Добро пожаловать!

Pages:     | 1 ||

«Министерство здравоохранения Российской Федерации, Северо-Западное отделение РАМН Главное Военно-медицинское управление МО РФ, Российская Военно-медицинская академия, Комитет по здравоохранению ...»

-- [ Страница 2 ] --

21. Postic D., Assous M., Grimont P.D.A. and Baranton G. Diversity of Borrelia burgdorferi sensu lato evidenced by restriction frag ment length polymorphism of rrf(5S) – rrl(23S) intergenic spaser amplicons. Int. J. Syst. Bacteriol. 1994, 44: 743-752.

34 www.tick.ru гена является высокий процент ложноположительных реакций. Од ВЫДЕЛЕНИЕ И ИЗУЧЕНИЕ НЕКОТОРЫХ СВОЙСТВ ИЗО ВЫДЕЛЕНИЕ И ИЗУЧЕНИЕ НЕКОТОРЫХ СВОЙСТВ ИЗО нако если учесть, что эти тесты применяются для подтверждения ЛЯТОВ BORRELIA BURGDORFERI SENSU LATO ИЗ КЛИНИ ЛЯТОВ BORRELIA BURGDORFERI SENSU LATO ИЗ КЛИНИ диагноза, основанного на клинических данных, а не для массовых ЧЕСКИХ ОБРАЗЦОВ И ВЕКТОРОВ-ПЕРЕНОСЧИКОВ.


скрининговых исследований, то это не является принципиальным недостатком. Планшеты для ELISA с антигенной подложкой Штанников А.В1., Баранова Е.В1., Евсегнеев С.И1., Решетняк Т.В1., Borrelia burgdorferi sensu stricto Taldom №17 были сравнены с Реполовская Т.В1., Прилипов А.Г4.,Колосова Н.В1., Наумов Р.Л3., Би Вorrelia(Lyme)TEST производства фирмы ImmunoWELLR. По спе кетов С.Ф1, Ананьева Л.П2.

цифичности их характеристики одинаковы.

В заключении необходимо сказать, что, учитывая полиморфизм Государственный Научный Центр Прикладной Микробиологии, антигенов боррелий в зависимости от их географического ареала, Оболенск1;

Институт ревматологии РАМН, Москва2;

Институт ме необходимо дальнейшее расширение коллекции штаммов возбуди дицинской паразитологии и тропической медицины им. Марцинов теля, а также проведение генетических работ по изучению природы ского3, Москва;

Институт вирусологии им. Ивановского, Москва4.

боррелиозных генов и их клонированию. Это позволит создавать комбинации антигенов, обладающие наряду с высокой чувствитель ностью необходимой специфичностью.

При культивировании в среде BSK II 15 клинических био ЛИТЕРАТУРА.

птатов, а также 10 клещей удалось выделить 3 изолята 1. Аnonymous (1995) Lyme disease. United States, 1994. Morbid.

Borrelia burgdorferi sensu lato(2 клинических и 1клещевой).

Mortal. Week Rep. 44, 459-462.

Генотипирование этих изолятов было осуществлено мето 2. Nocton. J.J. and Steere, A.C. (1995 ) Lyme disease. Adv. Intern.

дом PCR-RFLP анализа. Оба клинических варианта оказа Med. 40, 69-115.

лись B. garinii, а клещевой вариант – B.burgdorferi sensu 3. Centers for Disease Control: Lyme disease – United States, 1994.

stricto. Штаммам была присвоена следующая аббревиатура:

MMWR Morb Mortal Wkly Rep. 1995;

44:459-462. Borrelia burgdorferi sensu stricto Taldom №17, B. garinii Siu и B.garinii Col. При сравнении антигенного спектра выделен 4. Jaenson TGT. The epidemiology of Lyme borreliosis. Parasitol ных штаммов с лабораторными штаммами Borrelia Today.1991;

7: 39-45.

burgdorferi sensu stricto B31 и 39/40 у штаммов Siu и Col на 5. Коренберг Э.И. Боррелиозы. В: В.И. Покровский.(ред). Ру блюдалась мажорная дополнительная полоса в области ководство по эпидемиологии инфекционных болезний. М., кДа, а у штамма №17 качественные и количественные раз Медицина, 1993,3, с.382-391.

