). From the ecological examples, perhaps the most extensively studied organism in this field is the anther smut fungus Microbotryum violaceum, phytopathogen of the Caryophyllaceae, and the main subject of this thesis.

Lifecycle of Microbotryum violaceum. Indicated are the karyotypic phases in the fungal lifecycle, being diploid outside the host plant, and haploid/dikaryotic on/inside the host plant. The schematic picture of morphological sex change has been adapted from Vnky (1994). Note that the scale of each phase is quite different, the size teliospores is 10-12m, of sporidia 6-8m, and the corolla of Silene host flowers 10-30mm dependent of the host species.

T T T The anther smut fungus Microbotryum violaceum (Pers.: Pers) Deml & Oberw.

(=Ustilago violacea (Pers.) Fuckel) (Ustilaginaceae) (Vnky 1994) is a well-studied example of a heterobasidiomycete fungus that obligatory parasitises susceptible members of the Caryophyllaceae plant family to complete its sexual lifecycle (Thrall et al. 1993). The sexual life cycle will be shortly reviewed here, and is presented in figure 2. The lifecycle can be split into two stages, outside the host plant (diplophase) and on/inside the host plant (haplo-/dikaryophase). Starting with the diploid teliospores arriving on a healthy host plant, the sexual life cycle commences with germination. Germination of smut spores by meiosis results in four-celled promycelia from which four haploid cells (sporidia) of two mating types (designated a1 and a2) bud off. However, one or two cells are frequently left behind, or migrate back into the basidium (Ingold 1983;

Hood and Antonovics 1998). In principle, the two mating types are produced in a 1:1 ratio. However, biased ratios in both directions have been reported (Kaltz and Shykoff 1997;

Oudemans et al. 1998), and have been attributed to mating type linked haploid lethal alleles (Oudemans et al. 1998), or intratetrad mating (Hood and Antonovics 2000). In nutritious environments haploid cells proliferate asexually by mitosis in a yeastlike manner (Day and Garber 1988). In the absence of nutrients, and at lower temperatures (Cummins and Day 1977) haploid cells of opposite mating types can mate. The mating process and recognition between cells is influenced by pheromones (Blker and Kahmann 1993;

Snetselaar et al. 1996), which promote the formation of fungal fimbriae, i.e. microscopic hair like structures composed of collagen, carbohydrates and RNA (Poon and Day 1975 but see Celerin and Day 1998). Hereafter, a conjugation tube between these cells of different mating type is formed (Poon et al. 1974), marking the start of the dikaryotic phase in which the infectious hyphae are produced. Other critical factors in the mating process besides low temperature and low nutrient level are the presence of oxygen, and salts (Cummins and Day 1977). The development of the fungus from this point on is regulated by the presence of host plant chemicals (Day et al. 1981;

Kokontis and Ruddat 1986;

1989), of which -tocopherol (= vitamin E) has been identified as one of the major factors stimulating hyphal growth (Castle and Day 1984). Indeed, small amounts of synthetic vitamin-E have the ability to induce hyphal growth in vitro by itself (personal observation), but it has been argued that it is unlikely that vitamin-E promotes hyphal growth in planta because it is unavailable to the invading hyphae (Ruddat and Kokontis 1988). Infectious hyphae grow intercellularly (Spencer and White 1951;

Audran and Batcho 1981) and grow along with the plants apical meristemic regions (Day 1980). When the dikaryotic parasitic mycelium grows into the stamens of a flower, anthers produce teliospores instead of pollen (Thrall et al.

1993). As spores mature in the anther sacs, karyogamy marks the start of the diploid phase (Day and Garber 1988). In dioecious host species, an infection of female plants causes a morphological sex change (Hassan and MacDonald 1971);

ovaries are aborted and staminal rudiments develop into stamens that bear spore-filled anthers (Day and Garber 1988;

Thrall et al. 1993), a process that is induced by the fungus itself (Audran and Batcho 1981;

Scutt et al. 1997). The teliospores are dispersed by the natural insect visitors of the host plant, which serve the dual role of pollinators of healthy plants and vectors of this sexually transmitted disease (Jennersten 1983;

figure 3).

Electron microscope photograph of pollen grains (the larger spheres) and teliospores of Microbotryum violaceum (the smaller spheres) on the proboscis of an insect vector (picture adapted from Jennersten (1983), and used with kind permission of dr.

Jennersten).

M. violaceum is found to be highly selfing (Baird and Garber 1979), resulting in strong homozygosity in several host races (Bucheli et al. 2000;

chapter 2). Automixis (mating among products of different meioses from the same diploid origin, i.e.

between haploid sporidia from different teliospores from the same infected flower, or plant) as well as autogamy (mating among products of a single meiosis, i.e. within a single basidium) are more likely to occur (Hood and Antonovics 1998;

2000) than outcrossing, simply due to a closer proximity of cells, thereby limiting the opportunities for outcrossing. Besides this sexual cycle, and the asexual yeastlike growth, the fungus exhibits a parasexual cycle (sensu Pontecorvo 1956) in the absence of a suitable host, as can be shown on artificial media (Day and Cummins 1981). In that case the two nuclei of a single conjugate fuse, leading to recombination between vegetative cells by mitotic crossing over. The diploid cells can proliferate by yeastlike growth as well, until haploidization occurs.

As early as 1921, when Hermann Zillig published a paper ber spezialisierten Formen beim Antherenbrand, separate host races of this fungus were distinguished (Zillig 1921). In this paper, he found 70 caryophyllaceous host species in literature and herbarium collections that showed a worldwide distribution of this fungus, with the exception of Australia. Furthermore, he compared morphological characteristics of teliospores from a sub set of host species, and performed cross-inoculations between several host races and species. After vainly efforts to infect Silene dioica (Melandrium rubrum in those days) with smut from S. latifolia (M. album), and Saponaria ocimoides with smut from S. officinalis, both closely related host species, he concluded that most host species have their own host races of M. violaceum (Ustilago violacea). However, Liro (1924) challenged this finding, stating that spores from S.

latifolia and S. dioica could infect either of these host species. This was confirmed by Baker (1947), who stated, M. album (S. latifolia) is invading regions once occupied by M. dioicum (S. dioica), and is producing hybrid swarms. In this way, susceptibility of U. violacea (M. violaceum) is being introduced in to populations of M. dioicum (see also Baker 1948). This is an important statement within the context of this thesis, since the prejudiced reader might interpret this as a possible recent host shift event.

With the dawn of molecular marker techniques, however, host races of several of these host species proved to be genetically different as well. Perlin and co-workers showed polymorphisms in both chromosome number and chromosome length (Perlin 1996;

Perlin et al. 1997) among isolates of M. violaceum from different host species.

Also, microsatellite analyses revealed strong host-related genetic differentiation between isolates from various caryophyllaceous host species (Shykoff et al. 1999;

Bucheli et al. 2000). In all these studies the existence of a number of genetically different host races, or formae speciales of anther smut have been demonstrated in allopatric populations of hosts. However, whether this differentiation in sympatric populations of hosts is of the same magnitude, or is diminished by fungal gene flow is yet unclear.

Distribution of 1-km2 squares with both Silene latifolia and S. dioica host species present in the Netherlands between 1975 and 1997 (FLORON, Florbase-2d;

Leiden The Netherlands). The density of spots is an indication of putative sympatric host populations. Numbers point to numbered topographic maps of scale 1:25000 (Topografische dienst;

Emmen The Netherlands).

T Silene latifolia Poiret (= S. alba (Miller) Krause (Caryophyllaceae), the white campion, is a dioecious short-lived perennial from open, disturbed habitats and borders of arable land. Silene dioica (L.) Clairv. (Caryophyllaceae), the red campion, is a closely related dioecious perennial that mainly occurs in more shady humid habitats as woodland borders. It is generally agreed that S. latifolia and S. dioica share a recent common ancestry (Prentice 1979;

Desfaux and Lejeune 1996), and they share the same chromosome number (2n=24, cf. Prentice 1978). In areas where habitats overlap, or are adjacent, both species frequently occur in sympatry and hybridization is a common phenomenon (Baker 1947;

1948;

Goulson and Jerrim 1997). Figure shows the distribution of 1-km2 squares in which both S. latifolia and S. dioica were present in the Netherlands between 1975 and 1997 (FLORON, Florbase-2d;

Leiden The Netherlands). The high density of points in some parts shows that habitats are indeed frequently adjacent, and that parapatric, and possibly also sympatric host populations should be common. Differences in preference to either more shady (S.

dioica) or sun-exposed habitats (S. latifolia) could have evolved by a differential adaptation to light intensity (Willmot and Moore 1973). Besides the differential habitat preferences that structure the population spatially, there are other specific differences that structure sympatric host populations also temporally. S. dioica is more a true perennial species than the annual to short-lived perennial S. latifolia (Prentice 1979). A consequence of this is that S. dioica often does not flower until their second season (Prentice 1978). Moreover, flowering phenology is different between host species and sexes, with S. dioica flowering earlier than S. latifolia, and males flowering earlier than female hosts (Biere and Honders 1996b). Morphological differences between the two host species include differences in hairiness of the stem and leaves (personal observation), shape of the seeds, and shape and color, size and scent of the flowers (Prentice 1979: Jrgens et al. 1996). Furthermore, both species have been reported to have different pollinator guilds in allopatry (S. dioica: e.g. Kay et al. 1984;

Westerbergh and Saura 1994;

Carlsson-Granr et al. 1998;

S. latifolia: e.g.

Brantjes 1976a;

1976b;

1981;

Shykoff and Bucheli 1995;

Altizer et al. 1998) and in sympatry (e.g. Baker 1947;

Biere and Honders 1998;

Jrgens et al. 1996;

Goulson and Jerrim 1997). S. latifolia has a typical moth-pollination syndrome (Baker 1961;

Baker and Hurd 1968), including heavily scented white flowers that open at dusk (Jrgens et al. 2001). S. dioica, having flowers that open at dawn and remain open during the day, is primarily pollinated by bumblebees (Kay et al. 1984).

The electron microscope photograph taken from Jennersten (1983), which is displayed in figure 3, clearly shows the relevance of pollinators to this venereal disease. Pollinators carry both teliospores (smaller spheres) and pollen of the host plant (larger spheres), thereby serving the dual role as host pollinator and disease vector. However, some pollinators have been reported to discriminate against infected host plants, for instance bumblebee species preferentially visiting healthy S. latifolia over infected ones (Altizer et al. 1998). There are many factors influencing the visitation behavior of pollinators, since they visit flowers for different reasons, e.g., foraging for nectar (Willson and Bertin 1978;

Waddington 1981;

Kay et al. 1984;

Mitchell and Waser 1992;

Pappers et al. 1999;

Navarro 2000), robbing pollen (Utelli and Roy 2001) or oviposition (Brantjes 1976a;

1976b). Hence, insect visitors exhibit much variation in both efficiency or quality (Herrera 1987), and frequency or quantity (Herrera, 1989) of pollen transfer (Utelli and Roy, 2000). In addition to this, trade-offs between frequency and duration of flower visits have been recorded for bumblebees (Jones et al. 1998). Also, there are clear differences in behavior between diurnal and nocturnal pollinator guilds (e.g. Bertin and Willson 1980;

Guitan et al.

1993;

Groman and Pellmyr 1999). A number of plant factors determine and influence the behavior of insect visitors, such as plant density (Schmitt 1983;

Bosch and Waser 1999), inter-plant spacing (Bucheli and Shykoff 1999), floral display size (Klinkhamer et al. 1989;

Goulson et al 1998;

Stout 2000) and several morphological characteristics of flowers, e.g. size (Galen and Stanton 1989), color (Kay 1976;

Jones and Reithel 2001) and shape (Mller and Eriksson 1995). Although these studies all examine pollen transfer, to some extent many of the factors will also hold true for the transfer of fungal teliospores, since they arise in the anthers of the flower just as pollen does.

In this thesis we use two different types of markers to assess genetic variation in fungal isolates from S. latifolia and S. dioica (and hybrids). In addition, a third non genetic marker is used to explore differences in vector visitation patterns between the two host species.

First, we will use variation at one of the sporidial colony color (SCC) loci that is described in Garber et al. (1975). Figure 5 shows the biosynthesis pathway of the color molecule -carotene, starting with phytoene (Porter and Lincoln 1959;

Porter and Anderson 1962). In the first part of this pathway phytoene is converted into lycopene by dehydrogenases, in the second part these linear molecules can be transformed by cyclases, forming rings at the termini of the lycopene molecule. If such a ring is formed at just one terminus, it results in -carotene. When rings are formed at both termini, this results in -carotene, an important precursor of vitamin A (retinol) in higher organisms.