личия наблюдались в Western-блотте в области 18-25, 29- 6. Коренберг Э.И. Иксодовые клещевые боррелиозы как группа и 57кДа. Штамм Borrelia burgdorferi sensu stricto №17 был заболеваний человека и главные итоги её изучения в России.

наработан в препаративных количествах и использовался Журн. Инфекц.патол. 1996, 3(4):22-24.

как корпускулярный антиген для НРИФ, а также для полу 7. Коренберг Э.И., Горелова Н.Б., Постик Д. и др. Резервуар чения клеточных лизатов при разработке иммунофермент ные хозяева и переносчики боррелий – возбудителей иксо- ной тест системы(ELISA).

довых клещевых боррелиозов в России. Журн. Микробиол.

Болезнь Лайма (клещевой боррелиоз) – глобально распростра 1997, 6: 36-38.

нённый по всему северному полушарию зооноз. Главными этиоло 8. А.Н. Алексеев. Антропогенный пресс, патоморфология пе гическими агентами, вызывающими заболевание, в настоящее время реносчика, обилие возбудителя болезни Лайма. Докл. Акад.

считаются в Северной Америке - Borrelia burgdorferi sensu stricto, а Наук. 1995, т.340, № 4, 563-565.

в Старом свете - Borrelia burgdorferi, Borrelia garinii и Borrelia 9. Ананьева Л.П., Барскова В.Г., Скрипникова И.А., Насонова afzelii. К этому списку с некоторыми оговорками добавляют также В.А. Лайм-артрит. Тер. Архив, 1993, №12, 82-87.

Borrelia bissettii. sp. nov и Borrelia valaisiana (1 – 4).

46 www.tick.ru Территория России является наиболее протяжённым районом номичнее готовить среду в лабораторных условиях, а не использо Лайм-инфекции в мире, так как болезнь регистрируется от побере- вать её фабричные аналоги.

жья Балтийского моря до Тихого океана(5,6). Основными перенос- Высокий процент заражения посторонней микрофлорой клини чиками являются таёжный клещ Ixodes persulcatus и лесной клещ ческих биоптатов указывает на то, что их забор следует проводить в Ixodes ricinus(7). По предварительным данным института медицин- специальных боксах. Добавление антибиотиков в среду не всегда ской паразитологии и тропической медицины им. Марциновского и благоприятно сказывается на первых этапах выделения боррелий.

Зоологического института РАН(8) обсеменённость клещей спирохе- Типирование новых изолятов боррелий необходимо для систе тами Borrelia burgdorferi sensu lato в зависимости от района их сбо- матики, составления эпидемиологических карт и клинического про ра и сезона составляет в разные годы от 25 до 60%. гноза течения заболевания. Наиболее удобна для этого ПЦР - диаг В России фундаментальные исследования болезни Лайма до не- ностика. Метод достаточно производителен и, главное, не требует давнего времени практически не проводились. Это связано с тем, выделения микроорганизмов. Для таксономии боррелий чаще всего что наработка больших количеств биомассы боррелий сопряжена со используют PCR-RFLP анализ и PCR-RLB-анализ. Первый вариант значительными трудностями из-за чрезвычайной требовательности проще в методическом отношении, поэтому мы остановились на боррелий к условиям культивирования. Доступная информация о нём. Правда, анализ картины распределения рестриктов требует культивировании боррелий и выделении их антигенных детерми- наличия ДНК эталонных штаммов. В нашем распоряжении имелись нант в отечественной литературе отсутствует. Эксмериментальные только штаммы Borrelia burgdorferi sensu stricto. Поэтому, при ти работы ограничиваются, в основном, наблюдениями в клинике, сбо- пировании штаммов Siu и Col дополнительно использовались лите ром клещей в полевых условиях и систематическими исследова- ратурные и клинические данные, а также результаты определения ниями. (9 - 17). последовательности OspA гена (данные не приведены). Вероятно, Хотя имеются отдельные устные сообщения о разработке оте- ПЦР-диагностику всегда целесообразно совмещать с другими мето чественных препаратов (18), серодиагностика заболевания с помо- дами генотипирования, например, с сиквенсом какого- либо консер щью иммуноферментного метода в российских медицинских учре- вативного гена.