Carotenogenesis ACTIVE PHYTOENE White mutants -carotene, ENZYMES inactive dehydrogenase and carotenoid mutants at INACTIVE sporidial colony color (SCC) ENZYMES markers in Microbotryum PHYTOFLUENE violaceum, as proposed by Garber et al. (1975). The enzymes from phytoene to -CAROTENE lycopene are dehydrogenases;

inactive cyclase further down the pathway the enzymes are cyclases. Note that the SCC phenotypes NEUROSPORENE -ZEACAROTENE observed and used in this Orange mutants thesis, are the wild type pink (in which strains accumulate -CAROTENE LYCOPENE lycopene) and the mutant yellow (in which the cyclases Pink wild type inactive cyclase inactive cyclase are active, and hence strains -carotene).

-CAROTENE Yellow mutants The exact number of different enzymes that is involved in this pathway is not known.

From phytoene to lycopene could require only one type of enzyme (Porter and Anderson 1962). Possibly, only one enzyme is required for the conversion of lycopene to -carotene and then to -carotene as well. Carotenoids give color to many plant fruits, such as the deep orange of carrots and the red in tomatoes. Likewise, these molecules color the sporidia of M. violaceum when they are grown on artificial media.

The wild type of this fungus does not contain active cyclases, and hence sporidia accumulate lycopene that gives the colonies a pink color. Some natural occurring mutants do contain active cyclases, and result in orange (one active cyclase) and yellow colored colonies (two active cyclases). Other mutants have inactive dehydrogenases and accumulate phytoene, giving the colonies a white color. Biere and Honders (1996a) found that most of the smut isolates from allopatric S. latifolia were of the wild type, while most smuts isolated from allopatric S. dioica were of the yellow mutant phenotype.

The second type of marker that is used in this thesis is a molecular genetic marker, the microsatellite. Microsatellite loci are tandemly repeated short sequence motifs of DNA up to six bases long, that have been detected within the genome of every organisms so far analyzed (Hancock 1999). Microsatellites are co-dominantly inherited and show high levels of polymorphism (e.g. Tautz 1989), often providing ample resolution for studying population genetic structure within and between populations of a single species. Rates of mutation of microsatellites are high (around 10-4 to 10-5 in yeast (Henderson and Petes 1992;

Strand et al. 1993)) compared to rates of point mutation, which are in the order of 10-9 to 10-10. Besides mutation through recombination by unequal crossing-over or gene conversion, the predominant model of the mechanism of mutation is slipped strand mispairing (slippage) during replication, which occurs due to the repetitiveness of the microsatellite templates (cf.

Hancock 1999). In that case the nascent strand reanneals out-of-phase, and the resulting strand will be longer or shorter than the template strand. Conventional statistical methods that have been developed to analyze genetic variation, for instance in allozymes, are based on Wrights infinite allele model (Wright 1951;

Nei 1987;

Weir 1996), and yield classic F-statistics such as FST. However, mutations at microsatellite loci satisfy the stepwise mutation model, i.e. addition, or deletion of a single repetitive unit (Kimura and Ohta 1978), better than the infinite allele model.

Therefore, for such data, novel methods based on differences of allele size variances have been developed, yielding R-statistics such as RST (from the greek P (rho), analogous to F-statistics and (phi)), which is thought to be more appropriate to estimate population differentiation than FST values (Slatkin 1995). However, population differentiation estimates obtained from microsatellite date should be cautionary evaluated since some constraints on the evolution of microsatellite loci, e.g. constraints on allele size (Nauta and Weissing 1996) might produce biased estimates. Furthermore, Hedrick (1999) showed that the level of genetic divergence between groups, expressed in FST values, is greatly influenced by the level of heterozygosity due to the method of calculation, and argued that any interpretations from these highly variable loci should therefore be made carefully, since they may yield statistical but not biological significance. Bucheli et al. 1998 developed five microsatellite loci for the anther smut M. violaceum using isolates from S. latifolia.

Four of these loci could be successfully transferred with minor modifications to our lab conditions, and were used to investigate genetic divergence between fungal isolates in this thesis. These microsatellite loci showed host-related genetic differentiation among smut samples that were isolated from allopatric populations of a wide range of caryophyllaceous host species (Shykoff et al. 1999;

Bucheli et al.

2000), and specifically between allopatric S. latifolia and S. dioica host populations in Switzerland (Bucheli et al. 2001).

A third non-genetic marker is used to assess differences in visitation patterns between the pollinator guilds of S. latifolia and S. dioica, that serve as vectors of this fungal disease. This marker is a set of fluorescent dyes that here function as traceable teliospore surrogates. Fluorescent dyes have been successfully used to trace pollen movements across plants in many studies (e.g. Thomson 1981;

Waser and Price 1982;

Fenster et al. 1996;

Goulson and Jerrim, 1997), and have proven to be a good predictor of the dispersal of fungal spores as well (Shykoff and Bucheli 1995). The occurrence of dye on a flower is a qualitative measurement of the contact with a pollinator and/or a vector. As Thomson et al. (1986) rightly points out, using fluorescent dye as pollen analogue and simply scoring the presence/absence of dye on a flower surely would overestimate the extent of dispersal because stigmas are often more receptive to the much smaller dye particles than they are to pollen grains.

Therefore, dye particles may remain longer on a pollinator than do pollen, as was found in the comparative study to the transfer of pollen and fluorescent dye (Thomson et al. 1986). However, whereas pollen of S. latifolia is size-ranged 35-60m (Prentice et al. 1984), teliospores are much smaller, ranging from 6-9m (Zogg 1985, see also figure 5). Fluorescent dye particles are more or less of equal size as M. violaceum teliospores, and may therefore be better spore-analogues than they are pollen analogues, although they may be more sticky due to their irregular shape (personal observation). We use different colored dyes to differentiate between dye transmission from S. dioica, and from S. latifolia plants in our experiments.

I TI T I T I T I T I This thesis presents one of the first ecological studies on host race differentiation of a plant pathogenic fungus in host sympatry. Fungal isolates of the anther smut M. violaceum from allopatric populations of S. latifolia and S. dioica have previously shown to be differentiated, which was demonstrated by several authors (e.g. Zillig 1921, Perlin 1996). In sympatric populations of hosts, at least some gene flow is expected, which would act to homogenize the differentiation. On the other hand, if spores from one host species are deposited on the alien host species, this may result in such fitness penalties for the pathogen, that differentiation is maintained, or can even be increased. Differentiation that is observed in allopatry, not necessarily has evolved in allopatry. As the empirical evidence for host race formation and speciation in sympatry is scarce, and heavily biased towards phytophagous insect systems, it would be interesting to show in the Silene-Microbotryum system whether the differentiation between fungal isolates could have evolved in host sympatry. This would strongly contribute to the understanding of the scope for sympatric divergence, host race formation and speciation.

The main aim of this study is to investigate host-specific differentiation between fungal strains from S. latifolia and S. dioica, as they appear in allopatric, parapatric and sympatric populations of these host species, in the evolutionary context of host race formation and speciation. More specifically, I will try to assess the degree of genetic divergence at different levels of host sympatry, the existence of performance trade-offs, factors affecting reproductive isolation (e.g. vector behavior (fungal gene flow), assortative mating, and reinforcement (inferiority of hybrid dikaryons)), and other processes that may be involved in creating, maintaining, or dissolving genetic divergence between fungal isolates from different host species.

Genetic differentiation and degree of sympatry - In chapter 2, we will address the question to what extent strains from the two host species have diverged and whether the extent of divergence is affected by the degree of host sympatry. For this purpose, a microsatellite study was performed, analyzing the population genetic structure of anther smut populations that were isolated from a number of allopatric, parapatric and sympatric populations of S. latifolia, S. dioica and their interspecific hybrids, from locations in the Netherlands, France and the United Kingdom.

Impact of host spatial structure on differentiation - In chapter 3, the host spatial structure of one of the more sympatric populations from chapter 2 was examined in more detail. Specifically, the impact of host patch structure on the allele frequencies of the sporidial colony color marker was investigated. Furthermore, the multilocus microsatellite genotypes (from chapter 2) were plotted geographically in the population, and we analyzed the randomness of distribution of alleles over the population.

Mating and competitive ability of strains - In chapter 4, assortative mating and competitive ability of strains from the two host species were estimated. In a mating experiment, isolates from allopatric hosts from S. latifolia and S. dioica were crossed in vitro in a complete diallel. The conjugation frequencies after 24h in different host extracts and in water were evaluated. Furthermore, fungal isolates from both host species were used in a competition experiment in vivo on both S. latifolia and S.

dioica, analyzing their infection success. Also, the amount of multiple infections of a single host was estimated in this experiment. A direct link between the mating experiment and the competition experiment was provided by a sub set of isolates that were used in both experiments. From these experiments, the relative fitness of strains from both host species in different host environments was estimated.

Host fidelity of vectors - In chapter 5, the role of vectors in effectuating positive assortative mating between strains from the two host species was studied. We investigated the fidelity of pollinators/vectors for a specific host species in a set of experiments in which fluorescent dye was used to trace vector movements over artificial, and fully mixed plots of S. latifolia and S. dioica. In these experiments, we distinguished between diurnal and nocturnal pollinator guilds, and varied patch size of the host species. In addition, the distance over which dye was transferred in 24h was compared to the distance of true infection rates of M. violaceum in an experiment that examined infection of healthy S. latifolia over one flowering season, given a large teliospore source.

Implications for host races in sympatry - In chapter 6, the results of the study are summarized and discussed. Special attention is paid to fungal isolates from S.

latifolia and S. dioica in sympatry, addressing the main questions of this study: what factors are involved in creating, maintaining or dissolving of (genetic) variation between fungal isolates from S. latifolia and S. dioica;

to what extent is the degree of sympatry influencing this variation;

and is there a balance between migration and selection?

T with Arjen Biere and Jos van Damme submitted to Molecular Ecology We investigated genetic diversity in West-European populations of the anther smut Microbotryum violaceum in sympatric, parapatric and allopatric populations of the host species Silene latifolia and S. dioica, using four polymorphic microsatellite loci.

Between the allopatric host populations of S. latifolia and S. dioica, the fungus was highly differentiated, and revealed clear and distinct host races for these host species. In all sympatric and parapatric populations, except for one sympatric population in which the two host species grew truly intermingled, we found significant population subdivision with respect to host species as well, exhibiting high values of FST and RST. The extent of genetic differentiation between the host races decreased with increasing degree of sympatry, indicating increased levels of gene flow in more sympatric populations. Genetically, fungal isolates from interspecific hybrids resembled isolates from S. latifolia more than isolates from S. dioica.

The mean number of alleles per locus for isolates from each of the host species was significantly higher in sympatric/parapatric than in allopatric populations, suggesting that the nearby presence of strains from other host species can increase the level of genetic variation in each of the demes. Observed levels of heterozygosity were significantly lower than expected under Hardy-Weinberg equilibrium, confirming the selfing nature of this fungus. The overall levels of heterozygosity were found to be significantly lower in samples from S. dioica than in samples from S. latifolia.

The observed host-related genetic differentiation among these geographically spread populations suggest a long-term divergence between these host races of M. violaceum that most likely has evolved in allopatry. In sympatric host populations, both host races presumably come in secondary contact, and host-specific alleles are exchanged depending on the degree of sympatry in the population.

I T TI Plant parasites can often exploit more than one host species, and show intraspecific variation in host use. Different host species can represent different ecological niches to which the parasite can adapt by natural selection. When different host species occur in allopatry and are isolated by distance, pathogen populations are isolated as well, and subject to random processes such as genetic drift, especially when population sizes are small (Wright 1931;

Kimura 1955). The process of genetic divergence is strongly enhanced by disruptive selection on habitat preference (Rice and Salt 1990), or on fitness related aspects of the specific combination of host and parasite (e.g. in spider mites: Gotoh et al. 1993) where host and mate selection are correlated. As correlations between host (habitat) preference and assortative mating develop (e.g. offspring returning to the parental habitat to mate), host race formation can occur either in allopatry, or when different hosts (habitats) are present within the cruising range of the parasite, in sympatry as well (Berlocher 1998a;

Via 1999). In general, host race formation in sympatry is poorly documented in literature (but see Tauber and Tauber 1989;

Berlocher 1998a), and almost solely devoted to phytophagous insects (e.g. in frugivorous flies: Bush 1969;

in pea aphids: Via 1999;

2000). Many genera of insects exhibit variability in numerous behavioral, physiological and ecological traits that could advance sympatric speciation, including mating in association with the host, or after habitat selection (see Tauber and Tauber 1989 for review).

In phytophagous fungi, there are a few examples of host races, or species that might have evolved in sympatry (for instance in three Phytophtera palmivora sub species), but even in these cases it is feasible that they arose in allopatry, and that their ranges became overlapping at a later stage (cf. Burnett 1983). The evidence for (sympatric) host race formation and speciation point to two major factors (Brasier 1987), (1) (micro-)climate, in which divergence is promoted by locally strong gradients and discontinuities, and (2) substrate, in which divergence is driven by opportunistic nutritional strategies of the pathogen. However, most of these studies are strongly biased towards more economically important organisms (see Brasier 1987 for review), putting the emphasis unintentionally on the host rather than on the pathogen (but see Giraud et al. 1999). This also holds true for the physiological specialization of smut fungi in the review of Fisher and Holton (1957 p.331) that examines susceptibility and resistance of cereal and oat smuts of the Ustilago genus.

Nevertheless, they represent good examples of host specialization in phytopathogenic fungi, which can be a starting point for host race formation and, eventually, for speciation. Recent examples often use molecular markers in search of a genetic basis of (sympatric) host races, e.g. studies by Peever and co-workers in Alternaria (brown spot fungus of citrus), showing host-related genetic differentiation between citrus fruit cultivars (Peever et al. 1999;

Peever et al. 2000), and in Macrophomina (charcoal rot fungus infecting root tissue of some crop species) showing both genetic differentiation between host species, and combine this with data on host preference (Su et al. 2001).

From the ecological examples, perhaps the most extensively studied organism in this field is the anther smut Microbotryum violaceum.

The anther smut fungus M. violaceum, phytopathogenic fungus of the Caryophyllaceae (Pinks), provides a good model system to examine sympatric host race formation in natural field populations, since a number of hosts occur in sympatry and hybridize where habitats overlap (Baker 1947;

1948;

Goulson and Jerrim 1997).

Moreover, strains of this fungus that were isolated from a number of different host species show varying degrees of host differentiation and specialization (Zillig 1921;

Biere and Honders 1996a) and genetic differentiation (Perlin 1996;

1997;

Shykoff et al. 1999;

Bucheli et al. 2000). Karyotype studies of fungal strains from a wide range of host species within the Caryophyllaceae, examined by Perlin and co-workers, showed polymorphisms in both chromosome number and length (Perlin 1996;

Perlin et al. 1997). Microsatellite analysis also revealed strong host-related differentiation in various caryophyllaceous host species (Shykoff et al. 1999;

Bucheli et al. 2000). In all these studies the existence of a number of genetically different host races or formae speciales of anther smut have been demonstrated in allopatric populations of hosts. In sympatric populations of hosts, gene flow between fungal isolates may be common if prezygotic isolation mechanisms are weak, or absent. However, the amount of fungal gene flow, the impact of this gene flow on the differentiation among fungal isolates, and whether fungal isolates from sympatric populations of hosts show host-related genetic differentiation and are diverged in sympatry, is yet unclear.

In this study we focus on two of the fungus host species Silene latifolia and S.

dioica, common dioecious herbs in Western Europe with quite different yet frequently adjacent habitats. The occurrence of interspecific hybrids between these plant species, reported to constitute more than 6% of the sympatric population of Norg (Biere and Honders 1996b), is a silent witness of plant gene flow between these host species, and would suggest that there is fungal gene flow as well. Several authors have reported strong divergence between isolated samples from S. latifolia and S. dioica. Surveys of allopatric populations of hosts in the Netherlands using one of the sporidial colony color loci (Garber et al. 1975) as a marker, showed clear host-specific differentiation between strains isolated from S. latifolia, which were almost fixed for the pink allele and strains isolated from S. dioica, which were almost fixed for the yellow allele (Biere and Honders 1996a;

Van Putten et al. chapter 3). Genetic differentiation between strains from allopatric populations of these host species has been observed using RAPD markers (Biere and Honders, unpublished data) as well as in five microsatellite loci (Bucheli et al. 2001). In addition, cross inoculation experiments between strains from these hosts have shown that strains had up to three-fold higher spore-production on male plants of their hosts of origin, indicating that fungal strains have adapted to their native host species (Biere and Honders 1996a). However, the same study indicated that infection success of strains was not significantly lower on the non-native host species, indicating that gene flow between strains could occur, depending on the behavior of the pollinators that act as vectors of this phytopathogen.

Here, we investigate genetic differentiation and population sub structuring of anther smuts in sympatric and parapatric populations of hosts in comparison to strains isolated from allopatric populations of hosts. Since no constraints on gene flow in sympatric populations are expected a priori due to frequent hybridization between S.

latifolia and S. dioica (Baker 1947;

1948;

Goulson and Jerrim 1997), genetic population subdivision with respect to host species could provide insight into whether the divergence between fungal isolates from these host species could have evolved in sympatry, and whether host-related differentiation could be maintained in the presence of gene flow. Note that the terms sympatry, parapatry and allopatry (sensu Kondrashov and Mina 1986) refer to the two closely related, yet different host species rather than to the fungus itself.

Specific questions that will be addressed in this paper are: (1) To what extent are populations of M. violaceum genetically differentiated due to host species, and/or due to geographic distance? (2) How does scale of sympatry influence the population structure of this fungus, i.e. is fungal gene flow between anther smuts from different host species, estimated by the genetic differentiation among fungal isolates, dependant of the degree of host sympatry?

T I T T The anther smut fungus, Microbotryum violaceum (Pers.:Pers) Deml & Oberw.

(= Ustilago violacea [Pers.] Fuckel) (Ustilaginaceae) (Deml and Oberwinkler 1982) is a heterobasidiomycete that obligatory parasitises susceptible members of the Caryophyllaceae to complete its sexual life cycle, thereby sterilizing the host plant (Baker 1947). The most striking disease symptom of an infection with this fungus is the overriding of the genetically determined sex expression in dioecious host species by halting the development of female reproductive tissue (Audran and Batcho 1981) and inducing the expression of male-specific genes (Scutt et al. 1997) that are also present, yet inactive in female hosts (Matsunaga et al. 1996). In female plants, ovaries are reduced and staminal rudiments develop into stamens that contain purple-brownish smut spores. Male flowers also bear teliospores in their anthers instead of pollen.

Teliospores are diploid thick-walled heterothallic cells that undergo meiosis when they germinate to produce haploid sporidia of two mating types that proliferate asexually by yeastlike growth. Sporidia of opposite mating type conjugate to produce a dikaryotic infection hyphen that can enter a host plant. Spores are transmitted by the natural pollinators of their hosts, which also serve as vectors of this disease (Jennersten 1983).

Silene latifolia Poiret (= Silene alba [Miller] Krause), the white campion is a short-lived perennial weed that grows in open, disturbed habitats. The closely related S. dioica (L.) Clairv., the red campion, is a perennial weed that mainly occurs on the edges of forests and in open woodland. Both species are dioecious and in areas where habitats overlap hybridization is a frequently occurring phenomenon (Baker 1947;

1948;

Goulson and Jerrim 1997). Although both species are common in Western Europe, truly mixed sympatric populations are scarce, or even absent because of differential habitat preferences.

We have sampled eight populations of anther smut in Western Europe (see figure 1 for their geographical distribution), four from sympatric/parapatric populations of hosts, two from allopatric S. latifolia populations and two from allopatric S. dioica populations. All populations contained at least a few hundred host plants at the time of sampling. The sympatric/parapatric populations are all patchy with respect to host species (Table 1). At the Norg sampling site (which has been studied extensively by Biere and Honders 1996b;

1998), patches with predominantly S. latifolia and patches with predominantly S. dioica are closest together, down to a few decimeters (but on average 10-14 meters).

Ng Ab Wh Md Ox Mw Kw Lv Ng = Norg Mw = Millingerwaard Ab = Abbertbos Ox = Oxford Md = Meyendel Kw = Kings Worthy Wh = Wolfheze Lv = Lac Vert Geographical locations of the sampled smut populations of Microbotryum violaceum in Western Europe. Norg, Abbertbos, Oxford and Kings Worthy are sympatric/parapatric host populations containing Silene latifolia, S. dioica and interspecific hybrids, Wolfheze and Millingerwaard are allopatric S. latifolia populations, and Meyendel and Lac Vert are allopatric S.

dioica populations. (Maps created using Online Map Creator;

kk+w - digital cartography, http://www.aquarius.geomar.de/omc/make_map.html).

At the Abbertbos site, patches of both host species are further apart, up to a few decameters at closest, and at the Oxford site they are even more separated, at a distance of a few hectometers from each other. The latter two populations could therefore also be considered parapatric instead of sympatric. In the British population of Kings Worthy, S. dioica was present but no infected individuals were found, hence we lack fungal isolates from this host species at this site. The sympatry level of this population was comparable to that of the population at Abbertbos. In all four sympatric populations (Ng, Ab, Ox and Kw) hybrid hosts occurred within S. latifolia patches, rather than within S. dioica patches. Interspecific S. latifolia x S. dioica hybrids could be distinguished from the pure species forms by their intermediate morphology (Goulson and Jerrim 1997), which is expressed in gradients of leaf shapes, flower colors and hairiness of stems (Baker 1951). Hybrids may include both F1 and backcrosses. In populations that were classified allopatric in this study (Lv, Md, Mw and Wh), the other host species was not observed within a range of a few kilometers.

Detailed information about the collection sites of Microbotryum violaceum teliospores and their Silene host populations (see figure 1 for locations in Europe).

Population Abbrev. Area description Location N Sympatry status Host species Abbertbos Ab 200m x 800m 5226N (39) S. latifolia and Hybrids are S. latifolia Half-open terrain and 549E 17 mixed in patches, S. dioica S. dioica woodland, population 12 are at a discrete distance Hybrids established > 1960 on 10 (100m - 500m). Sympatric / newly claimed land. Parapatric.

Norg Ng 20m x 1 km 5306N (38) All are mixed in patches, S.

S. latifolia Rural roadside, along 630E 21 latifolia and Hybrids in open S. dioica shrubs (see chapter 3 7 areas, S. dioica under trees.

Hybrids for details). 10 True sympatric.

Oxford Ox 2km x 4 km 5141N (119) S. latifolia and Hybrids are S. latifolia Rural, open terrain, 123W 76 mixed in patches, in open S. dioica woodland, in between 36 areas, S. dioica are at discrete Hybrids golf courses and 6 distances (100m few km).

along a pig farm. Parapatric.

Kings Worthy Kw 500m x 500m 5105N (14) S. latifolia and Hybrids are S. latifolia Open terrain, along 117W 12 mixed in patches, S. dioica S. dioica woodland, and high - adjacent in woodland.

Hybrids way. 2 Infected S. dioica not observed. Sympatric / Parapatric.

Lac Vert Lv 20m x 200m 4806N 10 Allopatric.

S. dioica Woodland along lake. 707E Meyendel Md 10m x 200m 5210N 15 Allopatric.

S. dioica Woodland. 430E Millingerwaard Mw 2km x 10km 5152N 15 Allopatric.

S. latifolia Open terrain, along 603E riverside.

Wolfheze Wh 15m x 300m 5200N 9 Allopatric.

S. latifolia Open terrain, rural 548E roadside.

Teliospores were collected from as many infected individual host plants as could be found by browsing through a population, and from both male and female host plants. Where possible, closed flower buds were taken to avoid cross infection.

While gently opening the flower buds, spores were collected in 1.5ml eppendorf cups.

Since only one dikaryon usually manages to grow into a flower (Day 1980), teliospores from single flower buds are regarded to be identical. Diploid teliospores, from single infections, were plated on standard medium (Cummins and Day 1977) with a sterile inoculation loop. Haploid sporidia, produced after teliospore germination and meiosis, were grown for one week. From the agar medium, cells from many colonies were scraped off the plate, put into an eppendorf cup, and freeze dried for several hours. Freeze dried samples were stored in a dry environment containing silica gel until DNA isolation. DNA was isolated using the PureGene Genomic DNA isolation kit for yeast (Gentra systems, Minneapolis MN, USA). DNA was dissolved in 100 l DNA hydration solution (Gentra Systems, Minneapolis MN, USA) and stored at 20C until PCR amplification. DNA from anther smut that is isolated following this procedure contains all genetic material that is present in the original diploid teliospore-parent, thus creating pseudo-diploid DNA samples. We used four microsatellite loci that were developed by Bucheli et al. (1998), which are shown in table 2.

Characteristics of the microsatellite loci (adapted from Bucheli et al. 1998). Ta = annealing temperature. Standard product lengths (in bp) as reported in Bucheli et al. (1998). Allele size range (in bp) as observed in this study and number of alleles in parentheses. Note that locus 17 was omitted from the collection due to amplification difficulties.