ждениях проводится только на основе зарубежных тест-наборов. В настоящее время метод НРИФ является в России основным Целью нашей работы было, во-первых, воспроизвести результа- при серодиагностике болезни Лайма. Корпускулярный антиген ты по культивированию и генотипированию боррелий, полученные Borrelia burgdorferi Taldom №17 получил хорошие отзывы при ла зарубежными авторами. Во-вторых, оптимизировать условия куль- бораторных испытаниях в различных регионах России. Однако глав тивирования, варьируя различные параметры внешней среды и ком- ный упор был сделан на создании иммуноферментных тест-ситем, поненты среды BSK II. В-третьих, попытаться разработать тест- как более надёжных и перспективных.

системы для серодиагностики на основе антигенов отечественных Импортные иммуноферментные диагностикумы «Merdox», изолятов боррелий. «Immunitix» и др., используемые в России, дают положительную Материалы и методы. реакцию не более, чем в 30% случаев клинически подтверждённого Бактериальные штаммы. В работе использовались лабора- диагноза болезни Лайма. В качестве антигенных компонентов в них торные штаммы Borrelia burgdorferi sensu stricto B31 и 39/40. Они используются наборы антигенов, присущих боррелиям тех стран, были получены от проф. Карша из Института гигиены и микробио- где они выявлены. Между тем уже доказано, что антигенные спек логии Вюрцбургского университета и доктора Стира из Медицин- тры спирохет даже близко расположенных географических зон мо ской школы Тафтского университета, соответственно, а также гут существенно отличаться. По предварительным результатам, по штаммы Borrelia burgdorferi sensu stricto Taldom №17, B. garinii Siu лученные на основе российских изолятов образцы тест-систем, и B. garinii Col, выделенные авторами статьи. практически в два раза превосходят по чувствительности импорт Условия культивирования. Отработку условий выделения и ные.

наработки биомассы боррелий проводили в среде BSKII(19,20) и её Основной проблемой в серодиагностике Лайм - боррелиозов модификациях. Культивирование вели в пластиковых одноразовых при использовании тестов на основе суммарного клеточного анти 36 www.tick.ru пробирках или в пробирках из нейтрального стекла с плотно закру Видно, что штамм Taldom №17 обладает самым большим набо- чивающимися крышками, заполненными средой на 90%. Пробирки ром иммунореактивных антигенов. В его препарате хорошо пред- инкубировали в термостате при 33С в течение 12 недель. Рост бор ставлены все диагностически значимые полосы с молекулярной релий контролировали еженедельно с помощью темнопольного массой 93, 80, 66, 60, 58, 45, 41, 39,37, 34, 31, 28, 25, 21, 18 кДа. микроскопа (Yenoval,х250)., а также по изменению окраски среды.

Штамм Borrelia burgdorferi sensu stricto №17 был наработан в Концентрация боррелий в эталонных и рабочих культурах опреде препаративных количествах и использовался, как корпускулярный лялась как среднее число боррелий, полученное при просмотре антиген для НРИФ, а также в качестве антигенной подложки при полей зрения, умноженное на 106.