Locus Primers (5 to 3) Ta Array Product Size range (bp) (C) length (bp) (# of alleles) 6 GTAGCCACCTCCCATCCC 55 (AG)15 134 116 (8) CGGTGTCGAGTTCCTTGAC 11 AAAACCCAAGACGACTGACGC 53 (AC)11 92 96 (3) TTCCTTCGATGCAGCCTC 14 GTCGTTCTCGCTCTCTC 53 (AG)15 60 62 GGGGCTCGTGAAGCCG (8) 18 CCCCACAGACGGTATGCTGC 55 (AG)15 146 144 CGTGACACCCTTCCTGCCGC (14) Conditions for PCR were modified from Bucheli et al. (1998) in the following way;

reactions were set up in volumes of 15l, each containing 10-50ng DNA, 1 x reaction buffer (with 1.5mM MgCl2), 0.3mM dNTP, 0.4 units of Expand Taq polymerase (Roche, Indianapolis IN, USA), 2pmol Cy5-fluorescent labeled forward primer and 2pmol reverse primer (loci 6 and 18), and 20pmol Cy5-labelled forward primer and 20pmol reverse primer (loci 11 and 14). PCR reactions (40 cycles) were performed in a PTC-200 thermal cycler (MJ Research, Watertown MA, USA). PCR products were visualized using an ALF Express II sequencing system (Amersham Pharmacia Biotech, Uppsala, Sweden). The length of the PCR fragments, relative to three internal sizers (DNA fragments of known length that are close to, but not interfering with the PCR fragment lengths, that were mixed with the loading buffer and hence were running in the same lane of the gel (Ben Vosman, personal communication)) were calculated using the software package ImageMaster Elite v3. (Amersham Pharmacia Biotech, Uppsala, Sweden). Repeat numbers of the different alleles were determined from the amplified fragment length relative to the standard product length as described in Bucheli et al. (1998).

Allele frequencies, mean numbers of alleles per locus (NA), number of unique genotypes (NG), observed heterozygosities (HO), and expected heterozygosities (Neis unbiased estimate of HS, Nei 1987) were determined for all populations with the use of BIOSYS-1 (Swofford and Selander 1989). Deviations from Hardy-Weinberg expectations were tested by Fishers exact test based on the Markov chain method of Guo and Thompson (1992) in GENEPOP-3.2a (an update of Raymond and Rousset 1995). Linkage disequilibrium was calculated in GENEPOP by creating numerous contingency tables for all pairs of loci, and the independence of these tables was tested with Fishers exact test. Allelic richness (RS, an estimate of the number of alleles per sample that is not biased by sample size;

El Mousadik and Petit 1996), conventional F-statistics (values FST, FIT and FIS;

Weir and Cockerham 1984), and values for RST (F-statistic analogues that also take into account the size of the allele (Slatkin 1995) and assume a stepwise mutation model) were calculated with the help of FSTAT-2.9. (an update of Goudet 1995). The effective number of migrants per generation Nm (Slatkin 1995) between anther smuts within a sympatric and/or parapatric host population was calculated using the Private Allele method of Barton and Slatkin (1986) in GENEPOP, and by hand calculation from derived FST and RST values using an adaptation of Wrights infinite island model (1951) by Crow and Aoki (1984).

They considered an n-island model of population structure with the infinite alleles model of neutral mutation, and showed that, at equilibrium:

FST, (eq. 1) (1+ 4Nm) where n =, (eq. 2) n - and n the number of islands. In our case each host type (the two parental species and hybrids) is considered an island for the fungus. Therefore, we set n=3, and hence =2.25. To test for isolation by distance, a Mantel test (Mantel 1967), which calculates the correlation between the genetic and the geographical distance matrix (10000 permutations), was performed by GENEPOP. An analysis of molecular variance (AMOVA;

Weir and Cockerham;

1984, Excoffier et al. 1992;

Weir 1996) was performed by ARLEQUIN-2.00 (Schneider et al., 2000). Observed heterozygosities over all loci between pooled host samples were analyzed using the GENMOD procedure in SAS-v8 (The SAS Institute Inc., Cary NC, USA). A consensus Neighbor Joining tree based on Neis unbiased genetic distance was constructed using PHYLIP-3.5c (Felsenstein, 1993), using a Swiss anther smut population from S. acaulis (adapted from Bucheli et al. 2000) as an outgroup.

Bootstrap values were derived after 10000 resamplings of the data.

T Table 3 shows the allele frequencies of the four microsatellite loci for all sampled populations. The heterozygosities, and F and R-statistics for all four microsatellite loci are given in table 4. Table 5 shows these molecular diversity indices for each of the populations averaged over these loci. All four loci contribute to the significant genetic sub structuring with high values of FST and RST, both among populations and among host species (Table 4). Except for locus 11, the patterns of observed and expected heterozygosities are consistent among loci.

Allele frequencies for four polymorphic microsatellite loci in Microbotryum violaceum.

Alleles are displayed here as numbers of whole repeats. The underlined frequencies in the bottom part of the table denote the most frequent alleles in the pooled hosts (cumulative % of 75 or more). = Silene dioica plants were present in the population, but no infected specimen were found.

Microsatellite locus Population Abbrev.

6 11 14 Host species (N) Allele Freq Allele Freq Allele Freq Allele Freq Abbertbos Ab S. latifolia (17) 6 0.382 13 0.412 19 0.412 15 0. 8 0.500 14 0.088 20 0.588 16 0. 18 0.118 15 0.500 34 0. S. dioica (12) 6 0.042 14 0.083 16 0.208 15 0. 8 0.125 15 0.917 17 0.333 29 0. 17 0.750 18 0.250 34 0. 18 0.083 20 0. 23 0. 24 0. Hybrids (10) 6 0.550 13 0.200 17 0.100 16 0. 8 0.350 14 0.250 19 0.200 19 0. 17 0.100 15 0.550 20 0.500 28 0. 23 0.200 34 0. Norg Ng S. latifolia (21) 6 0.905 13 0.429 16 0.095 16 0. 18 0.095 14 0.119 19 0.333 17 0. 15 0.452 20 0.547 28 0. 21 0.024 29 0. 34 0. 35 0. 36 0. S. dioica (7) 6 0.857 13 0.214 19 0.286 17 0. 8 0.071 14 0.214 20 0.714 28 0. 18 0.071 15 0.571 34 0. Hybrids (10) 35 0. 6 1.000 13 0.150 19 0.450 17 0. 14 0.150 20 0.450 28 0. 15 0.700 21 0.100 31 0. 35 0. 36 0. (Table 3 is continued on next page) (Table 3continued) 6 11 14 Oxford Ox S. latifolia (77) 8 0.864 13 0.428 16 0.169 14 0. 9 0.104 15 0.572 17 0.013 15 0. 10 0.013 19 0.805 16 0. 17 0.013 20 0.013 17 0. 19 0.006 28 0. 31 0. 34 0. S. dioica (36) 8 0.043 13 0.014 16 0.114 16 0. 17 0.771 15 0.986 17 0.843 27 0. 18 0.171 19 0.043 30 0. 19 0.014 31 0. Hybrids (6) 34 0. 6 0.083 13 0.500 19 0.833 15 0. 8 0.750 15 0.500 20 0.167 16 0. 9 0.167 17 0. Kings Worthy Kw S. latifolia (12) 8 0.917 13 0.458 16 0.042 15 0. 9 0.083 15 0.542 17 0.083 16 0. 19 0.875 17 0. S. dioica (-) - - - - - - - - Hybrids (2) 8 1.000 13 0.500 16 0.500 15 1. 15 0.500 19 0. Lac Vert Lv S. dioica (10) 17 0.857 15 1.000 16 0.600 31 0. 18 0.143 18 0.400 34 0. 35 0. Meyendel Md S. dioica (15) 18 0.733 15 1.000 18 1.000 31 0. 19 0.267 33 0. 34 0. Millingerwaard Mw S. latifolia (15) 7 0.033 13 0.567 16 0.321 15 0. 8 0.967 15 0.433 17 0.071 16 0. 19 0. 20 0. Wolfheze Wh S. latifolia (9) 6 0.438 14 0.389 19 0.611 16 0. 8 0.563 15 0.611 20 0.389 34 0. (Table 3 is continued on next page) (Table 3continued) 6 11 14 Within host species S. latifolia (151) 6 0.193 13 0.417 16 0.133 14 0. 7 0.003 14 0.050 17 0.020 15 0. 8 0.700 15 0.533 19 0.633 16 0. 9 0.060 20 0.210 17 0. 10 0.007 21 0.003 28 0. 17 0.007 29 0. 18 0.027 31 0. 19 0.003 34 0. 35 0. 36 0. S. dioica (80) 6 0.086 13 0.025 16 0.158 15 0. 8 0.046 14 0.031 17 0.424 16 0. 17 0.553 15 0.944 18 0.278 17 0. 18 0.257 19 0.044 27 0. 19 0.059 20 0.076 28 0. 23 0.013 29 0. 24 0.006 30 0. 31 0. 33 0. 34 0. 35 0. Hybrids (28) 6 0.571 13 0.268 16 0.036 15 0. 8 0.357 14 0.143 17 0.036 16 0. 9 0.036 15 0.589 19 0.446 17 0. 17 0.036 20 0.375 19 0. 21 0.036 28 0. 23 0.071 31 0. 34 0. 35 0. 36 0. Different alleles 8 3 8 Observed and expected heterozygosities (HO and HS), and F and R-statistics of each of the four microsatellite loci among populations and among isolates of the fungal pathogen Microbotryum violaceum from different host species.

Hierarchical Heterozygosities F-statistics R statistics structure Locus HO HS FST FIS FIT RST Among 6 0.138 0.319 0.598 0.565 0.825 0. populations 11 0.642 0.403 0.212 -0.595 -0.257 0. 14 0.113 0.498 0.459 0.706 0.841 0. 18 0.199 0.534 0.347 0.725 0.820 0. All 0.273 0.439 0.420 0.395 0.649 0. Among 6 0.127 0.551 0.379 0.746 0.842 0. host species 11 0.591 0.403 0.212 0.230 -0.161 0. 14 0.134 0.643 0.273 0.795 0.851 0. 18 0.224 0.844 0.111 0.798 0.821 0. All 0.269 0.610 0.247 0.560 0.669 0. Molecular diversity in populations of the fungal pathogen Microbotryum violaceum, expressed in mean number of alleles per locus (NA), number of unique genotypes (NG), observed and expected heterozygosities (HO and HS) and F-statistics and RST value averaged over four microsatellite loci. = Significant heterozygote deficiency (p<0.05) is denoted by a star (*) in the column of HO.

Population Molecular diversity indices averaged over four microsatellite loci Host species (N) NA NG HO SE HS SE FIS FIT FST RST Abbertbos (39) 5.0 27 0.41 0.10 * 0.69 0.05 0.262 0.456 0.264 0. S. latifolia (17) 2.8 12 0.56 0.16 0.57 0.02 0. S. dioica (12) 3.8 7 0.10 0.04 * 0.45 0.13 0. Hybrids (10) 3.5 9 0.53 0.13 0.64 0.02 0. Norg (38) 4.5 25 0.31 0.16 * 0.51 0.13 0.385 0.413 0.046 0. S. latifolia (21) 4.0 13 0.32 0.16 * 0.49 0.10 0. S. dioica (7) 3.0 6 0.32 0.19 0.53 0.11 0. Hybrids (10) 3.0 9 0.28 0.14 0.48 0.17 0. Oxford (119) 5.5 48 0.23 0.12 * 0.60 0.08 0.455 0.708 0.464 0. S. latifolia (77) 4.5 28 0.28 0.18 * 0.44 0.10 0. S. dioica (36) 3.5 18 0.10 0.03 * 0.36 0.11 0. Hybrids (6) 2.5 6 0.38 0.22 0.50 0.09 0. Kings Worthy (14) 2.5 8 0.27 0.22 0.37 0.09 0.173 0.477 0.367 0. S. latifolia (12) 2.5 6 0.27 0.22 0.32 0.08 0. S. dioica (-) - - - - - Hybrids (2) 1.5 2 0.25 0.25 0.33 0.19 0. Lac Vert (10) 2.0 8 0.16 0.11 0.34 0.13 0. S. dioica Meyendel (15) 1.8 4 0 0 * 0.16 0.10 1. S. dioica Millingerwaard (15) 2.5 9 0.27 0.20 0.36 0.16 0. S. latifolia Wolfheze (9) 2.0 7 0.29 0.16 0.46 0.05 0. S. latifolia Among host sp (259) 8.3 122 0.27 0.12 * 0.61 0.10 0.561 0.669 0.246 0. S. latifolia (151) 6.5 66 0.32 0.18 * 0.58 0.06 0. S. dioica (80) 6.5 43 0.11 0.02 * 0.58 0.17 0. Hybrids (28) 5.5 25 0.38 0.16 * 0.67 0.08 0. Among pops (259) 8.3 122 0.27 0.13 * 0.44 0.09 0.396 0.649 0.419 0. Significant deviations from Hardy-Weinberg equilibrium (HW) were observed for all samples from S. dioica populations (p<0.002), and for populations from allopatric S. latifolia (p<0.05 and smaller), indicating that one or more of the HW assumptions were violated (results not shown). In most populations, all loci were in linkage equilibrium. In only two of the populations (Ab and Ox), most of the locus pairs showed significant linkage disequilibrium (p<0.05 and smaller), except for locus pairs involving locus 11 in the Abbertbos population, and between locus 14 and 18 in the Oxford population. A number of factors could explain this difference between the populations. Most likely, the loci are not physically linked, but have been subject to high selfing rates, founder effects, historical bottlenecks, or differential selection regimes, but which one of these factors are more important than others goes beyond the scope of this paper.