разработке иммуноферментной тест - системы(ELISA). Опытные Выделение боррелий из клещей. 20 клещей были получены из образцы антигена для НРИФ были разосланы в 10 регионов России. СЭС Серпуховского района Московской области. Сбор клещей в Из 7 получен ответ, что препарат не уступает по своим свойствам полевых условиях проводился в Tалдомском районе Московской гамалеевскому антигену Ip21. Иммуноферментный тест прошёл области флагом в мае месяце 2000г. Клещи помещались в специаль предварительную проверку в институте ревматологии и показал ные пробирки и хранились при 4С. Перед культивированием каж 70% чувствительность(IgG плюс IgM) с сывороткам от больных с дый клещ 10 минут инкубировался в 70% этаноле и затем трижды клинически подтверждённым диагнозом болезни Лайма. При анали- промывался по 60 секунд в стерильной дистиллированной воде. В зе специфичности наблюдались перекрёстные реакции с сыворотка- дальнейшем клещи помещались в стерильную ступку с 50мкл PBS и ми от больных сифилисом и лептоспирозом. растирались пестиком до гомогенного состояния в течение 1-2 ми Обсуждение. Организация мониторинга за возбудителем Лайм - нут. Для предварительной оценки обсеменённости клещей борре боррелиоза на территории России является актуальной задачей (5- лиями 15 мкл образца наносили на предметное стекло и просматри 7,11,13,14). Однако создание представительной коллекции, изучение вали не менее 100 полей зрения. Оставшуюся часть инокулировали антигенного состава российских изолятов и конструирование имму- в пробирку со средой BSK II. Чтобы предотвратить контаминацию нохимических тест – систем подразумевает возможность выделения посторонней микрофлорой I добавляли антибиотики в следующих и культивирования боррелий. Между тем стоимость 1 литра им- концентрациях: рифампицин – 50 мкг/мл, амфотерицин В – 2, портной среды равняется 150 долларам США, что ограничивает её мкг/мл, фосфомицин – 20 мкг/мл, ципрофлоксацин – 0,5 мкг/мл.

применение при наработке биомассы в препаративных количествах. Пробирки, засеянные гомогенатом клещей, помещали на 33° С и ин Поэтому была проведена работа по приготовлению среды BSK II кубировали в течение 12 недель.

самостоятельно(at home). Выяснено, что при использовании им- Выделение боррелий из кожных клинических биоптатов.

портных реактивов высокого качества полученная среда превосхо- Операционное поле тщательно дезинфицировалось спиртовой на дит фирменный аналог complete media BSK H (Sigma). На свойства стойкой йода, и из пограничной области мигрирующей эритемы среды заметно влияет способ её приготовления. Эксперименты по специальным панчем брался кожный лоскут площадью 6 мм2 так, замене наиболее дорогостоящих компонентов отечественными ана- чтобы захватить ткань по обе стороны границы эритемы. Первые логами показали, что их можно использовать для наработки боль- дней биоптаты инкубировались в 1мл центрифужных пробирках в ших количеств биомассы боррелий, когда посевная доза велика и не среде BSK II без кроличьей сыворотки, затем супернатант и биоптат требуется высокая чувствительность среды. Так как российский порознь переносили в пробирки с 10 мл полной средой BSK II. Про бычий сывороточный альбумин на порядок дешевле импортного, то бирки инкубировались при 33· С в течение трёх месяцев.

это является существенным моментом. Для выделения боррелий из Генотипирование штаммов боррелий методом RFLP-PCR различных источников пока приходится пользоваться BSK II из им- анализа. Nested PCR осуществляли с помощью двух пар праймеров портных реактивов. Низкое качество фирменной среды, вероятно, к 3’ концу первого 5S рРНК гена(rrfA) и 5’концу второго 23S рРНК связано с тем, что при доставке её в Россию не всегда соблюдаются гена(rrlB): 23SN1 (5'-ACCATAGACTCTTATTACTTTGAC) и 23SC необходимые условия хранения. Возможно также колебание (5' –TAAGCTQACTAATACTAATTACCC) - для первого этапа ам свойств от партии к партии. Таким образом, целесообразнее и эко- плификации;

23SN2 (5' –ACCATAGACTCTTATTACTTTGACCA) и 44 www.tick.ru 5SCB (S'-GAGAGTAGGTTATTGCCAGGG) –для второго литературе для штаммов B. garinii. На основании этой информации, (21,22).Реакционная смесь для первого этапа состояла из: 2,5мкл 10х а также по результатам сиквенса ДНК OspA гена (данные не приве реакционного буфера;

2,5 мкл 2мМ dNTP, 0,25 мкл Taq- дены), штамм Taldom №17 был типирован, как Borrelia burgdorferi полимеразы(5ед/мл);

по 0.5 мкл праймеров(5pmol);

5 мкл образца, sensu stricto, а штаммы Siu и Col, как B. garinii.

вода до 25 мкл. Смесь перемешивали пипетированием, наносили Электрофоретическая и иммунохимическая характеристика сверху 6 капель вазелинового масла и помещали в микроцик- антигенных препаратов боррелий. Электрофоретический анализ лер(Mini cyclerTM MJ Research Inc, USA). Амплификацию проводили лизатов боррелий показал наличие широкого спектра белков, боль по программе: 94С – 1 мин;

затем 25 циклов: 94с-30 сек, 52С-30 шинство из которых были общими у всех штаммов. Однако наблю сек, 72С- 1 мин. Для проведения второго этапа готовили новую ре- дались и индивидуальные особенности. Так, препараты клиниче акционную смесь: 0,5 мкл 10х реакционного буфера;

0,25 мкл Taq- ских изолятов боррелий “Siu” и “Col” отличались от штамма клеще полимеразы(5ед/мл);

по 0.5 мкл праймеров(5pmol);

1,5 мкл 20мМ вого изолята “Taldom” и штамма B. burgdorferi sensu stricto 39/ dNTP, вода до 5мкл. Смесь подслаивали под масло в пробирку, и присутствием мажорной белковой зоны 25 кДа.

амплификацию проводили по программе: 94С – 1 мин;

40 циклов: Дополнительные отличия удалось выявить в Western - блоте, 94С - 30 сек, 55С – 30 сек, 72- 1 мин. К 12 мкл амплификата до- используя панель сывороток больных с клинически подтвержден бавляли 2мкл 50 мМ MgCl2, 1 мкл Tru 1I(Mse I). Смесь инкубирова- ным диагнозом болезни Лайма (Рис.2).

ли 1 час при 65С и наносили на акриламидный 16%гель с 6М моче виной, предварительно разбавив суспензию равным объёмом фор мамида. Распределение рестриктов анализировали после электро фореза в постоянном электрическом поле с Е=10в/см. В качестве эталона использовалась ДНК штамма Borrelia burgdorferi sensu stricto B31.

Иммунохимический анализ. Антигенный препарат боррелий получали ультразвуковой дезинтеграцией 5мл суспензии боррелий с концентрацией 109кл\мл на аппарате VirSonic 100. Режим обработки 3 раза по 15сек с 45сек перерывом. Полученный образец охлаждали на льду в течение 1 часа и затем центрифугировали при 5 000g 30мин. Для работы использовали супернатант. Концентрацию белка в образцах определяли по методу Лоури(23).

Для изучения белкового состава препараты боррелий анализи ровали в вертикальном SDS-электрофорезе по Лэммли (24). Элек трофоретическую сепарацию белков боррелий проводили в 12% по лиакриламидном геле.

Иммуногенную активность имеющихся препаратов оценивали в (ELISA) и методом Western-blot(25). В качестве специфических им муноглобулинов использовали сыворотки больных болезнью Лайма, предоставленные НИИ Ревматологии. Перенос белков из геля на нитроцеллюлозную бумагу(Nitrocellulose membrane, Рисунок 2. Иммуноблот антигенных препаратов боррелий с пулом Sigma)осуществлялся с помощью полусухого электроблоттера(26).

сывороток больных:

Участки неспецифического взаимодействия мембраны блокировали 1- природный изолят штамм “Taldom”;

2- штамм биоптата в течение 30 мин. раствором 5 % обезжиренного молока с 0.05 % “Siu”;

3- штамм биоптата “Col”;

4- штамм 39/40 (USA).