In the two sympatric/parapatric populations (Ab, Ox), where patches of the two host species were spatially more separated than in the Norg population, significant population differentiation among fungal communities from the host species was observed (p<0.0001), with large values for both FST and RST (Table 5). The same was observed in a population (Kw) that only consisted of fungal isolates from S. latifolia and hybrids (S. dioica was present in this host population, but infected specimen were not found). In Norg however, where the absolute geographical distance between different host patches was the smallest, values for FST and RST were much lower and their deviation from zero was only marginally significant (p=0.08). High values for FIS and FIT, which were significantly different from zero, were observed for most fungal populations in allopatric, parapatric and sympatric host populations including Norg, indicating high inbreeding levels both for fungal samples within host species and for fungal samples from different hosts within the total population. Only the fungal strains from Abbertbos S. latifolia showed lower values for FIS that were not significantly different from zero. Logically, a similar pattern is observed for heterozygosities (Table 5). In all populations, except samples from Abbertbos S. latifolia, observed heterozygosities (HO) were lower than expected (Neis unbiased estimate for HS), indicating heterozygote deficiency (HD), but this was not in all populations significant (Table 5;

populations indicated with * show significant HD, with p<0.05 or smaller).

Estimates of the effective number of migrants per generation (Nm) of the fungus Microbotryum violaceum between the host species Silene latifolia, S. dioica and the interspecific hybrids, using the Private Allele (PA) method (Barton and Slatkin 1986), and derived directly from FST and RST values. Mean distances between different host species are rough estimates.

Pop. Distance between Mean Frequency of Estimate of Nm derived via different host species N private alleles PA FST RST Mean Norg < 1m - 10m 12.7 0.11 0.86 2.30 3.01 2. Abbertbos < 10m - 100m 13.0 0.24 0.16 0.31 0.43 0. Oxford < 100m 1000m 39.3 0.10 0.58 0.13 0.01 0. In general, values for RST were comparable to the values for FST, except for the sympatric/parapatric region of Oxford, indicating that in this population frequency differences for larger and smaller alleles were large between the different host categories. In this population the larger alleles from loci 6 and 18 were more frequent in samples from S. dioica, and the smaller alleles in these loci were more frequent in samples from S. latifolia and hybrids (Table 3). An indirect estimate of the amount of gene flow is the effective number of migrants per generation (cf. McDermott and McDonald 1993). Estimates for this number were derived from FST and RST values (Crow and Aoki 1984), and additionally from the number of private alleles (Barton and Slatkin 1986). Table 6 shows that the estimates produced by the different methods were in the same range. If absolute distance between S. latifolia and S. dioica hosts is a measure for the relative scale of sympatry, the number of migrants based on FST and RST values decreased rapidly with decreasing sympatry level, but not for the estimate based on the number of private alleles. However, we found no evidence for isolation by distance;

significant correlations between the genetic and the geographical distance between pairs of populations were neither observed using FST/(1-FST), nor using RST/(1-RST) as an estimate for the genetic distance between population pairs (Mantel test;

p>0.23 and larger).

4, 3, 3, 2, 2, Mean+SE 1, Mean-SE AS AS Mean S. latifolia S. dioica Sympatry status Mean number of alleles per locus ( SE) in samples of Microbotryum violaceum from Silene latifolia (left panel) and S. dioica (right panel) in allopatric (A), and in sympatric/parapatric (S) host populations.

Mean number of alleles per locus Source of variation in mean number of alleles per locus in the fungal pathogen Microbotryum violaceum in sympatric/parapatric (Ab, Ng and Ox) and in allopatric (Lv, Md, Mw and Wh) populations of its host species Silene latifolia and S. dioica (ANCOVA with sample size N taken as covariate). See figure 3 for means and standard errors expressing the difference.

Effect df MS F P-value Sample size [N] 1 0.62 2.8 n.s.

Sympatry status [SYM] 1 3.01 13.4 < 0. Host species [HSP] 1 0.06 0.3 n.s.

SYM x HSP 1 0.10 0.5 n.s.

Error 5 0.22 - Table 5 shows the gene diversity of the anther smut populations expressed as the mean number of alleles per locus. The mean levels of variation ( SE) of anther smuts in allopatric populations of hosts (2.25 0.3 for S. latifolia and 1.88 0.5 for S.

dioica) are significantly lower (Table 7 and Figure 2;

p<0.015) than the mean levels of variation ( SE) in sympatric/parapatric host populations of anther smut (3.75 0. for S. latifolia and 3.42 0.6 for S. dioica). Since the mean number of alleles is likely to be highly dependent on sample size, we also calculated allelic richness RS (El Mousadik and Petit 1996). The difference in allelic richness was also highly significantly different (p<0.0025) between samples from allopatric (RS=1.93) and sympatric (RS=2.81) populations of hosts. This pattern holds true for fungal populations in both the Netherlands and the UK, strengthening the suggestion that higher levels of variation in the pathogen can be maintained in the presence of another host species.

Observed heterozygosities in samples of the fungal pathogen Microbotryum violaceum from Silene latifolia, S. dioica and the interspecific hybrids (LR statistics, type III;

procedure GENMOD in SAS).

Main effect df P-value Contrasts between host species Host species 2 61.8 <0. S. latifolia vs. Hybrids 1 2.0 n.s.

S. dioica vs. S. latifolia and Hybrids 1 57.6 <0. For the analyses of host-related genetic differentiation, data were pooled within host species (Table 3). Besides the heterozygote deficiency at the population level, observed heterozygosities were significantly lower for pooled samples from S. dioica samples than for pooled samples from S. latifolia and hybrids (Table 8).

Consequently, values for FIS in samples from S. dioica were also much larger than in samples from S. latifolia and hybrids. The high FST and RST values (Tables 4 and 5) showed significant genetic differentiation between smut samples from different host species. Table 3 shows that pooled host samples from S. dioica harbored the larger alleles in higher frequencies for loci 6 and 18, whereas pooled host samples from S.

latifolia carried the smaller alleles in higher frequencies. The other loci, when pooled within host species, also produced host-specific patterns, e.g. samples from S. dioica predominantly had allele size 15 for locus 11, whereas samples from S. latifolia and hybrids showed both allele sizes 13 and 15 in high frequency. Likewise, at locus samples from S. dioica had predominantly allele size 16 to 18, whereas samples from S. latifolia and hybrids showed predominantly allele sizes 19 and 20.

Sources of variation in F and R-statistics revealed by Analysis of Molecular Variance (AMOVA), as calculated in ARLEQUIN (Schneider et al. 2000).

Sum of Squared Variance % Variation Source of Variation Deviancies components df FST RST FST RST FST RST Among host species 2 109.7 19196.2 0.38 66.7 24.5 56. Within host species 515 594.4 26073.6 1.15 50.6 75.5 43. Total 517 704.1 45269.8 1.53 117.3 100 Table 9 shows the results of the analysis of molecular variance (AMOVA, Michalakis and Excoffier 1996). When the AMOVA is based on allele differences (assuming the infinite allele mutation model, FST), 25% of the observed variance is due to differences between host species. However, when alleles size matters in the analysis (assuming the stepwise mutation model, RST), 57% of the observed variance can be attributed to host species. The difference between FST and RST based AMOVAs is again accounted for by large frequency differences of the larger (S. dioica) and the smaller (S. latifolia and hybrids) alleles of loci 6 and 18 (Table 3). As results may be biased by the large sample size of the Oxford population (46% of the samples), we repeated the analysis excluding the Oxford population. This yielded basically the same result. Variance due to host differences is 20% for the AMOVA based on FST and 38% based on RST.

Oxford 34% Oxford 19% Kings Worthy 32% Kings Worthy 38% 49% Millingerwaard Abbertbos 53% Wolfheze 42% Abbertbos 100% 55% Norg 57% 82% Norg Norg Meyendel 58% Lac Vert 59% Oxford 51% Abbertbos Outgroup Majority rule consensus Neighbor Joining tree expressing overall levels of Neis unbiased genetic distance between the sampled populations of Microbotryum violaceum. Distances are based on four microsatellite loci. Open circles denote smut samples from Silene latifolia, filled triangles denote smut samples from S. dioica, and hatched diamonds denote smut samples from interspecific hybrid hosts. Population locations correspond to those in table 1 and figure 1. Percentages denote bootstrap values after 10000 resamplings. The outgroup (denoted by a gray star) is smut sampled from a Swiss population of S. acaulis (adapted from Bucheli et al. 2000).

Figure 3 shows the consensus Neighbor Joining tree based on Neis unbiased genetic distances (Nei 1987) produced after 10000 bootstrap resamplings. Clustering occurs in three major groups, with bootstrap values of 50% and larger. One distinct group is formed by samples from S. dioica on the one hand and samples from S.

latifolia and hybrids in two distinct groups on the other. One of the S. latifolia/hybrid groups includes the complete Norg population, which form a separate clade themselves in 82% of all examined trees. The other S. latifolia/hybrid group basically consists of the samples from British S. latifolia and hybrid hosts together with the sample from Millingerwaard S. latifolia hosts. However, bootstrap values within the latter group never exceed 38%, and we therefore do not consider sub clustering within this group. Clear however is that fungal samples from hybrid origin are more similar to samples from S. latifolia, than to samples from S. dioica.

I I In the sympatric and parapatric host populations, highly significant genetic differentiation was observed between fungal isolates from S. dioica hosts on the one hand and S. latifolia and hybrid hosts on the other, resulting in local population structuring of M. violaceum. The extent to which host species are mixed in the population, i.e. the degree of sympatry proved to be important for the genetic population structure of the pathogen (Table 7). This is not surprising since spatial scale plays a major role in the evolutionary dynamics of host-pathogen systems (Real and McElhany 1996;

Thrall and Burdon 1997;

Burdon and Thrall 1999). Only in the Norg population where interspecific plant distance is as close as a few decimeters, gene flow between the two host races, estimated indirectly by numbers of migrants (McDermott and McDonald 1993) was larger than 1, and high enough to keep FST and RST values low. When interspecific host plant distances increases, gene flow apparently decreases rapidly. Except for samples from the Abbertbos S. latifolia population, in all samples high values for FIS (and FIT) were observed. This results in significant heterozygote deficiency in three sympatric, and in one allopatric host population. The insignificance of heterozygote deficiency in the other samples is probably due to the lower sample sizes. It is unclear why the samples from S. latifolia in the Abbertbos population have lower FIS (and FIT) values than all other populations.

Significant heterozygote deficiency can be caused by the presence of null alleles (Pemberton et al. 1995). Since only a few of our samples did not amplify at all during the PCR, we do not believe that null alleles caused the heterozygote deficiency in this study. Alternatively, significant heterozygote deficiency can indicate high levels of inbreeding. Selfing in this fungus is thought to be the rule rather than an exception (Baird and Garber 1979;

Hood and Antonovics 1998;

Kaltz and Shykoff 1999).

Therefore, the observed heterozygote deficiency, except for samples from Abbertbos S. latifolia, could be explained by high selfing rates, which is consistent with the results of Bucheli et al. (2000;

2001). Contrary to what Bucheli and colleagues found, samples from S. dioica showed significantly lower heterozygosities than samples isolated from S. latifolia or hybrids, indicating that selfing rates are higher in samples from S. dioica than in samples from S. latifolia and hybrids. A possible explanation could be the difference in mean numbers of flowers produced per plant between the two host species. Diseased S. dioica produce more flowers per flowering stalk, and more flowering stalks per plant than diseased S. latifolia (Biere and Honders 1996a).