Твин 20 в 0.01 М фосфатно-солевой буфере, рН - 7.4. Далее мем 38 www.tick.ru боррелий обнаружено не было. В гомогенатах 10 клещей, собран- брану в течение часа инкубировали с сыворотками в разведении 1:

ных в Талдомском районе, в тёмном поле наблюдались спирохеты в 200. После отмывки мембрана обрабатывалась в течение 30 мин ра количестве одна-две в 100 полях зрения. В процессе трёхнедельного бочим разведением вторых антител против человеческих IgG и IgM, культивирования удалось выделить 1 вариант боррелий, получив- конъюгированных с пероксидазой хрена. Визуализацию специфиче ший название Taldom №17.После предварительной расчистки он ского иммунохимического взаимодействия на мембране проводили был отклонирован последовательным разведением до единичных субстратной смесью: 0.05 % диаминобензидина;

0.015 % Н2 О2;

клеток. 0.01 М ФСБ рН - 7.4.

Выделение боррелий из биоптатов. Из института Ревматологии Сыворотки. 209 образцов сывороток были получены из Инсти АМН Российской Федерации было получено 15 кожных биоптатов тута ревматологии (Москва). Из них 115 от больных с клинически от больных с клинически подтверждённым диагнозом болезни Лай- подтверждённым диагнозом болезни Лайма. Самые высокотитраж ма. Несмотря на предпринятые асептические мероприятия 7 из них ные сыворотки были объединены в пул, который использовался, как заросли посторонней микрофлорой. Из оставшихся образцов уда- положительный контроль. Референс сыворотки на сифилис и леп лось выделить 2 варианта, обозначенные по имени пациентов Siu и тоспироз были получены из ЦКВИ (Москва).

Kol. Вариант Siu выделился после 6 недель культивирования, а ва- Результаты.

риант Kol - после 12 недель. Оба варианта были отклонированы по- Оптимизация режима культивирования боррелий и моди следовательным разведением до единичных клеток. фикация питательной среды. Данных об особенностях метабо Идентификация выделенных вариантов. В результате Nested- лизма боррелий очень мало. Тем не менее, многолетние эмпириче PCR из всех изолятов были получены амплификаты в 225 пар осно- ские попытки привели к созданию так называемой среды BSK II, ваний, соответствующие фрагменту спейсерного участка между ри- пригодной для культивирования боррелий in vitro и выделения их босомальными генами rrfA и rrlB, которые в дальнейшем обрабаты- из различных источников. Рецептура среды с небольшими модифи вались ферментом Mse I (рис.1). кациями используется практически всеми исследователями, зани мающимися этой проблемой. Однако в России эта среда не произ водится. Это связано с тем, что для её состава нужны компоненты очень высокого качества.

На первом этапе работ основное внимание было уделено само стоятельному приготовлению среды BSK II(at home), так как из вестно, что её качество сильно зависит не только от свойств компо нентов, но и от порядка их смешивания. Для приготовления среды BSK II использовались реактивы только фирмы "Sigma", "Gibco" и "Difco". Контролем в экспериментах служила фирменная среда для боррелий – complete media BSK H(Sigma). Ниже приводится состав среды BSK-II и рекомендуемый способ её приготовления.

Готовую среду расфасовать в герметически завинчивающиеся культуральные ёмкости (пробирки, флаконы) так, чтобы заполнить их на 9/10 объема.

Среда сохраняет свои ростовые свойства в течение 2 месяцев Рисунок 1. Распределение Mse I –рестриктов ДНК из штаммов при хранении при +4oС и 1 год при - 20oС.

Borrelia burgdorferi sensu lato.

Видно, что распределение рестриктов у штамма В31 практиче ски совпадает с таковым у штамма Taldom №17. Рестрикционная картина у вариантов Siu и Col схожа с данными, преставленными в 42 www.tick.ru 32, 37, 39 и 40 градусов в термостате, как с повышенной концентра [A] Желатин 5,7% цией СО2, так и без него в течение 12 недель. Визуальный контроль В колбу на 2000 мл налить 300мл прогретой до 50С деио проводился каждые 2 дня.

низованной воды (= 12- 15 Мом). Добавить 17 г желатина При температуре 32oС и 37oС среда BSK II( at home) обеспечи и перемешивать до полного растворения. Автоклавировать вает рост культур из инокулюма 20-100 спирохет и итоговый выход при 1 атм. 30 минут.