Since all teliospores that are produced in the flowers of a single shoot are almost always the result of a single infectious dikaryon (Day 1980), they will be genetically identical. Many pollinators, serving as vectors of this disease (Jennersten 1983), visit flowers of a single plant often sequentially (personal observation), and will pick up relatively more of the same spores on S. dioica hosts than on S. latifolia hosts in a geitonogamous manner (Kiang 1972;

Morris et al. 1994). These spores are likely to be deposited on conspecifics of the host species of origin rather than on heterospecifics (Van Putten et al. chapter 5), which should lead to fewer opportunities for outcrossing on S. dioica than on S. latifolia.

Previous studies of genetic diversity within allopatric populations of the anther smut fungus M. violaceum have shown little variation in allozymes (Antonovics et al.

1996) in North America, and in microsatellite loci (Bucheli et al. 2001) in Switzerland. In allopatric populations of S. latifolia and S. dioica hosts, we find levels of variationwhen variation is expressed in mean numbers of alleles per locusthat are comparable to these studies. Interestingly however, we find significantly higher levels of variation in this fungus in sympatric and parapatric than in allopatric host populations, both in the populations from the Netherlands and in the population from the UK. This leads to the suggestion that higher levels of variation in the pathogen can be maintained in the presence of another host species, even if the levels of gene flow between fungi from one host species to another are low. In a scenario where the two host races have evolved in allopatry, followed by the present situation in which the genetically differentiated fungal populations come in secondary contact with each other in parapatry or sympatry, low levels of gene flow will cause the mutual exchange of alleles and enlarge the variation in both host races, as was observed in a hybrid zone of two chromosome races of the common shrew (Wyttenbach et al.

1999). Selectively neutral variation, as variation in microsatellite loci is assumed to be (cf. Goldstein and Sltterer 1999), may be maintained for long periods of time.

Explanations for a more active maintenance of this higher level of genetic variation are far more speculative. For instance, if these microsatellite loci are not neutral but linked to loci under selection, an explanation could be that natural selection favoring host adaptation keeps fungal isolates from S. dioica and S. latifolia genetically differentiated, while low levels of gene flow opposes this force, thereby maintaining the variation.

50% 46,4% 40% 30% 20,6% 20% 17,4% 11,3% 10% 4,0% 0,4% 0% 116 118 120 122 124 126 128 130 132 134 136 138 140 Locus 35,1% 35% 30% 25% 20% 18,6% 16,1% 15% 9,8% 10% 7,6% 6,9% 5,5% 5% 0,4% 0% 144 148 152 156 160 164 168 172 176 180 184 146 150 154 158 162 166 170 174 178 182 Locus Histograms of the allele sizes of locus 6 (upper panel) and locus 18 (lower panel) in the fungal populations of Microbotryum violaceum sampled in this study (n=259 samples). Note the bimodal distribution at both loci.

The genetic variation we have observed is strongly host species related, confirming the existence of separate host races for S. latifolia and S. dioica as Percent of observations Percent of observations proposed by previous authors (Zillig 1921;

Biere and Honders 1996a;

Bucheli et al.

2001). Allele frequency differences of all four microsatellite loci contributed to the host-related genetic differentiation. However, this was especially apparent in two of the examined loci, showing that samples from S. dioica carried the larger alleles in high frequencies, while samples from S. latifolia harbored the smaller alleles in high frequencies. A similar difference is observed in populations of anther smut in Switzerland (Bucheli et al. 2001). Figure 4 displays the frequency distribution of these host-specific alleles. Clearly these distributions are bimodal, showing gaps of seven repeats (locus 6) and nine repeats (locus 18) in the middle. Obviously, when the fungus would be considered as one species, a more continuous distribution is expected under the stepwise mutation model (Kimura and Ohta 1978). There are at least two different explanations for the occurrence of these gaps. First, mutations (most likely an insertion or a deletion) in one of the flanking regions of the microsatellite locus could explain mutational steps larger than single repeats in the allele size frequency distribution. However, there is evidence that flanking regions of microsatellite loci are highly conserved (e.g. among marine turtles: FitzSimmons et al 1995;

among cichlid fish: Rico et al 1996;

Zardoya et al. 1996) and that mutant alleles generally are non recombinant for flanking markers (cf. Ellegren 2000). Also, at both loci intermediate allele sizes have been reported (Shykoff et al. 1999;

Bucheli et al. 2000), mainly occurring in samples from other Caryophyllaceous host species. Therefore, the second explanation for the observed gaps in allele size distribution, long term divergence between the two separate host races, seems more likely. By assuming a stepwise mutation model, large allele size differences indicate long-term divergence between the host races, at least for anther smut populations in Western Europe. In that case, the host race of S. latifolia and the host race of S. dioica share a common ancestor with a certain intermediate allele size at each of these loci. In the period subsequent to divergence from this common ancestor, the mean allele lengths at the individual loci have evolved independently, and in different directions in both host races (Ellegren et al. 1995). Since we found host-specific alleles of similar sizes throughout the populations in Western Europe, such long-term divergence might have evolved in allopatry. Also, sympatric populations of these host species that contracted an infection with this fungal disease are much less abundant than allopatric populations.

Therefore, we speculate that in the sympatric populations that were studied here, both fungal races come into secondary contact with each other.

The consensus Neighbor Joining tree (figure 3) showed that samples from S.

dioica were clearly clustering together, separate from samples from S. latifolia and hybrid hosts. Smut samples from hybrids clustered within the S. latifolia samples.

This is consistent with the observation that interspecific host hybrids grow among S.

latifolia and much less among S. dioica, both in populations in the UK (Goulson and Jerrim 1997;

personal observation) and in populations in the Netherlands (personal observation). Such a distribution may be caused by similar habitat preferences of S.

latifolia and hybrid hosts, but might also be caused by asymmetric pollen flow, going predominantly from S. dioica towards S. latifolia (Goulson and Jerrim 1997), in combination with the limited seed dispersal of these plant species. Such directional pollen flow might be caused by differences in flowering phenology between host species, with S. dioica flowering earlier than S. latifolia (Biere and Honders 1996b), and between host sexes, with males flowering earlier and over a longer period than females (Purrington and Smitt 1998). Since the same vectors that transmit the pollen transmit the spores, similar arguments may hold for fungal gene flow, explaining the genetic resemblance among fungal isolates from S. latifolia and hybrids.

The low bootstrap values within this S. latifolia and hybrids group do not really allow for interpretations that go beyond the observation that all four smut samples from the UK, and five out of six smut samples from the Netherlands appeared in two separate clusters.

The observation that host-specific microsatellite alleles, that are separated by 7 9 repeats between the fungal isolates, occur in populations throughout Western Europe, indicates long-term divergence in the anther smut M. violaceum into two separate host races for S. latifolia and S. dioica. Since the differentiation between fungal isolates in sympatry proved to be significantly lower, this is most likely the result of reproductive isolation in allopatry. If gene flow is high relative to selection, it can prevent divergence and/or break down a situation of reproductive isolation (cf. Orr and Smith 1998). In parapatric populations (Ab, Ox) where fungal strains from different hosts presumably come in secondary contact with each other, levels of gene flow are apparently too low, keeping them genetically differentiated. In the only true sympatric population of hosts that we examined (Ng), low values of FST and RST indicate that there is little genetic differentiation left at the microsatellite loci across isolates from different host categories, and gene flow must therefore be considerably higher than in parapatric populations of hosts.

The results from this microsatellite study contrast with results of a survey of the allelic distribution of one of the sporidial colony color loci (SCC) in the Norg population (Van Putten et al. chapter 3), that showed clear and significant differentiation between the two host races at this locus, although to a significantly lower degree than what was observed between smut from allopatric host populations of these host species. This suggests that this locus is subject to gene flow but that natural selection counteracts further convergence at this locus. Wild type strains of M.

violaceum found on allopatric S. latifolia produce pink colored colonies on standard yeast-glucose-agar medium due to the accumulation of lycopene. The yellow colored mutant phenotype found on allopatric S. dioica converts this lycopene into -carotene through a cyclase that is inactive in the wild type (Garber et al. 1975). Therefore, the selective neutrality of this SCC marker is unclear and there may be host-specific selection on the responsible locus. Assuming that the Norg population of anther smut is in equilibrium, the selectively neutral markers may have converged, while variation in selectively less neutral markers may have maintained some of the divergence that presumably had developed historically in allopatry. In spite of this, we must conclude that we find no direct evidence for active host race formation in pure sympatry in this model system. However, our study clearly presents additional evidence for the existence of separate, genetically diverged host races of the anther smut M. violaceum on S. latifolia and S. dioica in parapatric populations of these host species.

The authors wish to thank Dave Goulson for help with finding and sampling the sympatric and parapatric populations of anther smut in the UK, Erika Bucheli for help with methodological issues, Jerome Goudet for useful discussions on analyzing the dataset, and Peter van Dijk for commenting earlier versions of the manuscript. This study was financially supported by the Earth and Life Science Foundation of the Netherlands Organization for Scientific Research (NWO-ALW);

grant 805-36-391.

T with Arjen Biere, Sonja Honders and Jos van Damme We have studied the effects of spatial structure of the host species S. latifolia and S.

dioica on the genetic structure of the anther smut M. violaceum in a sympatric population of these hosts. For one of the sporidial colony color loci (SCC), divergence among fungal isolates from S. latifolia and S. dioica was significantly smaller relative to allopatric populations of hosts.

Fungal isolates from allopatric populations of S. latifolia are almost fixed for the wild type pink allele, and isolates from S. dioica are almost fixed for the yellow allele. However, in contrast to previous studies using microsatellite loci (in which FST and RST were not significantly different from zero), convergence between both host races in sympatry was far from complete. Among fungal isolates from S. dioica, the frequency of their native yellow allele was 56%, but among isolates from S. latifolia, their native pink allele was close to fixation, as in allopatric populations.

The local host structure, consisting of patches that are mostly dominated by either S.

dioica, or by S. latifolia, had a weakly significant impact on the SCC allele frequencies. This suggested that the anther smut population could be divided into a local deme structure, in which selection and migration might be balanced in such a way that the overall variation in this SCC locus is maintained. A closer look at the microsatellite genotypes showed that the more rare alleles were not randomly distributed over the population either, supporting the hypothesis that the patchiness of the host population shapes the genetic structure of the pathogen.

I T TI Natural populations of pathogens and their hosts tend to be unevenly distributed in space (and time), which is primarily caused by aspects of their dispersal (Burdon et al. 1989). Steepness of pathogen dispersal gradients strongly depends on the mode of dispersal, and increases from dispersal through soils, to wind or rain dispersal, or transmission by direct contact. Pathogens carried by vectors show a wide variety of dispersal patterns, largely reflecting the behavior of their vectors (Burdon et al. 1989 and references therein). Moreover, the patchiness of pathogen populations is enhanced by the patchy local distributions of the hosts themselves, by organizing the populations of organisms that feed on them into numerous local demes (McCauley 1991). A deme structure of local units within which breeding is random will promote local adaptation of the parasite to the hosts within a deme, as is predicted by the adaptive deme formation hypothesis of plant-herbivore systems (Edmunds and Alstad 1978;

Van Zandt and Mopper 1998). Plant pathogens can often employ more than one host species and show intraspecific variation in host use. It has been argued that, to achieve host specialization in sympatry, fitness trade-offs between host species are necessary to compensate for incomplete host fidelity that is likely to occur and would generate gene flow (Feder 1998). If the amount of gene flow is high relative to selection, and/or fitness trade-offs are absent, genetic diversity will homogenize (cf.

Mopper 1996).

In the anther smut fungus Microbotryum violaceum, an obligate parasite of the Caryophyllaceae, host races that each can infect only a limited set of host species have been recognized early in the scientific history of this fungus (Zillig 1921). Recently, fungal isolates from allopatric populations of the closely related host species Silene latifolia and S. dioica proved to be genetically differentiated. They showed different sporidial colony colors (sensu Garber 1975 et al.;

cf. Biere and Honders 1996a), and host-specific microsatellite alleles (Bucheli et al. 2001;

Van Putten et al. chapter 2).

This differentiation may partly reflect the adaptation of this pathogen to these two host species. Besides genetic drift that will be important when population sizes are small and mutation, natural selection acting on fitness differences between individual pathogen strains is the driving force creating genetic diversity. Fitness of the pathogen can be divided in infection success, and performance on the host. With respect to infection success, there is no clear evidence for local adaptation of the pathogen to its host at the within species level (S. dioica, Carlsson-Granr 1997;

S. latifolia Kaltz et al. 1999), nor at the between species level for this pair of host species (Biere and Honders 1996a). In the S. latifolia case, absence of local adaptation might be explained by low migration rates of the pathogen relative to the migration rate of its host species (Gandon et al. 1996;

Delmotte et al. 1999). Notwithstanding the importance of the infection success, or virulence of a pathogen (sensu Jarosz and Davelos 1995), it is certainly not the only factor that influences local host adaptation, and hence the genetic structuring of the pathogen population. At the between host species level, Biere and Honders (1996a) performed a cross-inoculation experiment, using fungal isolates from allopatric S. latifolia and S. dioica, and found a three-fold higher production of smut spores of the native host race in male host plants. This suggested that adaptation of this fungus to its host species might have evolved with respect to aggressiveness (a term used to describe pathogen fitness on a particular host, given that it is virulent to that host, sensu Jarosz and Davelos 1995) rather than virulence.

Interestingly, in sympatric populations of these host species, differentiation among fungal isolates from these two host species was found to be significantly smaller, and dependent on the degree of sympatry of the hosts (Van Putten et al.

chapter 2). In the case that the degree of sympatry reflects the amount of gene flow between the host races, we would expect that in sympatric populations of different host species that have a spatially heterogeneous distribution, differentiation between isolated host patches would be larger than between different host species within a patch. Here, we study the effects of host population structure at a small spatial scale on the genetic population structure of anther smuts in a natural sympatric population of S. latifolia and S. dioica. In chapter 2 of this thesis, the microsatellite analysis of the Norg population showed that values for FST and RST, calculated over host species, were not significantly different from zero. This suggested that there was no population subdivision with respect to host species, and supposedly enough gene flow to neutralize the divergence between the host races of anther smut in this population. In this chapter we study this population in more spatial detail, and include the analysis of the allelic distribution at one of the sporidial colony color loci (Garber et al. 1975) in this population of anther smuts.

Specific questions that will be addressed are: (1) To what extent are the anther smut host races of S. dioica and S. latifolia differentiated in this sympatric population of hosts relative to allopatric populations of host species? (2) Does the degree of host differentiation among fungal isolates depend on local host spatial structure? Since the microsatellite study suggested that there was ample gene flow among smut isolates from different host species, we hypothesize that the differentiation with respect to the SCC marker will be substantially smaller in sympatry than in allopatry. Moreover, since a previous study that quantified the spatial structure in this system stressed the importance of a spatial analysis when host and pathogen populations are subdivided and/or show non-random forms of association that are spatially linked (Real and McElhany 1996 and references therein) as in our case, we hypothesize that the spatial structure of the host population will be reflected in the genetic population structure of this pathogen.

T I T T The anther smut fungus Microbotryum violaceum (Pers.:Pers) Deml & Oberw.

(= Ustilago violacea [Pers.] Fuckel) (Ustilaginaceae) (Deml and Oberwinkler 1982) is a heterobasidiomycete that obligatory parasitises susceptible members of the Caryophyllaceae to complete its sexual lifecycle, thereby sterilizing the host plant (Baker 1947). The most striking disease symptom of an infection with this fungus is the overriding of the genetically determined sex expression in dioecious host species by halting the development of female reproductive tissue (Audran and Batcho 1981) and inducing the expression of male-specific genes (Scutt et al. 1997) that are also present, yet inactive in female plants (Matsunaga et al. 1996). As a consequence, ovaries are reduced, and staminal rudiments develop into stamens that contain purple brownish smut spores. Male flowers also bear teliospores in their anthers instead of pollen. Teliospores are diploid thick-walled cells, which undergo meiosis when they germinate to produce haploid sporidia of two mating types that proliferate asexually by yeastlike growth. In the presence of a susceptible host, sporidia of opposite mating type conjugate to produce a dikaryotic infection hypha that can enter host tissue.

Spores are transmitted by the natural pollinators of their hosts, which also serve as vectors of this disease (Jennersten 1983).

Silene latifolia Poiret (= Silene alba [Miller] Krause), the White Campion is a short-lived perennial weed that grows in open, disturbed habitats and S. dioica (L.) Clairv., the Red Campion, is a perennial weed that mainly occurs on the edges of woodlands. Both species are dioecious and in areas where habitats are adjacent or overlap, hybridization between these species occurs frequently (Baker 1947;

Goulson and Jerrim 1997).

T Although both species are common in Western Europe, truly mixed sympatric populations of S. latifolia and S. dioica are scarce, or even absent because of differential habitat preferences. These habitat preferences of the hosts result in the patchy structure of the sympatric population that we have sampled in Norg (The Netherlands, 5306N 630E). The Norg population, which has been extensively described and studied by Biere and Honders (1996b;

1998), stretches approximately 900m along a rural, infrequently used sandy road, with a frequently interrupted row of shrubs and small trees on both sides. Vast fields of arable land further surround the population. S. dioica host plants grow mainly in the shady humid areas, while S.

latifolia host plants grow in the more open spots. In 1993, the host population was found to be both spatially and temporally sub structured, and consisted of flowering S. dioica (of which 7.4% was systemically infected) and 1041 flowering S.

latifolia (of which 17% was systemically infected). Furthermore, the number of putative hybrids was estimated 5.9% of all the Silene hosts (Baker 1951) and their systemic disease incidence 18.2%. From these figures, a reliable minimum estimate of the population size (= number of infected host plants) of anther smuts in flowering hosts in the Norg population is approximately 240. This is a minimum estimate because of the vegetative infected host plants and putative multiple infections per hosts (see chapter 4). The distribution of the different hosts along the road is non random, showing a high frequency of S. latifolia and hybrids in the first and last quarter of the road, and high frequency of S. dioica in the center part. Individual plants of S. latifolia, S. dioica and interspecific hybrids incidentally grow as close together as a few decimeters in this population.

Between 1991-2000 we sampled teliospores from 18 geographically spread allopatric host populations of S. latifolia (8) and S. dioica (10) from the Netherlands, the UK and France (see chapter 2 for details of four of these populations). In Norg, teliospores were collected from both host species in the flowering seasons of 1991, 1992, 1994, 1995, 1996 and 1998. In 1998, teliospores were collected from the interspecific hybrids as well. In the Norg population, for each sample the exact location of the host plant was marked in x-y coordinates. Whenever possible, teliospores were collected from closed flower buds to avoid cross infection. While gently opening the flower buds, spores were transferred to 1.5ml eppendorf cups.

Since only one dikaryon usually infects a shoot and its flower buds (Day 1980), teliospores from single flower buds are assumed to be identical.

Teliospores were plated onto standard yeast-glucose-agar medium (Cummins and Day 1977). Haploid sporidia, produced after spore germination and meiosis were grown at 21C for one week. Single spore colonies were transferred to new plates containing standard medium. From the samples collected before 1998, single cell colonies were separated and their mating types were determined using reference strains. After a week of growth the sporidial colony color of all strains was determined. Wild type (+) strains of M. violaceum produce pink colonies (Sporidial Colony Color;

SCC) when growing on standard medium due to the formation of lycopene. The yellow colored mutant converts this lycopene into -carotene through a cyclase that is inactive in the wild type (Garber et al. 1975). When in doubt, strains were replated on standard medium to be certain of their SCC genotype. The samples from 1998 were also freeze-dried, and their DNA was isolated and analyzed for four microsatellite loci (Bucheli et al. 1998). This procedure is described in more detail in chapter 2 of this thesis.

The effect of host species in the allopatric host populations, and the effect of host patch type in the Norg sympatric population on the SCC allele frequencies in a patch were tested in a generalized linear model (procedure GENMOD in SASv8 (The SAS Institute Inc.1999, Cary NC USA). For this purpose, the data from Norg were pooled over years, and plotted according to their x-y coordinates. From these coordinates, we defined host patches using a nearest neighbor joining method. A host plant was considered to be in a patch unless he was more distant than 8m from the nearest other host plant in this patch. The threshold value of 8m to attribute plants into different patches was chosen for the following reasons;

first, the linear boundary of spore deposition and infection of a healthy host from an infected source plant was found to be around 10-12m (Alexander 1990;

Roche et al. 1995;

Van Putten et al.

chapter 5). Second, Biere and Honders (1998) investigated the effects of local density and frequency of diseased plants on the probability of hosts to become infected in the Norg population, and found the 8m scale to be a turning point in the effect of disease frequency on infection probability. Below this value, i.e. at small spatial scales, the effect was significantly positive while above this value the effect was insignificant, suggesting that this and smaller spatial scales are the relevant scales for transmission by insect vectors. This way, the Norg samples were grouped into 28 different patches of 2 different types;

14 patches in which S. dioica was the majority host type (>50%) and 14 patches in which S. latifolia (>50%) was the majority host type. We estimated patch size by projecting the ellipse with the maximum x and y differences within the patch, and calculating the surface area. Estimated patch sizes ranged from 1m (solitary plants) to 330m2, with an average size of approximately 55m2. Patches were thus defined based on infected host plants only, a classification that is relevant for the spatial structure of the pathogen population and for assessing the majority host species in a patch with respect to spore source. However, since pollinators/vectors will respond to the spatial structure of both healthy and diseased plants, we checked whether the majority host species based on diseased plants only corresponded to the majority host species based on all Silene plants, using the extensive studies of this population that were carried out by Biere and co-workers between 1991-93 and involved all (healthy, infected and vegetative) host plants present within a flowering season (Biere and Honders 1996b;

1998). In 1993, out of 57 examined sections covering 16m each, 40 were diseased and in all cases the majority host species based on diseased plants and on both healthy and diseased plants corresponded.

Furthermore, since we have pooled data from different years, we make the assumptions that a) the defined patches are reasonably stable with respect to number and density of host plants over these years, and b) smut samples from plants within a certain patch between the different years represent different individuals (otherwise, they would be pseudo-replicates in the analysis). Indeed, patches were found to be rather stable in this population. Between 1991-93, out of 57 examined sections covering 16m each, only two were newly colonized or got extinct, and less than 4% changed in majority host type, mainly due to the few numbers of plants in those sections. Although S. latifolia are in general thought to be shorter-lived perennial plants than S. dioica (cf. Prentice 1979), turnover rates of the flowering population were found to be comparable for both species, up to about 50% per year (A. Biere, personal communication). Finally, none of the smut samples that were sampled shared the exact x-y coordinates, and can safely be regarded to be sampled from different individual host plants.

Attempts to analyze the molecular data from Norg by calculating FST and RST values and comparing them over the different hierarchical levels, i.e. host species and patch structure, failed due to low sample size (n=38). Also, it turned out that we have been unfortunate in collecting teliospores in 1998, and sampled for the microsatellite analysis predominantly from patches where S. latifolia was the majority host type.

Therefore, we plotted the genotypes graphically and analyzed only the randomness of the distribution of alleles over patches with a simple chi-square test, deriving the expected frequencies from the overall frequencies in the population and comparing them to the observed frequencies in a patch. Since sample sizes within patches were small, we decided to be conservative, and have tested the deviations from a random distribution at a Bonferroni corrected critical probability = 0.05 / k, with k=16 for the 16 examined alleles, yielding a critical 2[1] value of 8.73.

In the flowering season of 2001, the Norg population has been sampled again, collecting teliospores from a much larger number of S. latifolia, S. dioica and hybrid hosts, which is currently being analyzed for these four microsatellite loci.

Unfortunately, these data could not be analyzed within the time span of writing this thesis.

T Seven out of 10 allopatric S. dioica populations and seven out of 8 allopatric S.

latifolia populations were fixed for their SCC type, resulting overall allele frequencies of >95% of the yellow (y) allele in the S. dioica hosts and >98% of the pink (+) allele in S. latifolia hosts, as is visualized in figure 1. This host-specific differentiation of the SCC locus is highly significant (2=153.7;

df=17;

p<0.0001).

Host-related differentiation + + in allopatric populations of host y y species in the anther smut fungus Microbotryum violaceum. Displayed are allele frequencies of the pink (+) and yellow (y) allele of the Sporidial Colony Color locus in 8 populations of Silene latifolia (52 samples), and 10 populations of S. dioica ( Host sp.**** samples). The allele frequencies between host species are significantly Allopatric S. dioica Allopatric S. latifolia different with p<0.0001.

T Figure 2 shows the geographic distribution of the SCC pink and yellow alleles in anther smuts of S. latifolia and S. dioica hosts pooled over six flowering seasons.

This picture shows that the host population structure can roughly be described with S.

dioica occurring midway and S. latifolia at both ends of the road.