боррелий 1-5·108 на миллилитр. Время генерации составляет при [B] В 300 мл прогретой до 50o С деионизованной воды раство мерно 7-9 часов. Визуально увеличение титра спирохет можно было рить:

наблюдать уже через 4 –5 дней, а максимальной плотности культура Neopepton 5 г достигает через 4-6 недель. Рост спирохет придонный. Осадок со Trypton 1 г стоит из довольно крупных рыхлых агрегатов, которые быстро осе Yeastolate 1 г дают при взбалтывании суспензии. При температуре 39oС рост рез Охладить до комнатной температуры и добавить в колбу ко замедляется, появляются длинные нитеобразные формы, а при [С].

40oС вообще прекращается.

[C] В колбу на 2000 мл добавить:

Присутствие углекислого газа не оказывало существенного Деионизированной воды 500 мл влияния на интенсивность размножения боррелий. Таким образом, 10х CMRL Medium – 1066 100 мл использование анаэростатов или иных специальных приспособле HEPES 6 г ний для культивирования боррелий необязательно.

Лимоннокислый натрий 0,7 г Фирменная среда BSK H по сравнению с приготовленной само D-глюкоза 5 г стоятельно средой BSK II обеспечивала в тех же условиях выход Пируват натрия 0,8 г лишь 107 боррелий на миллилитр.

N-ацетил-D-глюкоза мин 0,4 г Из 8 проверенных кроличьих сывороток только 3 стимулирова MgCl2·H2O 0,3 г ли рост боррелий, на уровне протестированной фирменной сыво Бикарбонат натрия 2,2 г ротки (Sigma). Они были наработаны в больших количествах и по L-глутамин 0,146 г мещены на хранение при -70С для использования в дальнейших [D] 143 мл 35% бычьего сывороточного альбумина прогреть до экспериментах.

37oС и добавить в колбу [С].

Инактивация системы комплемента прогревом сыворотки в те [E] 100 мл нормальной кроличьей сыворотки, профильтровать чение 20 мин при 56С обязательна, если среда засевается единич предварительно через Whatman # 1, а затем через стериль ными клетками. Если же инокулюм превышает 103 кл/мл, то при ный фильтр с диаметром пор 0,45 мкм.

рост биомассы наблюдается более интенсивно при использовании [F] Довести pH среды в колбе [C], содержащей компоненты интактных кроличьих сывороток. Присутствие в сыворотке не [B], [C], [D], до 7,5 5М раствором NaOH.

больших количеств гемоглобина не влияет на рост боррелий.

[G] Полученную смесь профильтровать сначала через стериль Замена самых дорогостоящих компонентов среды BSK II: V ный фильтр с диаметром пор 0,45 мкм, а затем – 0,22 мкм.

фракции бычьего сывороточного альбумина (Sigma) на отечествен [H] В колбу [C] стерильно добавить прогретый до 37С жела ный белок, а среды CMRL 1066(Gibco) на среду №199 даёт удовле тин [A] и кроличью сыворотку [E].

творительные результаты, если посевная доза превышает 1000 кле Отработка условий культивирования проводилась на штамме ток на мл. Выход биомассы составляет 6-8· 107 кл/мл.

Borrelia burgdorferi sensu stricto B31. Этот штамм является эталон Подобранные условия культивирования оказались оптималь ным лабораторным штаммом, что позволяет при отработке методи ными для всех используемых в работе штаммов боррелий.

ки сопоставлять результаты.

Выделение боррелий из клещей. При микроскопическом ана Различные разведения культур (105, 104, 103, 102 кл/мл) засева лизе содержимого кишечника 20 клещей, снятых с людей, обратив лись по 1-2 капли в пробирки со средой BSK II. На каждую точку шихся в разное время в Серпуховскую СЭС, ни в одном из случаев бралось по 3 пробирки. Пробирки инкубировались при температуре 40

Pages:     | 1 ||

© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.