SCC locus S. latifolia +/+ S. dioica +/+ S. latifolia +/y S. dioica +/y S. latifolia y/y S. dioica y/y - - 0 100 200 300 400 500 600 700 800 Distance along road (m) Spatial and host-related distribution of fungal genotypes of Microbotryum violaceum with respect to a Sporidial Colony Color locus in the Norg population. Circles represent Silene latifolia, and triangles represent S. dioica. Open symbols represent homozygous pink (+/+) genotypes, black symbols represent homozygous yellow (y/y) genotypes, and grey symbols represent heterozygous pink/yellow (+/y) genotypes. Note that the scaling on the axes is quite different, covering 20m on the y-axis and 900m on the x-axis.

Host-related differentiation in the anther smut Microbotryum + + y y violaceum in a sympatric population of the host species Silene dioica and S. latifolia. Displayed are allele frequencies of the pink (+) and yellow (y) allele of a Sporidial Colony Color locus in the Norg population of S.

latifolia (103 smut samples from years), and S. dioica (104 samples Host sp.** from 6 years). The allele frequencies Norg S. dioica Norg S. latifolia between host species are significantly different with p<0.007.

Moreover, in smut from S. dioica all three genotypes (+/+, y/y, and +/y) were observed frequently, whereas the y/y genotype was scarce in smut from S. latifolia hosts. The host differentiation as observed in allopatric host populations also held true for the Norg population of anther smuts (Figure 3;

2=7.56;

df=1;

p<0.007), although the overall frequency of the pink allele was significantly lower than in the allopatric samples from S. latifolia (2=7.60;

df=1;

p<0.006), and the overall frequency of the yellow allele was lower than in the allopatric samples from S. dioica (2=38.8;

df=1;

p<0.0001). Also, figures 1 and 3 clearly show that the differences between allopatric Distance from road (m) (A) and sympatric (S) populations are much larger in the samples from S. dioica (A 95% vs. S 56%) than in samples from S. latifolia (A 98% vs. S 94%).

Effects of local patch structure on the degree of host-specific differentiation in the anther smut fungus S. latifolia Microbotryum violaceum in a sympatric + + population of its host species Silene y y dioica and S. latifolia. Displayed are allele frequencies of the pink (+) and yellow (y) allele of a Sporidial Colony Color locus in the Norg population for S. latifolia (a, b), and S. dioica (c, d).

The left side of the diagram (a, c) represents the patches where S. dioica is ab the majority type (n=14), the right side S. dioica# of the diagram (b, d) represents the + + patches where S. latifolia is the majority y y type (n=14). In this diagram, pooled data from six years within 1991-98 are shown. For each host species separate tests are given for the effect of PATCH TYPE on the allele frequency of the native allele in that host (+ for S.

latifolia, and y for S. dioica). In a cd combined test for the two host species, the interaction effect PATCH TYPE * SPECIES on the frequencies of the > 50 % S. dioica > 50 % S. latifolia native alleles is significant with PATCH TYPE p<0.05. Significance levels designated in the separate tests;

# p=0.16;

p=0.07.

The degree of host-specific differentiation was significantly affected by local patch composition (the interaction effect PATCH TYPE * HOST SPECIES;

p<0.05).

This interaction is illustrated in figure 4. The frequency of the native allele is higher when host species occur in patches dominated (>50%) by conspecifics (Figure 4b,c) than when host species occur in patches dominated by heterospecifics (Figure 4a,d). In other words, the frequency of the pink allele is larger on the native host S. latifolia when this host is surrounded by other S. latifolia (Figure 4b) than when it is surrounded by S. dioica (Figure 4a). Likewise, the frequency of the yellow allele is larger on the native host S. dioica when this host is surrounded by other S. dioica (Figure 4c) than when it is surrounded by S. latifolia (Figure 4d).

Locus 6 aa a = aa b = c = 18 aa 8 aa ac aa aa aa aa ac aaaaaa ac ac bc aa aa aa aa aa aa aaaa aa aa aa aa aa aa aa aa aa aa aa - S.latifolia aa S.dioica aa aa Hybrids bb - Locus 11 ac a = ac b = cc c = ac ac ac ac ac ac ac bc bcac aa bc bc bc ac ac ac ac cc acbc bc aa cc ac ac ac bc ac cc cc -4 bb S.latifolia cc S.dioica bc ac Hybrids aa - 0 100 200 300 400 500 600 700 800 Distance along road (m) Graphical representation of the genetic diversity in the fungal pathogen Microbotryum violaceum on microsatellite loci 6 and 11 in the Norg population. Open circles represent fungal isolates from Silene latifolia, filled circles isolates from S. dioica, and gray circles from interspecific hybrids. Note that the scaling on the axes is quite different, covering 20m on the y-axis and 900m on the x-axis.

Distance from road (m) Locus cc a = cc b = c = 20 bb 8 cc d = cc ac bb bb cc cc ccacbbcc cc cc cc cc cc bb bb cc bb bc bb bb cc cc bb bb cc bb dd cc cc - S.latifolia aa S.dioica bb ad Hybrids bb - Locus cc a = cc b = c = 28 cg cc d = 29 cc cc cc cc e = cc f = 3 cc g = ggcg 4 fg cc fg gg bb cc cc ffgg bc accc bg dd bg ee ff be cc gg ee cc gg - S.latifolia dd S.dioica bc fg Hybrids aa - 0 100 200 300 400 500 600 700 800 Distance along road (m) Graphical representation of the genetic diversity in the fungal pathogen Microbotryum violaceum on microsatellite loci 14 and 18 in the Norg population. Open circles represent fungal isolates from Silene latifolia, filled circles isolates from S. dioica, and gray circles from interspecific hybrids. Note that the scaling on the axes is quite different, covering 20m on the y-axis and 900m on the x-axis.

Distance from road (m) Most frequent alleles of four microsatellite loci in the fungal pathogen Microbotryum violaceum in host patches of Silene latifolia and S. dioica with more than one genotyped fungal specimen. Patches are indicated by their x-coordinate range, and patch type is indicated by the dominant host species.

= Marks the more rare alleles that are locally (co-)dominating a patch. # = Allele was not present in one of these patches, but appeared in a patch with only one genotyped individual.

Patch Patch type Locus 6 Locus 11 Locus 14 Locus (x-coordinate) (dominant host species) 6 8 # 18 13 14 15 16 19 20 21 16 17 28 29 31 34 28-43m S. latifolia 138-178m S. latifolia 539-542m S. dioica 663-683m S. latifolia 696-702m S. latifolia 703-708m S. latifolia 730-753m S. latifolia 808-810m S. latifolia Total frequency -.92.01.07.32.14.54.05.36.55.04.01.09.46.05.07.08. The microsatellite analysis, as presented previously in chapter 2, revealed no significant population subdivision with respect to the hierarchical level host species (Van Putten et al. chapter 2;

FST = 0.046, RST = 0.035 (the deviancies from zero were only marginally significant, with 0.05

Results of the Chi-square test for randomness of distribution of alleles over the patches, for each of the 16 alleles from the four microsatellite loci. The significance threshold was Bonferroni /16, 0. yielding the conservative Significance threshold cri value of 8.73.

[1] Six out of the 16 alleles 10 turned out to be not randomly distributed over the population, but were clustered in patches. The 0.0 0.2 0.4 0.6 0.8 1. s represent two separate points plotted on top of Allele frequency in the population each other.

Chi-square Figure 6 provides some statistical support for this rather qualitative statement. In six out of the 16 alleles, the chi-square analysis showed that the distribution of alleles over the eight patches was non-random, especially for the more rare alleles. In this analysis, the distribution of the alleles from loci 6 and 11 did not deviate from randomness at this conservative significance threshold.

I I The allelic distribution at one of the sporidial colony loci (SCC) indicated strong divergence of host races in allopatric populations of hosts, at least in populations in Western Europe. Since this divergence was observed in a number of geographically different populations, it may well represent long-term divergence between both host races. The host-specific differentiation observed for in the SCC marker was consistent with the molecular marker studies of Bucheli and colleagues (2001) and chapter 2 of this thesis, confirming once again clear and separated host races of M. violaceum (Zillig 1921) on S. latifolia and S. dioica. Strains from these host species arein contrast to an early study by Baker (1947)able to cross-infect each others host species (Biere and Honders 1996a), without a priori being at a disadvantage on the alien host species (Biere and Honders 1996a;

Van Putten et al.

chapter 4).

T Overall, looking at the SCC distribution of alleles there is significant divergence between the host races in sympatric populations of host species, despite the fact that the microsatellite data indicate there is gene flow between smuts from S.

latifolia and from S. dioica in the range of 1 to 3 migrants per generation (Van Putten et al. chapter 2). Gene flow caused significant lower allele frequencies relative to allopatric populations of the yellow allele in smut isolated from S. dioica hosts in particular, but also of the wild type pink allele in smut isolated from S. latifolia hosts.

Nevertheless, the pattern of variation observed in allopatric and sympatric host populations of the SCC marker is clearly different from what is observed in microsatellites (Van Putten et al. 2001), suggesting that the SCC locus might not be as neutral as the microsatellite loci. Presence of the wild type pink allele or the yellow allele at the SCC locus results in the production of lycopene and -carotene respectively, in the carotenogenesis pathway (cf. Garber et al. 1975). Lycopene is a precursor of -carotene in carotenogenesis, and its transformation requires an active cyclase that is inactive in the wild type. A study examining carotenoids in rust fungi, a related order of plant parasitic fungi, showed that variation in the amount of carotenes was negatively associated with the amount of pigment in spore-walls (Zwetko and Pfeifhofer 1991). Spores with strongly pigmented walls contained little carotene in their cytoplasm and vice versa. Pigmented spore-walls may provide protection against high light intensities, or UV radiation. Extrapolating this to the anther smut fungus and the variation at the SCC locus, the different genotypes may be subject to host specific selection pressures that could oppose gene flow and contribute to the observed pattern of variation. However, S. dioica is better adapted to low light intensities than S. latifolia (Willmot and Moore 1973), hence we would expect just the opposite pattern for the distribution of alleles of the SCC locus for this pair of host species. Nevertheless, if natural selection, acting on the SCC locus itself or on loci linked to this locus, is high relative to gene flow, it might facilitate host specialization.

In the traditional view, host specialization is driven by genetic trade-offs in performance, which would be the result of antagonistic pleiotropy. In the Microbotryum-Silene system, there is not much evidence for such trade-offs. In a cross inoculation study by Biere and Honders (1996a), strains did not have a higher virulence on conspecifics of the host of origin, but a three-fold higher spore production was observed on infected male plants of the native host species. Recent models have shown that, even without such performance trade-offs for which little evidence is found in the literature (Jeanike 1990), the non-equilibrium frequency dependent cycling of allele frequencies of resistance and virulence loci itself can drive the evolution of host specialization in parasites capable of host choice, given that there is genetic variation in host preference (Kawecki 1998). However, since the pollinators vector the teliospores of this anther smut, host choice is a feature of the vectors rather than of the pathogen. Hence, host specialization of this fungus will largely depend on interactions with its insect vectors, e.g. host fidelity of pollinators (Van Putten et al.

chapter 5).

T In the Norg population, the host plants provide a heterogeneous environment for the pathogen in three different ways. First and foremost, the host plants are different species. Second and of prime interest to this study, the host plants grow spatially in patches due to differential habitat preferences (Goulson and Jerrim 1997).

Third, the flowering phenology between S. latifolia and S. dioica has been reported to be different, yielding a temporally heterogeneous environment, with S. dioica flowering earlier than S. latifolia, and males flowering earlier than female hosts (Biere and Honders 1996b). Therefore, we expected that the population of M. violaceum in Norg is not panmictic, but consists of a number of demes that genetically structure the population, as often found for phytophagous insects (Mopper 1996). Indeed, we found weak evidence for effects of local host spatial structure on differentiation among fungal isolates within this sympatric host population. Smut samples isolated from S.

latifolia in patches where S. latifolia was the majority type had a higher frequency of the wild type pink allele (the S. latifolia allele in allopatric host populations) than smut from S. latifolia in patches where S. dioica was the majority type. Conversely, smut from S. dioica in a S. dioica patch had a higher frequency of the yellow allele (the S.

dioica allele in allopatric host populations) than smut from S. dioica in S. latifolia patches. Although sample size of the microsatellite analysis was small (n=38), the results support the hypothesis of a more local distribution of alleles, which was most apparent for the more rare alleles. Unfortunately, smut spores that were collected in 1998 were sampled from seven S. latifolia dominating patches and from only one S.

Pages:     || 2 | 3 |



2011 www.dissers.ru -

, .
, , , , 1-2 .